mirror of
https://github.com/explosion/spaCy.git
synced 2025-08-27 23:45:01 +03:00
Merge branch 'v4' into unique-underscore-spans
This commit is contained in:
commit
0eb24dabd4
2
.github/ISSUE_TEMPLATE/01_bugs.md
vendored
2
.github/ISSUE_TEMPLATE/01_bugs.md
vendored
|
@ -10,7 +10,7 @@ about: Use this template if you came across a bug or unexpected behaviour differ
|
||||||
<!-- Include a code example or the steps that led to the problem. Please try to be as specific as possible. -->
|
<!-- Include a code example or the steps that led to the problem. Please try to be as specific as possible. -->
|
||||||
|
|
||||||
## Your Environment
|
## Your Environment
|
||||||
<!-- Include details of your environment. If you're using spaCy 1.7+, you can also type `python -m spacy info --markdown` and copy-paste the result here.-->
|
<!-- Include details of your environment. You can also type `python -m spacy info --markdown` and copy-paste the result here.-->
|
||||||
* Operating System:
|
* Operating System:
|
||||||
* Python Version Used:
|
* Python Version Used:
|
||||||
* spaCy Version Used:
|
* spaCy Version Used:
|
||||||
|
|
72
.github/azure-steps.yml
vendored
72
.github/azure-steps.yml
vendored
|
@ -1,67 +1,56 @@
|
||||||
parameters:
|
parameters:
|
||||||
python_version: ''
|
python_version: ''
|
||||||
architecture: ''
|
architecture: 'x64'
|
||||||
prefix: ''
|
num_build_jobs: 2
|
||||||
gpu: false
|
|
||||||
num_build_jobs: 1
|
|
||||||
|
|
||||||
steps:
|
steps:
|
||||||
- task: UsePythonVersion@0
|
- task: UsePythonVersion@0
|
||||||
inputs:
|
inputs:
|
||||||
versionSpec: ${{ parameters.python_version }}
|
versionSpec: ${{ parameters.python_version }}
|
||||||
architecture: ${{ parameters.architecture }}
|
architecture: ${{ parameters.architecture }}
|
||||||
|
allowUnstable: true
|
||||||
|
|
||||||
- bash: |
|
- bash: |
|
||||||
echo "##vso[task.setvariable variable=python_version]${{ parameters.python_version }}"
|
echo "##vso[task.setvariable variable=python_version]${{ parameters.python_version }}"
|
||||||
displayName: 'Set variables'
|
displayName: 'Set variables'
|
||||||
|
|
||||||
- script: |
|
- script: |
|
||||||
${{ parameters.prefix }} python -m pip install -U pip setuptools
|
python -m pip install -U build pip setuptools
|
||||||
${{ parameters.prefix }} python -m pip install -U -r requirements.txt
|
python -m pip install -U -r requirements.txt
|
||||||
displayName: "Install dependencies"
|
displayName: "Install dependencies"
|
||||||
|
|
||||||
- script: |
|
- script: |
|
||||||
${{ parameters.prefix }} python setup.py build_ext --inplace -j ${{ parameters.num_build_jobs }}
|
python -m build --sdist
|
||||||
${{ parameters.prefix }} python setup.py sdist --formats=gztar
|
displayName: "Build sdist"
|
||||||
displayName: "Compile and build sdist"
|
|
||||||
|
|
||||||
- script: python -m mypy spacy
|
- script: |
|
||||||
|
python -m mypy spacy
|
||||||
displayName: 'Run mypy'
|
displayName: 'Run mypy'
|
||||||
|
condition: ne(variables['python_version'], '3.6')
|
||||||
|
|
||||||
- task: DeleteFiles@1
|
- task: DeleteFiles@1
|
||||||
inputs:
|
inputs:
|
||||||
contents: "spacy"
|
contents: "spacy"
|
||||||
displayName: "Delete source directory"
|
displayName: "Delete source directory"
|
||||||
|
|
||||||
|
- task: DeleteFiles@1
|
||||||
|
inputs:
|
||||||
|
contents: "*.egg-info"
|
||||||
|
displayName: "Delete egg-info directory"
|
||||||
|
|
||||||
- script: |
|
- script: |
|
||||||
${{ parameters.prefix }} python -m pip freeze --exclude torch --exclude cupy-cuda110 > installed.txt
|
python -m pip freeze > installed.txt
|
||||||
${{ parameters.prefix }} python -m pip uninstall -y -r installed.txt
|
python -m pip uninstall -y -r installed.txt
|
||||||
displayName: "Uninstall all packages"
|
displayName: "Uninstall all packages"
|
||||||
|
|
||||||
- bash: |
|
- bash: |
|
||||||
${{ parameters.prefix }} SDIST=$(python -c "import os;print(os.listdir('./dist')[-1])" 2>&1)
|
SDIST=$(python -c "import os;print(os.listdir('./dist')[-1])" 2>&1)
|
||||||
${{ parameters.prefix }} SPACY_NUM_BUILD_JOBS=2 python -m pip install dist/$SDIST
|
SPACY_NUM_BUILD_JOBS=${{ parameters.num_build_jobs }} python -m pip install dist/$SDIST
|
||||||
displayName: "Install from sdist"
|
displayName: "Install from sdist"
|
||||||
|
|
||||||
- script: |
|
- script: |
|
||||||
${{ parameters.prefix }} python -m pip install -U -r requirements.txt
|
python -W error -c "import spacy"
|
||||||
displayName: "Install test requirements"
|
displayName: "Test import"
|
||||||
|
|
||||||
- script: |
|
|
||||||
${{ parameters.prefix }} python -m pip install -U cupy-cuda110 -f https://github.com/cupy/cupy/releases/v9.0.0
|
|
||||||
${{ parameters.prefix }} python -m pip install "torch==1.7.1+cu110" -f https://download.pytorch.org/whl/torch_stable.html
|
|
||||||
displayName: "Install GPU requirements"
|
|
||||||
condition: eq(${{ parameters.gpu }}, true)
|
|
||||||
|
|
||||||
- script: |
|
|
||||||
${{ parameters.prefix }} python -m pytest --pyargs spacy -W error
|
|
||||||
displayName: "Run CPU tests"
|
|
||||||
condition: eq(${{ parameters.gpu }}, false)
|
|
||||||
|
|
||||||
- script: |
|
|
||||||
${{ parameters.prefix }} python -m pytest --pyargs spacy -W error -p spacy.tests.enable_gpu
|
|
||||||
displayName: "Run GPU tests"
|
|
||||||
condition: eq(${{ parameters.gpu }}, true)
|
|
||||||
|
|
||||||
- script: |
|
- script: |
|
||||||
python -m spacy download ca_core_news_sm
|
python -m spacy download ca_core_news_sm
|
||||||
|
@ -104,13 +93,22 @@ steps:
|
||||||
displayName: 'Test assemble CLI vectors warning'
|
displayName: 'Test assemble CLI vectors warning'
|
||||||
condition: eq(variables['python_version'], '3.8')
|
condition: eq(variables['python_version'], '3.8')
|
||||||
|
|
||||||
|
- script: |
|
||||||
|
python -m pip install -U -r requirements.txt
|
||||||
|
displayName: "Install test requirements"
|
||||||
|
|
||||||
|
- script: |
|
||||||
|
python -m pytest --pyargs spacy -W error
|
||||||
|
displayName: "Run CPU tests"
|
||||||
|
|
||||||
|
- script: |
|
||||||
|
python -m pip install --pre thinc-apple-ops
|
||||||
|
python -m pytest --pyargs spacy
|
||||||
|
displayName: "Run CPU tests with thinc-apple-ops"
|
||||||
|
condition: and(startsWith(variables['imageName'], 'macos'), eq(variables['python.version'], '3.11'))
|
||||||
|
|
||||||
- script: |
|
- script: |
|
||||||
python .github/validate_universe_json.py website/meta/universe.json
|
python .github/validate_universe_json.py website/meta/universe.json
|
||||||
displayName: 'Test website/meta/universe.json'
|
displayName: 'Test website/meta/universe.json'
|
||||||
condition: eq(variables['python_version'], '3.8')
|
condition: eq(variables['python_version'], '3.8')
|
||||||
|
|
||||||
- script: |
|
|
||||||
${{ parameters.prefix }} python -m pip install --pre thinc-apple-ops
|
|
||||||
${{ parameters.prefix }} python -m pytest --pyargs spacy
|
|
||||||
displayName: "Run CPU tests with thinc-apple-ops"
|
|
||||||
condition: and(startsWith(variables['imageName'], 'macos'), eq(variables['python.version'], '3.10'))
|
|
||||||
|
|
9
.github/workflows/autoblack.yml
vendored
9
.github/workflows/autoblack.yml
vendored
|
@ -12,10 +12,10 @@ jobs:
|
||||||
if: github.repository_owner == 'explosion'
|
if: github.repository_owner == 'explosion'
|
||||||
runs-on: ubuntu-latest
|
runs-on: ubuntu-latest
|
||||||
steps:
|
steps:
|
||||||
- uses: actions/checkout@v2
|
- uses: actions/checkout@v3
|
||||||
with:
|
with:
|
||||||
ref: ${{ github.head_ref }}
|
ref: ${{ github.head_ref }}
|
||||||
- uses: actions/setup-python@v2
|
- uses: actions/setup-python@v4
|
||||||
- run: pip install black
|
- run: pip install black
|
||||||
- name: Auto-format code if needed
|
- name: Auto-format code if needed
|
||||||
run: black spacy
|
run: black spacy
|
||||||
|
@ -23,10 +23,11 @@ jobs:
|
||||||
# code and makes GitHub think the action failed
|
# code and makes GitHub think the action failed
|
||||||
- name: Check for modified files
|
- name: Check for modified files
|
||||||
id: git-check
|
id: git-check
|
||||||
run: echo ::set-output name=modified::$(if git diff-index --quiet HEAD --; then echo "false"; else echo "true"; fi)
|
run: echo modified=$(if git diff-index --quiet HEAD --; then echo "false"; else echo "true"; fi) >> $GITHUB_OUTPUT
|
||||||
|
|
||||||
- name: Create Pull Request
|
- name: Create Pull Request
|
||||||
if: steps.git-check.outputs.modified == 'true'
|
if: steps.git-check.outputs.modified == 'true'
|
||||||
uses: peter-evans/create-pull-request@v3
|
uses: peter-evans/create-pull-request@v4
|
||||||
with:
|
with:
|
||||||
title: Auto-format code with black
|
title: Auto-format code with black
|
||||||
labels: meta
|
labels: meta
|
||||||
|
|
6
.github/workflows/explosionbot.yml
vendored
6
.github/workflows/explosionbot.yml
vendored
|
@ -8,14 +8,14 @@ on:
|
||||||
|
|
||||||
jobs:
|
jobs:
|
||||||
explosion-bot:
|
explosion-bot:
|
||||||
runs-on: ubuntu-18.04
|
runs-on: ubuntu-latest
|
||||||
steps:
|
steps:
|
||||||
- name: Dump GitHub context
|
- name: Dump GitHub context
|
||||||
env:
|
env:
|
||||||
GITHUB_CONTEXT: ${{ toJson(github) }}
|
GITHUB_CONTEXT: ${{ toJson(github) }}
|
||||||
run: echo "$GITHUB_CONTEXT"
|
run: echo "$GITHUB_CONTEXT"
|
||||||
- uses: actions/checkout@v1
|
- uses: actions/checkout@v3
|
||||||
- uses: actions/setup-python@v1
|
- uses: actions/setup-python@v4
|
||||||
- name: Install and run explosion-bot
|
- name: Install and run explosion-bot
|
||||||
run: |
|
run: |
|
||||||
pip install git+https://${{ secrets.EXPLOSIONBOT_TOKEN }}@github.com/explosion/explosion-bot
|
pip install git+https://${{ secrets.EXPLOSIONBOT_TOKEN }}@github.com/explosion/explosion-bot
|
||||||
|
|
6
.github/workflows/slowtests.yml
vendored
6
.github/workflows/slowtests.yml
vendored
|
@ -14,7 +14,7 @@ jobs:
|
||||||
runs-on: ubuntu-latest
|
runs-on: ubuntu-latest
|
||||||
steps:
|
steps:
|
||||||
- name: Checkout
|
- name: Checkout
|
||||||
uses: actions/checkout@v1
|
uses: actions/checkout@v3
|
||||||
with:
|
with:
|
||||||
ref: ${{ matrix.branch }}
|
ref: ${{ matrix.branch }}
|
||||||
- name: Get commits from past 24 hours
|
- name: Get commits from past 24 hours
|
||||||
|
@ -23,9 +23,9 @@ jobs:
|
||||||
today=$(date '+%Y-%m-%d %H:%M:%S')
|
today=$(date '+%Y-%m-%d %H:%M:%S')
|
||||||
yesterday=$(date -d "yesterday" '+%Y-%m-%d %H:%M:%S')
|
yesterday=$(date -d "yesterday" '+%Y-%m-%d %H:%M:%S')
|
||||||
if git log --after="$yesterday" --before="$today" | grep commit ; then
|
if git log --after="$yesterday" --before="$today" | grep commit ; then
|
||||||
echo "::set-output name=run_tests::true"
|
echo run_tests=true >> $GITHUB_OUTPUT
|
||||||
else
|
else
|
||||||
echo "::set-output name=run_tests::false"
|
echo run_tests=false >> $GITHUB_OUTPUT
|
||||||
fi
|
fi
|
||||||
|
|
||||||
- name: Trigger buildkite build
|
- name: Trigger buildkite build
|
||||||
|
|
4
.github/workflows/spacy_universe_alert.yml
vendored
4
.github/workflows/spacy_universe_alert.yml
vendored
|
@ -17,8 +17,8 @@ jobs:
|
||||||
run: |
|
run: |
|
||||||
echo "$GITHUB_CONTEXT"
|
echo "$GITHUB_CONTEXT"
|
||||||
|
|
||||||
- uses: actions/checkout@v1
|
- uses: actions/checkout@v3
|
||||||
- uses: actions/setup-python@v1
|
- uses: actions/setup-python@v4
|
||||||
- name: Install Bernadette app dependency and send an alert
|
- name: Install Bernadette app dependency and send an alert
|
||||||
env:
|
env:
|
||||||
SLACK_BOT_TOKEN: ${{ secrets.SLACK_BOT_TOKEN }}
|
SLACK_BOT_TOKEN: ${{ secrets.SLACK_BOT_TOKEN }}
|
||||||
|
|
1
.gitignore
vendored
1
.gitignore
vendored
|
@ -24,6 +24,7 @@ quickstart-training-generator.js
|
||||||
cythonize.json
|
cythonize.json
|
||||||
spacy/*.html
|
spacy/*.html
|
||||||
*.cpp
|
*.cpp
|
||||||
|
*.c
|
||||||
*.so
|
*.so
|
||||||
|
|
||||||
# Vim / VSCode / editors
|
# Vim / VSCode / editors
|
||||||
|
|
|
@ -6,7 +6,7 @@ repos:
|
||||||
language_version: python3.7
|
language_version: python3.7
|
||||||
additional_dependencies: ['click==8.0.4']
|
additional_dependencies: ['click==8.0.4']
|
||||||
- repo: https://gitlab.com/pycqa/flake8
|
- repo: https://gitlab.com/pycqa/flake8
|
||||||
rev: 3.9.2
|
rev: 5.0.4
|
||||||
hooks:
|
hooks:
|
||||||
- id: flake8
|
- id: flake8
|
||||||
args:
|
args:
|
||||||
|
|
|
@ -8,7 +8,7 @@ be used in real products.
|
||||||
|
|
||||||
spaCy comes with
|
spaCy comes with
|
||||||
[pretrained pipelines](https://spacy.io/models) and
|
[pretrained pipelines](https://spacy.io/models) and
|
||||||
currently supports tokenization and training for **60+ languages**. It features
|
currently supports tokenization and training for **70+ languages**. It features
|
||||||
state-of-the-art speed and **neural network models** for tagging,
|
state-of-the-art speed and **neural network models** for tagging,
|
||||||
parsing, **named entity recognition**, **text classification** and more,
|
parsing, **named entity recognition**, **text classification** and more,
|
||||||
multi-task learning with pretrained **transformers** like BERT, as well as a
|
multi-task learning with pretrained **transformers** like BERT, as well as a
|
||||||
|
@ -16,7 +16,7 @@ production-ready [**training system**](https://spacy.io/usage/training) and easy
|
||||||
model packaging, deployment and workflow management. spaCy is commercial
|
model packaging, deployment and workflow management. spaCy is commercial
|
||||||
open-source software, released under the MIT license.
|
open-source software, released under the MIT license.
|
||||||
|
|
||||||
💫 **Version 3.4.0 out now!**
|
💫 **Version 3.4 out now!**
|
||||||
[Check out the release notes here.](https://github.com/explosion/spaCy/releases)
|
[Check out the release notes here.](https://github.com/explosion/spaCy/releases)
|
||||||
|
|
||||||
[](https://dev.azure.com/explosion-ai/public/_build?definitionId=8)
|
[](https://dev.azure.com/explosion-ai/public/_build?definitionId=8)
|
||||||
|
@ -79,7 +79,7 @@ more people can benefit from it.
|
||||||
|
|
||||||
## Features
|
## Features
|
||||||
|
|
||||||
- Support for **60+ languages**
|
- Support for **70+ languages**
|
||||||
- **Trained pipelines** for different languages and tasks
|
- **Trained pipelines** for different languages and tasks
|
||||||
- Multi-task learning with pretrained **transformers** like BERT
|
- Multi-task learning with pretrained **transformers** like BERT
|
||||||
- Support for pretrained **word vectors** and embeddings
|
- Support for pretrained **word vectors** and embeddings
|
||||||
|
|
|
@ -31,7 +31,7 @@ jobs:
|
||||||
inputs:
|
inputs:
|
||||||
versionSpec: "3.7"
|
versionSpec: "3.7"
|
||||||
- script: |
|
- script: |
|
||||||
pip install flake8==3.9.2
|
pip install flake8==5.0.4
|
||||||
python -m flake8 spacy --count --select=E901,E999,F821,F822,F823,W605 --show-source --statistics
|
python -m flake8 spacy --count --select=E901,E999,F821,F822,F823,W605 --show-source --statistics
|
||||||
displayName: "flake8"
|
displayName: "flake8"
|
||||||
|
|
||||||
|
@ -76,15 +76,24 @@ jobs:
|
||||||
# Python39Mac:
|
# Python39Mac:
|
||||||
# imageName: "macos-latest"
|
# imageName: "macos-latest"
|
||||||
# python.version: "3.9"
|
# python.version: "3.9"
|
||||||
Python310Linux:
|
# Python310Linux:
|
||||||
imageName: "ubuntu-latest"
|
# imageName: "ubuntu-latest"
|
||||||
python.version: "3.10"
|
# python.version: "3.10"
|
||||||
Python310Windows:
|
Python310Windows:
|
||||||
imageName: "windows-latest"
|
imageName: "windows-latest"
|
||||||
python.version: "3.10"
|
python.version: "3.10"
|
||||||
Python310Mac:
|
# Python310Mac:
|
||||||
imageName: "macos-latest"
|
# imageName: "macos-latest"
|
||||||
python.version: "3.10"
|
# python.version: "3.10"
|
||||||
|
Python311Linux:
|
||||||
|
imageName: 'ubuntu-latest'
|
||||||
|
python.version: '3.11.0'
|
||||||
|
Python311Windows:
|
||||||
|
imageName: 'windows-latest'
|
||||||
|
python.version: '3.11.0'
|
||||||
|
Python311Mac:
|
||||||
|
imageName: 'macos-latest'
|
||||||
|
python.version: '3.11.0'
|
||||||
maxParallel: 4
|
maxParallel: 4
|
||||||
pool:
|
pool:
|
||||||
vmImage: $(imageName)
|
vmImage: $(imageName)
|
||||||
|
@ -92,20 +101,3 @@ jobs:
|
||||||
- template: .github/azure-steps.yml
|
- template: .github/azure-steps.yml
|
||||||
parameters:
|
parameters:
|
||||||
python_version: '$(python.version)'
|
python_version: '$(python.version)'
|
||||||
architecture: 'x64'
|
|
||||||
|
|
||||||
# - job: "TestGPU"
|
|
||||||
# dependsOn: "Validate"
|
|
||||||
# strategy:
|
|
||||||
# matrix:
|
|
||||||
# Python38LinuxX64_GPU:
|
|
||||||
# python.version: '3.8'
|
|
||||||
# pool:
|
|
||||||
# name: "LinuxX64_GPU"
|
|
||||||
# steps:
|
|
||||||
# - template: .github/azure-steps.yml
|
|
||||||
# parameters:
|
|
||||||
# python_version: '$(python.version)'
|
|
||||||
# architecture: 'x64'
|
|
||||||
# gpu: true
|
|
||||||
# num_build_jobs: 24
|
|
||||||
|
|
82
extra/DEVELOPER_DOCS/Satellite Packages.md
Normal file
82
extra/DEVELOPER_DOCS/Satellite Packages.md
Normal file
|
@ -0,0 +1,82 @@
|
||||||
|
# spaCy Satellite Packages
|
||||||
|
|
||||||
|
This is a list of all the active repos relevant to spaCy besides the main one, with short descriptions, history, and current status. Archived repos will not be covered.
|
||||||
|
|
||||||
|
## Always Included in spaCy
|
||||||
|
|
||||||
|
These packages are always pulled in when you install spaCy. Most of them are direct dependencies, but some are transitive dependencies through other packages.
|
||||||
|
|
||||||
|
- [spacy-legacy](https://github.com/explosion/spacy-legacy): When an architecture in spaCy changes enough to get a new version, the old version is frozen and moved to spacy-legacy. This allows us to keep the core library slim while also preserving backwards compatability.
|
||||||
|
- [thinc](https://github.com/explosion/thinc): Thinc is the machine learning library that powers trainable components in spaCy. It wraps backends like Numpy, PyTorch, and Tensorflow to provide a functional interface for specifying architectures.
|
||||||
|
- [catalogue](https://github.com/explosion/catalogue): Small library for adding function registries, like those used for model architectures in spaCy.
|
||||||
|
- [confection](https://github.com/explosion/confection): This library contains the functionality for config parsing that was formerly contained directly in Thinc.
|
||||||
|
- [spacy-loggers](https://github.com/explosion/spacy-loggers): Contains loggers beyond the default logger available in spaCy's core code base. This includes loggers integrated with third-party services, which may differ in release cadence from spaCy itself.
|
||||||
|
- [wasabi](https://github.com/explosion/wasabi): A command line formatting library, used for terminal output in spaCy.
|
||||||
|
- [srsly](https://github.com/explosion/srsly): A wrapper that vendors several serialization libraries for spaCy. Includes parsers for JSON, JSONL, MessagePack, (extended) Pickle, and YAML.
|
||||||
|
- [preshed](https://github.com/explosion/preshed): A Cython library for low-level data structures like hash maps, used for memory efficient data storage.
|
||||||
|
- [cython-blis](https://github.com/explosion/cython-blis): Fast matrix multiplication using BLIS without depending on system libraries. Required by Thinc, rather than spaCy directly.
|
||||||
|
- [murmurhash](https://github.com/explosion/murmurhash): A wrapper library for a C++ murmurhash implementation, used for string IDs in spaCy and preshed.
|
||||||
|
- [cymem](https://github.com/explosion/cymem): A small library for RAII-style memory management in Cython.
|
||||||
|
|
||||||
|
## Optional Extensions for spaCy
|
||||||
|
|
||||||
|
These are repos that can be used by spaCy but aren't part of a default installation. Many of these are wrappers to integrate various kinds of third-party libraries.
|
||||||
|
|
||||||
|
- [spacy-transformers](https://github.com/explosion/spacy-transformers): A wrapper for the [HuggingFace Transformers](https://huggingface.co/docs/transformers/index) library, this handles the extensive conversion necessary to coordinate spaCy's powerful `Doc` representation, training pipeline, and the Transformer embeddings. When released, this was known as `spacy-pytorch-transformers`, but it changed to the current name when HuggingFace update the name of their library as well.
|
||||||
|
- [spacy-huggingface-hub](https://github.com/explosion/spacy-huggingface-hub): This package has a CLI script for uploading a packaged spaCy pipeline (created with `spacy package`) to the [Hugging Face Hub](https://huggingface.co/models).
|
||||||
|
- [spacy-alignments](https://github.com/explosion/spacy-alignments): A wrapper for the tokenizations library (mentioned below) with a modified build system to simplify cross-platform wheel creation. Used in spacy-transformers for aligning spaCy and HuggingFace tokenizations.
|
||||||
|
- [spacy-experimental](https://github.com/explosion/spacy-experimental): Experimental components that are not quite ready for inclusion in the main spaCy library. Usually there are unresolved questions around their APIs, so the experimental library allows us to expose them to the community for feedback before fully integrating them.
|
||||||
|
- [spacy-lookups-data](https://github.com/explosion/spacy-lookups-data): A repository of linguistic data, such as lemmas, that takes up a lot of disk space. Originally created to reduce the size of the spaCy core library. This is mainly useful if you want the data included but aren't using a pretrained pipeline; for the affected languages, the relevant data is included in pretrained pipelines directly.
|
||||||
|
- [coreferee](https://github.com/explosion/coreferee): Coreference resolution for English, French, German and Polish, optimised for limited training data and easily extensible for further languages. Used as a spaCy pipeline component.
|
||||||
|
- [spacy-stanza](https://github.com/explosion/spacy-stanza): This is a wrapper that allows the use of Stanford's Stanza library in spaCy.
|
||||||
|
- [spacy-streamlit](https://github.com/explosion/spacy-streamlit): A wrapper for the Streamlit dashboard building library to help with integrating [displaCy](https://spacy.io/api/top-level/#displacy).
|
||||||
|
- [spacymoji](https://github.com/explosion/spacymoji): A library to add extra support for emoji to spaCy, such as including character names.
|
||||||
|
- [thinc-apple-ops](https://github.com/explosion/thinc-apple-ops): A special backend for OSX that uses Apple's native libraries for improved performance.
|
||||||
|
- [os-signpost](https://github.com/explosion/os-signpost): A Python package that allows you to use the `OSSignposter` API in OSX for performance analysis.
|
||||||
|
- [spacy-ray](https://github.com/explosion/spacy-ray): A wrapper to integrate spaCy with Ray, a distributed training framework. Currently a work in progress.
|
||||||
|
|
||||||
|
## Prodigy
|
||||||
|
|
||||||
|
[Prodigy](https://prodi.gy) is Explosion's easy to use and highly customizable tool for annotating data. Prodigy itself requires a license, but the repos below contain documentation, examples, and editor or notebook integrations.
|
||||||
|
|
||||||
|
- [prodigy-recipes](https://github.com/explosion/prodigy-recipes): Sample recipes for Prodigy, along with notebooks and other examples of usage.
|
||||||
|
- [vscode-prodigy](https://github.com/explosion/vscode-prodigy): A VS Code extension that lets you run Prodigy inside VS Code.
|
||||||
|
- [jupyterlab-prodigy](https://github.com/explosion/jupyterlab-prodigy): An extension for JupyterLab that lets you run Prodigy inside JupyterLab.
|
||||||
|
|
||||||
|
## Independent Tools or Projects
|
||||||
|
|
||||||
|
These are tools that may be related to or use spaCy, but are functional independent projects in their own right as well.
|
||||||
|
|
||||||
|
- [floret](https://github.com/explosion/floret): A modification of fastText to use Bloom Embeddings. Can be used to add vectors with subword features to spaCy, and also works independently in the same manner as fastText.
|
||||||
|
- [sense2vec](https://github.com/explosion/sense2vec): A library to make embeddings of noun phrases or words coupled with their part of speech. This library uses spaCy.
|
||||||
|
- [spacy-vectors-builder](https://github.com/explosion/spacy-vectors-builder): This is a spaCy project that builds vectors using floret and a lot of input text. It handles downloading the input data as well as the actual building of vectors.
|
||||||
|
- [holmes-extractor](https://github.com/explosion/holmes-extractor): Information extraction from English and German texts based on predicate logic. Uses spaCy.
|
||||||
|
- [healthsea](https://github.com/explosion/healthsea): Healthsea is a project to extract information from comments about health supplements. Structurally, it's a self-contained, large spaCy project.
|
||||||
|
- [spacy-pkuseg](https://github.com/explosion/spacy-pkuseg): A fork of the pkuseg Chinese tokenizer. Used for Chinese support in spaCy, but also works independently.
|
||||||
|
- [ml-datasets](https://github.com/explosion/ml-datasets): This repo includes loaders for several standard machine learning datasets, like MNIST or WikiNER, and has historically been used in spaCy example code and documentation.
|
||||||
|
|
||||||
|
## Documentation and Informational Repos
|
||||||
|
|
||||||
|
These repos are used to support the spaCy docs or otherwise present information about spaCy or other Explosion projects.
|
||||||
|
|
||||||
|
- [projects](https://github.com/explosion/projects): The projects repo is used to show detailed examples of spaCy usage. Individual projects can be checked out using the spaCy command line tool, rather than checking out the projects repo directly.
|
||||||
|
- [spacy-course](https://github.com/explosion/spacy-course): Home to the interactive spaCy course for learning about how to use the library and some basic NLP principles.
|
||||||
|
- [spacy-io-binder](https://github.com/explosion/spacy-io-binder): Home to the notebooks used for interactive examples in the documentation.
|
||||||
|
|
||||||
|
## Organizational / Meta
|
||||||
|
|
||||||
|
These repos are used for organizing data around spaCy, but are not something an end user would need to install as part of using the library.
|
||||||
|
|
||||||
|
- [spacy-models](https://github.com/explosion/spacy-models): This repo contains metadata (but not training data) for all the spaCy models. This includes information about where their training data came from, version compatability, and performance information. It also includes tests for the model packages, and the built models are hosted as releases of this repo.
|
||||||
|
- [wheelwright](https://github.com/explosion/wheelwright): A tool for automating our PyPI builds and releases.
|
||||||
|
- [ec2buildwheel](https://github.com/explosion/ec2buildwheel): A small project that allows you to build Python packages in the manner of cibuildwheel, but on any EC2 image. Used by wheelwright.
|
||||||
|
|
||||||
|
## Other
|
||||||
|
|
||||||
|
Repos that don't fit in any of the above categories.
|
||||||
|
|
||||||
|
- [blis](https://github.com/explosion/blis): A fork of the official BLIS library. The main branch is not updated, but work continues in various branches. This is used for cython-blis.
|
||||||
|
- [tokenizations](https://github.com/explosion/tokenizations): A library originally by Yohei Tamura to align strings with tolerance to some variations in features like case and diacritics, used for aligning tokens and wordpieces. Adopted and maintained by Explosion, but usually spacy-alignments is used instead.
|
||||||
|
- [conll-2012](https://github.com/explosion/conll-2012): A repo to hold some slightly cleaned up versions of the official scripts for the CoNLL 2012 shared task involving coreference resolution. Used in the coref project.
|
||||||
|
- [fastapi-explosion-extras](https://github.com/explosion/fastapi-explosion-extras): Some small tweaks to FastAPI used at Explosion.
|
||||||
|
|
|
@ -127,3 +127,34 @@ distributed under the License is distributed on an "AS IS" BASIS,
|
||||||
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
|
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
|
||||||
See the License for the specific language governing permissions and
|
See the License for the specific language governing permissions and
|
||||||
limitations under the License.
|
limitations under the License.
|
||||||
|
|
||||||
|
|
||||||
|
polyleven
|
||||||
|
---------
|
||||||
|
|
||||||
|
* Files: spacy/matcher/polyleven.c
|
||||||
|
|
||||||
|
MIT License
|
||||||
|
|
||||||
|
Copyright (c) 2021 Fujimoto Seiji <fujimoto@ceptord.net>
|
||||||
|
Copyright (c) 2021 Max Bachmann <kontakt@maxbachmann.de>
|
||||||
|
Copyright (c) 2022 Nick Mazuk
|
||||||
|
Copyright (c) 2022 Michael Weiss <code@mweiss.ch>
|
||||||
|
|
||||||
|
Permission is hereby granted, free of charge, to any person obtaining a copy
|
||||||
|
of this software and associated documentation files (the "Software"), to deal
|
||||||
|
in the Software without restriction, including without limitation the rights
|
||||||
|
to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
|
||||||
|
copies of the Software, and to permit persons to whom the Software is
|
||||||
|
furnished to do so, subject to the following conditions:
|
||||||
|
|
||||||
|
The above copyright notice and this permission notice shall be included in all
|
||||||
|
copies or substantial portions of the Software.
|
||||||
|
|
||||||
|
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
|
||||||
|
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
|
||||||
|
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
|
||||||
|
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
|
||||||
|
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
|
||||||
|
OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
||||||
|
SOFTWARE.
|
||||||
|
|
|
@ -6,7 +6,6 @@ requires = [
|
||||||
"preshed>=3.0.2,<3.1.0",
|
"preshed>=3.0.2,<3.1.0",
|
||||||
"murmurhash>=0.28.0,<1.1.0",
|
"murmurhash>=0.28.0,<1.1.0",
|
||||||
"thinc>=8.1.0,<8.2.0",
|
"thinc>=8.1.0,<8.2.0",
|
||||||
"pathy",
|
|
||||||
"numpy>=1.15.0",
|
"numpy>=1.15.0",
|
||||||
]
|
]
|
||||||
build-backend = "setuptools.build_meta"
|
build-backend = "setuptools.build_meta"
|
||||||
|
|
|
@ -1,5 +1,5 @@
|
||||||
# Our libraries
|
# Our libraries
|
||||||
spacy-legacy>=3.0.9,<3.1.0
|
spacy-legacy>=3.0.10,<3.1.0
|
||||||
spacy-loggers>=1.0.0,<2.0.0
|
spacy-loggers>=1.0.0,<2.0.0
|
||||||
cymem>=2.0.2,<2.1.0
|
cymem>=2.0.2,<2.1.0
|
||||||
preshed>=3.0.2,<3.1.0
|
preshed>=3.0.2,<3.1.0
|
||||||
|
@ -15,7 +15,7 @@ pathy>=0.3.5
|
||||||
numpy>=1.15.0
|
numpy>=1.15.0
|
||||||
requests>=2.13.0,<3.0.0
|
requests>=2.13.0,<3.0.0
|
||||||
tqdm>=4.38.0,<5.0.0
|
tqdm>=4.38.0,<5.0.0
|
||||||
pydantic>=1.7.4,!=1.8,!=1.8.1,<1.10.0
|
pydantic>=1.7.4,!=1.8,!=1.8.1,<1.11.0
|
||||||
jinja2
|
jinja2
|
||||||
langcodes>=3.2.0,<4.0.0
|
langcodes>=3.2.0,<4.0.0
|
||||||
# Official Python utilities
|
# Official Python utilities
|
||||||
|
@ -28,10 +28,12 @@ cython>=0.25,<3.0
|
||||||
pytest>=5.2.0,!=7.1.0
|
pytest>=5.2.0,!=7.1.0
|
||||||
pytest-timeout>=1.3.0,<2.0.0
|
pytest-timeout>=1.3.0,<2.0.0
|
||||||
mock>=2.0.0,<3.0.0
|
mock>=2.0.0,<3.0.0
|
||||||
flake8>=3.8.0,<3.10.0
|
flake8>=3.8.0,<6.0.0
|
||||||
hypothesis>=3.27.0,<7.0.0
|
hypothesis>=3.27.0,<7.0.0
|
||||||
mypy>=0.910,<0.970; platform_machine!='aarch64'
|
mypy>=0.980,<0.990; platform_machine != "aarch64" and python_version >= "3.7"
|
||||||
types-dataclasses>=0.1.3; python_version < "3.7"
|
types-dataclasses>=0.1.3; python_version < "3.7"
|
||||||
types-mock>=0.1.1
|
types-mock>=0.1.1
|
||||||
|
types-setuptools>=57.0.0
|
||||||
types-requests
|
types-requests
|
||||||
|
types-setuptools>=57.0.0
|
||||||
black>=22.0,<23.0
|
black>=22.0,<23.0
|
||||||
|
|
42
setup.cfg
42
setup.cfg
|
@ -33,7 +33,7 @@ include_package_data = true
|
||||||
python_requires = >=3.6
|
python_requires = >=3.6
|
||||||
install_requires =
|
install_requires =
|
||||||
# Our libraries
|
# Our libraries
|
||||||
spacy-legacy>=3.0.9,<3.1.0
|
spacy-legacy>=3.0.10,<3.1.0
|
||||||
spacy-loggers>=1.0.0,<2.0.0
|
spacy-loggers>=1.0.0,<2.0.0
|
||||||
murmurhash>=0.28.0,<1.1.0
|
murmurhash>=0.28.0,<1.1.0
|
||||||
cymem>=2.0.2,<2.1.0
|
cymem>=2.0.2,<2.1.0
|
||||||
|
@ -42,13 +42,13 @@ install_requires =
|
||||||
wasabi>=0.9.1,<1.1.0
|
wasabi>=0.9.1,<1.1.0
|
||||||
srsly>=2.4.3,<3.0.0
|
srsly>=2.4.3,<3.0.0
|
||||||
catalogue>=2.0.6,<2.1.0
|
catalogue>=2.0.6,<2.1.0
|
||||||
|
# Third-party dependencies
|
||||||
typer>=0.3.0,<0.5.0
|
typer>=0.3.0,<0.5.0
|
||||||
pathy>=0.3.5
|
pathy>=0.3.5
|
||||||
# Third-party dependencies
|
|
||||||
tqdm>=4.38.0,<5.0.0
|
tqdm>=4.38.0,<5.0.0
|
||||||
numpy>=1.15.0
|
numpy>=1.15.0
|
||||||
requests>=2.13.0,<3.0.0
|
requests>=2.13.0,<3.0.0
|
||||||
pydantic>=1.7.4,!=1.8,!=1.8.1,<1.10.0
|
pydantic>=1.7.4,!=1.8,!=1.8.1,<1.11.0
|
||||||
jinja2
|
jinja2
|
||||||
# Official Python utilities
|
# Official Python utilities
|
||||||
setuptools
|
setuptools
|
||||||
|
@ -68,37 +68,41 @@ transformers =
|
||||||
ray =
|
ray =
|
||||||
spacy_ray>=0.1.0,<1.0.0
|
spacy_ray>=0.1.0,<1.0.0
|
||||||
cuda =
|
cuda =
|
||||||
cupy>=5.0.0b4,<11.0.0
|
cupy>=5.0.0b4,<12.0.0
|
||||||
cuda80 =
|
cuda80 =
|
||||||
cupy-cuda80>=5.0.0b4,<11.0.0
|
cupy-cuda80>=5.0.0b4,<12.0.0
|
||||||
cuda90 =
|
cuda90 =
|
||||||
cupy-cuda90>=5.0.0b4,<11.0.0
|
cupy-cuda90>=5.0.0b4,<12.0.0
|
||||||
cuda91 =
|
cuda91 =
|
||||||
cupy-cuda91>=5.0.0b4,<11.0.0
|
cupy-cuda91>=5.0.0b4,<12.0.0
|
||||||
cuda92 =
|
cuda92 =
|
||||||
cupy-cuda92>=5.0.0b4,<11.0.0
|
cupy-cuda92>=5.0.0b4,<12.0.0
|
||||||
cuda100 =
|
cuda100 =
|
||||||
cupy-cuda100>=5.0.0b4,<11.0.0
|
cupy-cuda100>=5.0.0b4,<12.0.0
|
||||||
cuda101 =
|
cuda101 =
|
||||||
cupy-cuda101>=5.0.0b4,<11.0.0
|
cupy-cuda101>=5.0.0b4,<12.0.0
|
||||||
cuda102 =
|
cuda102 =
|
||||||
cupy-cuda102>=5.0.0b4,<11.0.0
|
cupy-cuda102>=5.0.0b4,<12.0.0
|
||||||
cuda110 =
|
cuda110 =
|
||||||
cupy-cuda110>=5.0.0b4,<11.0.0
|
cupy-cuda110>=5.0.0b4,<12.0.0
|
||||||
cuda111 =
|
cuda111 =
|
||||||
cupy-cuda111>=5.0.0b4,<11.0.0
|
cupy-cuda111>=5.0.0b4,<12.0.0
|
||||||
cuda112 =
|
cuda112 =
|
||||||
cupy-cuda112>=5.0.0b4,<11.0.0
|
cupy-cuda112>=5.0.0b4,<12.0.0
|
||||||
cuda113 =
|
cuda113 =
|
||||||
cupy-cuda113>=5.0.0b4,<11.0.0
|
cupy-cuda113>=5.0.0b4,<12.0.0
|
||||||
cuda114 =
|
cuda114 =
|
||||||
cupy-cuda114>=5.0.0b4,<11.0.0
|
cupy-cuda114>=5.0.0b4,<12.0.0
|
||||||
cuda115 =
|
cuda115 =
|
||||||
cupy-cuda115>=5.0.0b4,<11.0.0
|
cupy-cuda115>=5.0.0b4,<12.0.0
|
||||||
cuda116 =
|
cuda116 =
|
||||||
cupy-cuda116>=5.0.0b4,<11.0.0
|
cupy-cuda116>=5.0.0b4,<12.0.0
|
||||||
cuda117 =
|
cuda117 =
|
||||||
cupy-cuda117>=5.0.0b4,<11.0.0
|
cupy-cuda117>=5.0.0b4,<12.0.0
|
||||||
|
cuda11x =
|
||||||
|
cupy-cuda11x>=11.0.0,<12.0.0
|
||||||
|
cuda-autodetect =
|
||||||
|
cupy-wheel>=11.0.0,<12.0.0
|
||||||
apple =
|
apple =
|
||||||
thinc-apple-ops>=0.1.0.dev0,<1.0.0
|
thinc-apple-ops>=0.1.0.dev0,<1.0.0
|
||||||
# Language tokenizers with external dependencies
|
# Language tokenizers with external dependencies
|
||||||
|
|
15
setup.py
15
setup.py
|
@ -30,7 +30,9 @@ MOD_NAMES = [
|
||||||
"spacy.lexeme",
|
"spacy.lexeme",
|
||||||
"spacy.vocab",
|
"spacy.vocab",
|
||||||
"spacy.attrs",
|
"spacy.attrs",
|
||||||
"spacy.kb",
|
"spacy.kb.candidate",
|
||||||
|
"spacy.kb.kb",
|
||||||
|
"spacy.kb.kb_in_memory",
|
||||||
"spacy.ml.parser_model",
|
"spacy.ml.parser_model",
|
||||||
"spacy.morphology",
|
"spacy.morphology",
|
||||||
"spacy.pipeline.dep_parser",
|
"spacy.pipeline.dep_parser",
|
||||||
|
@ -205,6 +207,17 @@ def setup_package():
|
||||||
get_python_inc(plat_specific=True),
|
get_python_inc(plat_specific=True),
|
||||||
]
|
]
|
||||||
ext_modules = []
|
ext_modules = []
|
||||||
|
ext_modules.append(
|
||||||
|
Extension(
|
||||||
|
"spacy.matcher.levenshtein",
|
||||||
|
[
|
||||||
|
"spacy/matcher/levenshtein.pyx",
|
||||||
|
"spacy/matcher/polyleven.c",
|
||||||
|
],
|
||||||
|
language="c",
|
||||||
|
include_dirs=include_dirs,
|
||||||
|
)
|
||||||
|
)
|
||||||
for name in MOD_NAMES:
|
for name in MOD_NAMES:
|
||||||
mod_path = name.replace(".", "/") + ".pyx"
|
mod_path = name.replace(".", "/") + ".pyx"
|
||||||
ext = Extension(
|
ext = Extension(
|
||||||
|
|
|
@ -31,21 +31,21 @@ def load(
|
||||||
name: Union[str, Path],
|
name: Union[str, Path],
|
||||||
*,
|
*,
|
||||||
vocab: Union[Vocab, bool] = True,
|
vocab: Union[Vocab, bool] = True,
|
||||||
disable: Iterable[str] = util.SimpleFrozenList(),
|
disable: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES,
|
||||||
enable: Iterable[str] = util.SimpleFrozenList(),
|
enable: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES,
|
||||||
exclude: Iterable[str] = util.SimpleFrozenList(),
|
exclude: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES,
|
||||||
config: Union[Dict[str, Any], Config] = util.SimpleFrozenDict(),
|
config: Union[Dict[str, Any], Config] = util.SimpleFrozenDict(),
|
||||||
) -> Language:
|
) -> Language:
|
||||||
"""Load a spaCy model from an installed package or a local path.
|
"""Load a spaCy model from an installed package or a local path.
|
||||||
|
|
||||||
name (str): Package name or model path.
|
name (str): Package name or model path.
|
||||||
vocab (Vocab): A Vocab object. If True, a vocab is created.
|
vocab (Vocab): A Vocab object. If True, a vocab is created.
|
||||||
disable (Iterable[str]): Names of pipeline components to disable. Disabled
|
disable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to disable. Disabled
|
||||||
pipes will be loaded but they won't be run unless you explicitly
|
pipes will be loaded but they won't be run unless you explicitly
|
||||||
enable them by calling nlp.enable_pipe.
|
enable them by calling nlp.enable_pipe.
|
||||||
enable (Iterable[str]): Names of pipeline components to enable. All other
|
enable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to enable. All other
|
||||||
pipes will be disabled (but can be enabled later using nlp.enable_pipe).
|
pipes will be disabled (but can be enabled later using nlp.enable_pipe).
|
||||||
exclude (Iterable[str]): Names of pipeline components to exclude. Excluded
|
exclude (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to exclude. Excluded
|
||||||
components won't be loaded.
|
components won't be loaded.
|
||||||
config (Dict[str, Any] / Config): Config overrides as nested dict or dict
|
config (Dict[str, Any] / Config): Config overrides as nested dict or dict
|
||||||
keyed by section values in dot notation.
|
keyed by section values in dot notation.
|
||||||
|
|
|
@ -1,6 +1,6 @@
|
||||||
# fmt: off
|
# fmt: off
|
||||||
__title__ = "spacy"
|
__title__ = "spacy"
|
||||||
__version__ = "3.4.1"
|
__version__ = "3.4.2"
|
||||||
__download_url__ = "https://github.com/explosion/spacy-models/releases/download"
|
__download_url__ = "https://github.com/explosion/spacy-models/releases/download"
|
||||||
__compatibility__ = "https://raw.githubusercontent.com/explosion/spacy-models/master/compatibility.json"
|
__compatibility__ = "https://raw.githubusercontent.com/explosion/spacy-models/master/compatibility.json"
|
||||||
__projects__ = "https://github.com/explosion/projects"
|
__projects__ = "https://github.com/explosion/projects"
|
||||||
|
|
129
spacy/attrs.pxd
129
spacy/attrs.pxd
|
@ -1,98 +1,49 @@
|
||||||
# Reserve 64 values for flag features
|
|
||||||
from . cimport symbols
|
from . cimport symbols
|
||||||
|
|
||||||
cdef enum attr_id_t:
|
cdef enum attr_id_t:
|
||||||
NULL_ATTR
|
NULL_ATTR = 0
|
||||||
IS_ALPHA
|
IS_ALPHA = symbols.IS_ALPHA
|
||||||
IS_ASCII
|
IS_ASCII = symbols.IS_ASCII
|
||||||
IS_DIGIT
|
IS_DIGIT = symbols.IS_DIGIT
|
||||||
IS_LOWER
|
IS_LOWER = symbols.IS_LOWER
|
||||||
IS_PUNCT
|
IS_PUNCT = symbols.IS_PUNCT
|
||||||
IS_SPACE
|
IS_SPACE = symbols.IS_SPACE
|
||||||
IS_TITLE
|
IS_TITLE = symbols.IS_TITLE
|
||||||
IS_UPPER
|
IS_UPPER = symbols.IS_UPPER
|
||||||
LIKE_URL
|
LIKE_URL = symbols.LIKE_URL
|
||||||
LIKE_NUM
|
LIKE_NUM = symbols.LIKE_NUM
|
||||||
LIKE_EMAIL
|
LIKE_EMAIL = symbols.LIKE_EMAIL
|
||||||
IS_STOP
|
IS_STOP = symbols.IS_STOP
|
||||||
IS_OOV_DEPRECATED
|
IS_BRACKET = symbols.IS_BRACKET
|
||||||
IS_BRACKET
|
IS_QUOTE = symbols.IS_QUOTE
|
||||||
IS_QUOTE
|
IS_LEFT_PUNCT = symbols.IS_LEFT_PUNCT
|
||||||
IS_LEFT_PUNCT
|
IS_RIGHT_PUNCT = symbols.IS_RIGHT_PUNCT
|
||||||
IS_RIGHT_PUNCT
|
IS_CURRENCY = symbols.IS_CURRENCY
|
||||||
IS_CURRENCY
|
|
||||||
|
|
||||||
FLAG19 = 19
|
ID = symbols.ID
|
||||||
FLAG20
|
ORTH = symbols.ORTH
|
||||||
FLAG21
|
LOWER = symbols.LOWER
|
||||||
FLAG22
|
NORM = symbols.NORM
|
||||||
FLAG23
|
SHAPE = symbols.SHAPE
|
||||||
FLAG24
|
PREFIX = symbols.PREFIX
|
||||||
FLAG25
|
SUFFIX = symbols.SUFFIX
|
||||||
FLAG26
|
|
||||||
FLAG27
|
|
||||||
FLAG28
|
|
||||||
FLAG29
|
|
||||||
FLAG30
|
|
||||||
FLAG31
|
|
||||||
FLAG32
|
|
||||||
FLAG33
|
|
||||||
FLAG34
|
|
||||||
FLAG35
|
|
||||||
FLAG36
|
|
||||||
FLAG37
|
|
||||||
FLAG38
|
|
||||||
FLAG39
|
|
||||||
FLAG40
|
|
||||||
FLAG41
|
|
||||||
FLAG42
|
|
||||||
FLAG43
|
|
||||||
FLAG44
|
|
||||||
FLAG45
|
|
||||||
FLAG46
|
|
||||||
FLAG47
|
|
||||||
FLAG48
|
|
||||||
FLAG49
|
|
||||||
FLAG50
|
|
||||||
FLAG51
|
|
||||||
FLAG52
|
|
||||||
FLAG53
|
|
||||||
FLAG54
|
|
||||||
FLAG55
|
|
||||||
FLAG56
|
|
||||||
FLAG57
|
|
||||||
FLAG58
|
|
||||||
FLAG59
|
|
||||||
FLAG60
|
|
||||||
FLAG61
|
|
||||||
FLAG62
|
|
||||||
FLAG63
|
|
||||||
|
|
||||||
ID
|
LENGTH = symbols.LENGTH
|
||||||
ORTH
|
CLUSTER = symbols.CLUSTER
|
||||||
LOWER
|
LEMMA = symbols.LEMMA
|
||||||
NORM
|
POS = symbols.POS
|
||||||
SHAPE
|
TAG = symbols.TAG
|
||||||
PREFIX
|
DEP = symbols.DEP
|
||||||
SUFFIX
|
ENT_IOB = symbols.ENT_IOB
|
||||||
|
ENT_TYPE = symbols.ENT_TYPE
|
||||||
|
HEAD = symbols.HEAD
|
||||||
|
SENT_START = symbols.SENT_START
|
||||||
|
SPACY = symbols.SPACY
|
||||||
|
PROB = symbols.PROB
|
||||||
|
|
||||||
LENGTH
|
LANG = symbols.LANG
|
||||||
CLUSTER
|
|
||||||
LEMMA
|
|
||||||
POS
|
|
||||||
TAG
|
|
||||||
DEP
|
|
||||||
ENT_IOB
|
|
||||||
ENT_TYPE
|
|
||||||
HEAD
|
|
||||||
SENT_START
|
|
||||||
SPACY
|
|
||||||
PROB
|
|
||||||
|
|
||||||
LANG
|
|
||||||
ENT_KB_ID = symbols.ENT_KB_ID
|
ENT_KB_ID = symbols.ENT_KB_ID
|
||||||
MORPH
|
MORPH = symbols.MORPH
|
||||||
ENT_ID = symbols.ENT_ID
|
ENT_ID = symbols.ENT_ID
|
||||||
|
|
||||||
IDX
|
IDX = symbols.IDX
|
||||||
SENT_END
|
|
||||||
|
|
|
@ -16,57 +16,11 @@ IDS = {
|
||||||
"LIKE_NUM": LIKE_NUM,
|
"LIKE_NUM": LIKE_NUM,
|
||||||
"LIKE_EMAIL": LIKE_EMAIL,
|
"LIKE_EMAIL": LIKE_EMAIL,
|
||||||
"IS_STOP": IS_STOP,
|
"IS_STOP": IS_STOP,
|
||||||
"IS_OOV_DEPRECATED": IS_OOV_DEPRECATED,
|
|
||||||
"IS_BRACKET": IS_BRACKET,
|
"IS_BRACKET": IS_BRACKET,
|
||||||
"IS_QUOTE": IS_QUOTE,
|
"IS_QUOTE": IS_QUOTE,
|
||||||
"IS_LEFT_PUNCT": IS_LEFT_PUNCT,
|
"IS_LEFT_PUNCT": IS_LEFT_PUNCT,
|
||||||
"IS_RIGHT_PUNCT": IS_RIGHT_PUNCT,
|
"IS_RIGHT_PUNCT": IS_RIGHT_PUNCT,
|
||||||
"IS_CURRENCY": IS_CURRENCY,
|
"IS_CURRENCY": IS_CURRENCY,
|
||||||
"FLAG19": FLAG19,
|
|
||||||
"FLAG20": FLAG20,
|
|
||||||
"FLAG21": FLAG21,
|
|
||||||
"FLAG22": FLAG22,
|
|
||||||
"FLAG23": FLAG23,
|
|
||||||
"FLAG24": FLAG24,
|
|
||||||
"FLAG25": FLAG25,
|
|
||||||
"FLAG26": FLAG26,
|
|
||||||
"FLAG27": FLAG27,
|
|
||||||
"FLAG28": FLAG28,
|
|
||||||
"FLAG29": FLAG29,
|
|
||||||
"FLAG30": FLAG30,
|
|
||||||
"FLAG31": FLAG31,
|
|
||||||
"FLAG32": FLAG32,
|
|
||||||
"FLAG33": FLAG33,
|
|
||||||
"FLAG34": FLAG34,
|
|
||||||
"FLAG35": FLAG35,
|
|
||||||
"FLAG36": FLAG36,
|
|
||||||
"FLAG37": FLAG37,
|
|
||||||
"FLAG38": FLAG38,
|
|
||||||
"FLAG39": FLAG39,
|
|
||||||
"FLAG40": FLAG40,
|
|
||||||
"FLAG41": FLAG41,
|
|
||||||
"FLAG42": FLAG42,
|
|
||||||
"FLAG43": FLAG43,
|
|
||||||
"FLAG44": FLAG44,
|
|
||||||
"FLAG45": FLAG45,
|
|
||||||
"FLAG46": FLAG46,
|
|
||||||
"FLAG47": FLAG47,
|
|
||||||
"FLAG48": FLAG48,
|
|
||||||
"FLAG49": FLAG49,
|
|
||||||
"FLAG50": FLAG50,
|
|
||||||
"FLAG51": FLAG51,
|
|
||||||
"FLAG52": FLAG52,
|
|
||||||
"FLAG53": FLAG53,
|
|
||||||
"FLAG54": FLAG54,
|
|
||||||
"FLAG55": FLAG55,
|
|
||||||
"FLAG56": FLAG56,
|
|
||||||
"FLAG57": FLAG57,
|
|
||||||
"FLAG58": FLAG58,
|
|
||||||
"FLAG59": FLAG59,
|
|
||||||
"FLAG60": FLAG60,
|
|
||||||
"FLAG61": FLAG61,
|
|
||||||
"FLAG62": FLAG62,
|
|
||||||
"FLAG63": FLAG63,
|
|
||||||
"ID": ID,
|
"ID": ID,
|
||||||
"ORTH": ORTH,
|
"ORTH": ORTH,
|
||||||
"LOWER": LOWER,
|
"LOWER": LOWER,
|
||||||
|
@ -92,8 +46,7 @@ IDS = {
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|
||||||
# ATTR IDs, in order of the symbol
|
NAMES = {v: k for k, v in IDS.items()}
|
||||||
NAMES = [key for key, value in sorted(IDS.items(), key=lambda item: item[1])]
|
|
||||||
locals().update(IDS)
|
locals().update(IDS)
|
||||||
|
|
||||||
|
|
||||||
|
|
|
@ -573,3 +573,12 @@ def setup_gpu(use_gpu: int, silent=None) -> None:
|
||||||
local_msg.info("Using CPU")
|
local_msg.info("Using CPU")
|
||||||
if gpu_is_available():
|
if gpu_is_available():
|
||||||
local_msg.info("To switch to GPU 0, use the option: --gpu-id 0")
|
local_msg.info("To switch to GPU 0, use the option: --gpu-id 0")
|
||||||
|
|
||||||
|
|
||||||
|
def _format_number(number: Union[int, float], ndigits: int = 2) -> str:
|
||||||
|
"""Formats a number (float or int) rounding to `ndigits`, without truncating trailing 0s,
|
||||||
|
as happens with `round(number, ndigits)`"""
|
||||||
|
if isinstance(number, float):
|
||||||
|
return f"{number:.{ndigits}f}"
|
||||||
|
else:
|
||||||
|
return str(number)
|
||||||
|
|
|
@ -9,7 +9,7 @@ import typer
|
||||||
import math
|
import math
|
||||||
|
|
||||||
from ._util import app, Arg, Opt, show_validation_error, parse_config_overrides
|
from ._util import app, Arg, Opt, show_validation_error, parse_config_overrides
|
||||||
from ._util import import_code, debug_cli
|
from ._util import import_code, debug_cli, _format_number
|
||||||
from ..training import Example, remove_bilu_prefix
|
from ..training import Example, remove_bilu_prefix
|
||||||
from ..training.initialize import get_sourced_components
|
from ..training.initialize import get_sourced_components
|
||||||
from ..schemas import ConfigSchemaTraining
|
from ..schemas import ConfigSchemaTraining
|
||||||
|
@ -989,7 +989,8 @@ def _get_kl_divergence(p: Counter, q: Counter) -> float:
|
||||||
def _format_span_row(span_data: List[Dict], labels: List[str]) -> List[Any]:
|
def _format_span_row(span_data: List[Dict], labels: List[str]) -> List[Any]:
|
||||||
"""Compile into one list for easier reporting"""
|
"""Compile into one list for easier reporting"""
|
||||||
d = {
|
d = {
|
||||||
label: [label] + list(round(d[label], 2) for d in span_data) for label in labels
|
label: [label] + list(_format_number(d[label]) for d in span_data)
|
||||||
|
for label in labels
|
||||||
}
|
}
|
||||||
return list(d.values())
|
return list(d.values())
|
||||||
|
|
||||||
|
@ -1004,6 +1005,10 @@ def _get_span_characteristics(
|
||||||
label: _gmean(l)
|
label: _gmean(l)
|
||||||
for label, l in compiled_gold["spans_length"][spans_key].items()
|
for label, l in compiled_gold["spans_length"][spans_key].items()
|
||||||
}
|
}
|
||||||
|
spans_per_type = {
|
||||||
|
label: len(spans)
|
||||||
|
for label, spans in compiled_gold["spans_per_type"][spans_key].items()
|
||||||
|
}
|
||||||
min_lengths = [min(l) for l in compiled_gold["spans_length"][spans_key].values()]
|
min_lengths = [min(l) for l in compiled_gold["spans_length"][spans_key].values()]
|
||||||
max_lengths = [max(l) for l in compiled_gold["spans_length"][spans_key].values()]
|
max_lengths = [max(l) for l in compiled_gold["spans_length"][spans_key].values()]
|
||||||
|
|
||||||
|
@ -1031,6 +1036,7 @@ def _get_span_characteristics(
|
||||||
return {
|
return {
|
||||||
"sd": span_distinctiveness,
|
"sd": span_distinctiveness,
|
||||||
"bd": sb_distinctiveness,
|
"bd": sb_distinctiveness,
|
||||||
|
"spans_per_type": spans_per_type,
|
||||||
"lengths": span_length,
|
"lengths": span_length,
|
||||||
"min_length": min(min_lengths),
|
"min_length": min(min_lengths),
|
||||||
"max_length": max(max_lengths),
|
"max_length": max(max_lengths),
|
||||||
|
@ -1045,12 +1051,15 @@ def _get_span_characteristics(
|
||||||
|
|
||||||
def _print_span_characteristics(span_characteristics: Dict[str, Any]):
|
def _print_span_characteristics(span_characteristics: Dict[str, Any]):
|
||||||
"""Print all span characteristics into a table"""
|
"""Print all span characteristics into a table"""
|
||||||
headers = ("Span Type", "Length", "SD", "BD")
|
headers = ("Span Type", "Length", "SD", "BD", "N")
|
||||||
|
# Wasabi has this at 30 by default, but we might have some long labels
|
||||||
|
max_col = max(30, max(len(label) for label in span_characteristics["labels"]))
|
||||||
# Prepare table data with all span characteristics
|
# Prepare table data with all span characteristics
|
||||||
table_data = [
|
table_data = [
|
||||||
span_characteristics["lengths"],
|
span_characteristics["lengths"],
|
||||||
span_characteristics["sd"],
|
span_characteristics["sd"],
|
||||||
span_characteristics["bd"],
|
span_characteristics["bd"],
|
||||||
|
span_characteristics["spans_per_type"],
|
||||||
]
|
]
|
||||||
table = _format_span_row(
|
table = _format_span_row(
|
||||||
span_data=table_data, labels=span_characteristics["labels"]
|
span_data=table_data, labels=span_characteristics["labels"]
|
||||||
|
@ -1061,8 +1070,18 @@ def _print_span_characteristics(span_characteristics: Dict[str, Any]):
|
||||||
span_characteristics["avg_sd"],
|
span_characteristics["avg_sd"],
|
||||||
span_characteristics["avg_bd"],
|
span_characteristics["avg_bd"],
|
||||||
]
|
]
|
||||||
footer = ["Wgt. Average"] + [str(round(f, 2)) for f in footer_data]
|
|
||||||
msg.table(table, footer=footer, header=headers, divider=True)
|
footer = (
|
||||||
|
["Wgt. Average"] + ["{:.2f}".format(round(f, 2)) for f in footer_data] + ["-"]
|
||||||
|
)
|
||||||
|
msg.table(
|
||||||
|
table,
|
||||||
|
footer=footer,
|
||||||
|
header=headers,
|
||||||
|
divider=True,
|
||||||
|
aligns=["l"] + ["r"] * (len(footer_data) + 1),
|
||||||
|
max_col=max_col,
|
||||||
|
)
|
||||||
|
|
||||||
|
|
||||||
def _get_spans_length_freq_dist(
|
def _get_spans_length_freq_dist(
|
||||||
|
|
|
@ -20,7 +20,7 @@ def download_cli(
|
||||||
ctx: typer.Context,
|
ctx: typer.Context,
|
||||||
model: str = Arg(..., help="Name of pipeline package to download"),
|
model: str = Arg(..., help="Name of pipeline package to download"),
|
||||||
direct: bool = Opt(False, "--direct", "-d", "-D", help="Force direct download of name + version"),
|
direct: bool = Opt(False, "--direct", "-d", "-D", help="Force direct download of name + version"),
|
||||||
sdist: bool = Opt(False, "--sdist", "-S", help="Download sdist (.tar.gz) archive instead of pre-built binary wheel")
|
sdist: bool = Opt(False, "--sdist", "-S", help="Download sdist (.tar.gz) archive instead of pre-built binary wheel"),
|
||||||
# fmt: on
|
# fmt: on
|
||||||
):
|
):
|
||||||
"""
|
"""
|
||||||
|
@ -36,7 +36,12 @@ def download_cli(
|
||||||
download(model, direct, sdist, *ctx.args)
|
download(model, direct, sdist, *ctx.args)
|
||||||
|
|
||||||
|
|
||||||
def download(model: str, direct: bool = False, sdist: bool = False, *pip_args) -> None:
|
def download(
|
||||||
|
model: str,
|
||||||
|
direct: bool = False,
|
||||||
|
sdist: bool = False,
|
||||||
|
*pip_args,
|
||||||
|
) -> None:
|
||||||
if (
|
if (
|
||||||
not (is_package("spacy") or is_package("spacy-nightly"))
|
not (is_package("spacy") or is_package("spacy-nightly"))
|
||||||
and "--no-deps" not in pip_args
|
and "--no-deps" not in pip_args
|
||||||
|
@ -50,13 +55,10 @@ def download(model: str, direct: bool = False, sdist: bool = False, *pip_args) -
|
||||||
"dependencies, you'll have to install them manually."
|
"dependencies, you'll have to install them manually."
|
||||||
)
|
)
|
||||||
pip_args = pip_args + ("--no-deps",)
|
pip_args = pip_args + ("--no-deps",)
|
||||||
suffix = SDIST_SUFFIX if sdist else WHEEL_SUFFIX
|
|
||||||
dl_tpl = "{m}-{v}/{m}-{v}{s}#egg={m}=={v}"
|
|
||||||
if direct:
|
if direct:
|
||||||
components = model.split("-")
|
components = model.split("-")
|
||||||
model_name = "".join(components[:-1])
|
model_name = "".join(components[:-1])
|
||||||
version = components[-1]
|
version = components[-1]
|
||||||
download_model(dl_tpl.format(m=model_name, v=version, s=suffix), pip_args)
|
|
||||||
else:
|
else:
|
||||||
model_name = model
|
model_name = model
|
||||||
if model in OLD_MODEL_SHORTCUTS:
|
if model in OLD_MODEL_SHORTCUTS:
|
||||||
|
@ -67,13 +69,26 @@ def download(model: str, direct: bool = False, sdist: bool = False, *pip_args) -
|
||||||
model_name = OLD_MODEL_SHORTCUTS[model]
|
model_name = OLD_MODEL_SHORTCUTS[model]
|
||||||
compatibility = get_compatibility()
|
compatibility = get_compatibility()
|
||||||
version = get_version(model_name, compatibility)
|
version = get_version(model_name, compatibility)
|
||||||
download_model(dl_tpl.format(m=model_name, v=version, s=suffix), pip_args)
|
|
||||||
|
filename = get_model_filename(model_name, version, sdist)
|
||||||
|
|
||||||
|
download_model(filename, pip_args)
|
||||||
msg.good(
|
msg.good(
|
||||||
"Download and installation successful",
|
"Download and installation successful",
|
||||||
f"You can now load the package via spacy.load('{model_name}')",
|
f"You can now load the package via spacy.load('{model_name}')",
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|
||||||
|
def get_model_filename(model_name: str, version: str, sdist: bool = False) -> str:
|
||||||
|
dl_tpl = "{m}-{v}/{m}-{v}{s}"
|
||||||
|
egg_tpl = "#egg={m}=={v}"
|
||||||
|
suffix = SDIST_SUFFIX if sdist else WHEEL_SUFFIX
|
||||||
|
filename = dl_tpl.format(m=model_name, v=version, s=suffix)
|
||||||
|
if sdist:
|
||||||
|
filename += egg_tpl.format(m=model_name, v=version)
|
||||||
|
return filename
|
||||||
|
|
||||||
|
|
||||||
def get_compatibility() -> dict:
|
def get_compatibility() -> dict:
|
||||||
if is_prerelease_version(about.__version__):
|
if is_prerelease_version(about.__version__):
|
||||||
version: Optional[str] = about.__version__
|
version: Optional[str] = about.__version__
|
||||||
|
@ -105,6 +120,11 @@ def get_version(model: str, comp: dict) -> str:
|
||||||
return comp[model][0]
|
return comp[model][0]
|
||||||
|
|
||||||
|
|
||||||
|
def get_latest_version(model: str) -> str:
|
||||||
|
comp = get_compatibility()
|
||||||
|
return get_version(model, comp)
|
||||||
|
|
||||||
|
|
||||||
def download_model(
|
def download_model(
|
||||||
filename: str, user_pip_args: Optional[Sequence[str]] = None
|
filename: str, user_pip_args: Optional[Sequence[str]] = None
|
||||||
) -> None:
|
) -> None:
|
||||||
|
|
|
@ -1,10 +1,13 @@
|
||||||
from typing import Optional, Dict, Any, Union, List
|
from typing import Optional, Dict, Any, Union, List
|
||||||
import platform
|
import platform
|
||||||
|
import pkg_resources
|
||||||
|
import json
|
||||||
from pathlib import Path
|
from pathlib import Path
|
||||||
from wasabi import Printer, MarkdownRenderer
|
from wasabi import Printer, MarkdownRenderer
|
||||||
import srsly
|
import srsly
|
||||||
|
|
||||||
from ._util import app, Arg, Opt, string_to_list
|
from ._util import app, Arg, Opt, string_to_list
|
||||||
|
from .download import get_model_filename, get_latest_version
|
||||||
from .. import util
|
from .. import util
|
||||||
from .. import about
|
from .. import about
|
||||||
|
|
||||||
|
@ -16,6 +19,7 @@ def info_cli(
|
||||||
markdown: bool = Opt(False, "--markdown", "-md", help="Generate Markdown for GitHub issues"),
|
markdown: bool = Opt(False, "--markdown", "-md", help="Generate Markdown for GitHub issues"),
|
||||||
silent: bool = Opt(False, "--silent", "-s", "-S", help="Don't print anything (just return)"),
|
silent: bool = Opt(False, "--silent", "-s", "-S", help="Don't print anything (just return)"),
|
||||||
exclude: str = Opt("labels", "--exclude", "-e", help="Comma-separated keys to exclude from the print-out"),
|
exclude: str = Opt("labels", "--exclude", "-e", help="Comma-separated keys to exclude from the print-out"),
|
||||||
|
url: bool = Opt(False, "--url", "-u", help="Print the URL to download the most recent compatible version of the pipeline"),
|
||||||
# fmt: on
|
# fmt: on
|
||||||
):
|
):
|
||||||
"""
|
"""
|
||||||
|
@ -23,10 +27,19 @@ def info_cli(
|
||||||
print its meta information. Flag --markdown prints details in Markdown for easy
|
print its meta information. Flag --markdown prints details in Markdown for easy
|
||||||
copy-pasting to GitHub issues.
|
copy-pasting to GitHub issues.
|
||||||
|
|
||||||
|
Flag --url prints only the download URL of the most recent compatible
|
||||||
|
version of the pipeline.
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/cli#info
|
DOCS: https://spacy.io/api/cli#info
|
||||||
"""
|
"""
|
||||||
exclude = string_to_list(exclude)
|
exclude = string_to_list(exclude)
|
||||||
info(model, markdown=markdown, silent=silent, exclude=exclude)
|
info(
|
||||||
|
model,
|
||||||
|
markdown=markdown,
|
||||||
|
silent=silent,
|
||||||
|
exclude=exclude,
|
||||||
|
url=url,
|
||||||
|
)
|
||||||
|
|
||||||
|
|
||||||
def info(
|
def info(
|
||||||
|
@ -35,11 +48,20 @@ def info(
|
||||||
markdown: bool = False,
|
markdown: bool = False,
|
||||||
silent: bool = True,
|
silent: bool = True,
|
||||||
exclude: Optional[List[str]] = None,
|
exclude: Optional[List[str]] = None,
|
||||||
|
url: bool = False,
|
||||||
) -> Union[str, dict]:
|
) -> Union[str, dict]:
|
||||||
msg = Printer(no_print=silent, pretty=not silent)
|
msg = Printer(no_print=silent, pretty=not silent)
|
||||||
if not exclude:
|
if not exclude:
|
||||||
exclude = []
|
exclude = []
|
||||||
if model:
|
if url:
|
||||||
|
if model is not None:
|
||||||
|
title = f"Download info for pipeline '{model}'"
|
||||||
|
data = info_model_url(model)
|
||||||
|
print(data["download_url"])
|
||||||
|
return data
|
||||||
|
else:
|
||||||
|
msg.fail("--url option requires a pipeline name", exits=1)
|
||||||
|
elif model:
|
||||||
title = f"Info about pipeline '{model}'"
|
title = f"Info about pipeline '{model}'"
|
||||||
data = info_model(model, silent=silent)
|
data = info_model(model, silent=silent)
|
||||||
else:
|
else:
|
||||||
|
@ -99,11 +121,44 @@ def info_model(model: str, *, silent: bool = True) -> Dict[str, Any]:
|
||||||
meta["source"] = str(model_path.resolve())
|
meta["source"] = str(model_path.resolve())
|
||||||
else:
|
else:
|
||||||
meta["source"] = str(model_path)
|
meta["source"] = str(model_path)
|
||||||
|
download_url = info_installed_model_url(model)
|
||||||
|
if download_url:
|
||||||
|
meta["download_url"] = download_url
|
||||||
return {
|
return {
|
||||||
k: v for k, v in meta.items() if k not in ("accuracy", "performance", "speed")
|
k: v for k, v in meta.items() if k not in ("accuracy", "performance", "speed")
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|
||||||
|
def info_installed_model_url(model: str) -> Optional[str]:
|
||||||
|
"""Given a pipeline name, get the download URL if available, otherwise
|
||||||
|
return None.
|
||||||
|
|
||||||
|
This is only available for pipelines installed as modules that have
|
||||||
|
dist-info available.
|
||||||
|
"""
|
||||||
|
try:
|
||||||
|
dist = pkg_resources.get_distribution(model)
|
||||||
|
data = json.loads(dist.get_metadata("direct_url.json"))
|
||||||
|
return data["url"]
|
||||||
|
except pkg_resources.DistributionNotFound:
|
||||||
|
# no such package
|
||||||
|
return None
|
||||||
|
except Exception:
|
||||||
|
# something else, like no file or invalid JSON
|
||||||
|
return None
|
||||||
|
|
||||||
|
|
||||||
|
def info_model_url(model: str) -> Dict[str, Any]:
|
||||||
|
"""Return the download URL for the latest version of a pipeline."""
|
||||||
|
version = get_latest_version(model)
|
||||||
|
|
||||||
|
filename = get_model_filename(model, version)
|
||||||
|
download_url = about.__download_url__ + "/" + filename
|
||||||
|
release_tpl = "https://github.com/explosion/spacy-models/releases/tag/{m}-{v}"
|
||||||
|
release_url = release_tpl.format(m=model, v=version)
|
||||||
|
return {"download_url": download_url, "release_url": release_url}
|
||||||
|
|
||||||
|
|
||||||
def get_markdown(
|
def get_markdown(
|
||||||
data: Dict[str, Any],
|
data: Dict[str, Any],
|
||||||
title: Optional[str] = None,
|
title: Optional[str] = None,
|
||||||
|
|
|
@ -299,8 +299,8 @@ def get_meta(
|
||||||
}
|
}
|
||||||
nlp = util.load_model_from_path(Path(model_path))
|
nlp = util.load_model_from_path(Path(model_path))
|
||||||
meta.update(nlp.meta)
|
meta.update(nlp.meta)
|
||||||
meta.update(existing_meta)
|
|
||||||
meta["spacy_version"] = util.get_minor_version_range(about.__version__)
|
meta["spacy_version"] = util.get_minor_version_range(about.__version__)
|
||||||
|
meta.update(existing_meta)
|
||||||
meta["vectors"] = {
|
meta["vectors"] = {
|
||||||
"width": nlp.vocab.vectors_length,
|
"width": nlp.vocab.vectors_length,
|
||||||
"vectors": len(nlp.vocab.vectors),
|
"vectors": len(nlp.vocab.vectors),
|
||||||
|
|
|
@ -25,6 +25,7 @@ def project_update_dvc_cli(
|
||||||
project_dir: Path = Arg(Path.cwd(), help="Location of project directory. Defaults to current working directory.", exists=True, file_okay=False),
|
project_dir: Path = Arg(Path.cwd(), help="Location of project directory. Defaults to current working directory.", exists=True, file_okay=False),
|
||||||
workflow: Optional[str] = Arg(None, help=f"Name of workflow defined in {PROJECT_FILE}. Defaults to first workflow if not set."),
|
workflow: Optional[str] = Arg(None, help=f"Name of workflow defined in {PROJECT_FILE}. Defaults to first workflow if not set."),
|
||||||
verbose: bool = Opt(False, "--verbose", "-V", help="Print more info"),
|
verbose: bool = Opt(False, "--verbose", "-V", help="Print more info"),
|
||||||
|
quiet: bool = Opt(False, "--quiet", "-q", help="Print less info"),
|
||||||
force: bool = Opt(False, "--force", "-F", help="Force update DVC config"),
|
force: bool = Opt(False, "--force", "-F", help="Force update DVC config"),
|
||||||
# fmt: on
|
# fmt: on
|
||||||
):
|
):
|
||||||
|
@ -36,7 +37,7 @@ def project_update_dvc_cli(
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/cli#project-dvc
|
DOCS: https://spacy.io/api/cli#project-dvc
|
||||||
"""
|
"""
|
||||||
project_update_dvc(project_dir, workflow, verbose=verbose, force=force)
|
project_update_dvc(project_dir, workflow, verbose=verbose, quiet=quiet, force=force)
|
||||||
|
|
||||||
|
|
||||||
def project_update_dvc(
|
def project_update_dvc(
|
||||||
|
@ -44,6 +45,7 @@ def project_update_dvc(
|
||||||
workflow: Optional[str] = None,
|
workflow: Optional[str] = None,
|
||||||
*,
|
*,
|
||||||
verbose: bool = False,
|
verbose: bool = False,
|
||||||
|
quiet: bool = False,
|
||||||
force: bool = False,
|
force: bool = False,
|
||||||
) -> None:
|
) -> None:
|
||||||
"""Update the auto-generated Data Version Control (DVC) config file. A DVC
|
"""Update the auto-generated Data Version Control (DVC) config file. A DVC
|
||||||
|
@ -54,11 +56,12 @@ def project_update_dvc(
|
||||||
workflow (Optional[str]): Optional name of workflow defined in project.yml.
|
workflow (Optional[str]): Optional name of workflow defined in project.yml.
|
||||||
If not set, the first workflow will be used.
|
If not set, the first workflow will be used.
|
||||||
verbose (bool): Print more info.
|
verbose (bool): Print more info.
|
||||||
|
quiet (bool): Print less info.
|
||||||
force (bool): Force update DVC config.
|
force (bool): Force update DVC config.
|
||||||
"""
|
"""
|
||||||
config = load_project_config(project_dir)
|
config = load_project_config(project_dir)
|
||||||
updated = update_dvc_config(
|
updated = update_dvc_config(
|
||||||
project_dir, config, workflow, verbose=verbose, force=force
|
project_dir, config, workflow, verbose=verbose, quiet=quiet, force=force
|
||||||
)
|
)
|
||||||
help_msg = "To execute the workflow with DVC, run: dvc repro"
|
help_msg = "To execute the workflow with DVC, run: dvc repro"
|
||||||
if updated:
|
if updated:
|
||||||
|
@ -72,7 +75,7 @@ def update_dvc_config(
|
||||||
config: Dict[str, Any],
|
config: Dict[str, Any],
|
||||||
workflow: Optional[str] = None,
|
workflow: Optional[str] = None,
|
||||||
verbose: bool = False,
|
verbose: bool = False,
|
||||||
silent: bool = False,
|
quiet: bool = False,
|
||||||
force: bool = False,
|
force: bool = False,
|
||||||
) -> bool:
|
) -> bool:
|
||||||
"""Re-run the DVC commands in dry mode and update dvc.yaml file in the
|
"""Re-run the DVC commands in dry mode and update dvc.yaml file in the
|
||||||
|
@ -83,7 +86,7 @@ def update_dvc_config(
|
||||||
path (Path): The path to the project directory.
|
path (Path): The path to the project directory.
|
||||||
config (Dict[str, Any]): The loaded project.yml.
|
config (Dict[str, Any]): The loaded project.yml.
|
||||||
verbose (bool): Whether to print additional info (via DVC).
|
verbose (bool): Whether to print additional info (via DVC).
|
||||||
silent (bool): Don't output anything (via DVC).
|
quiet (bool): Don't output anything (via DVC).
|
||||||
force (bool): Force update, even if hashes match.
|
force (bool): Force update, even if hashes match.
|
||||||
RETURNS (bool): Whether the DVC config file was updated.
|
RETURNS (bool): Whether the DVC config file was updated.
|
||||||
"""
|
"""
|
||||||
|
@ -105,6 +108,14 @@ def update_dvc_config(
|
||||||
dvc_config_path.unlink()
|
dvc_config_path.unlink()
|
||||||
dvc_commands = []
|
dvc_commands = []
|
||||||
config_commands = {cmd["name"]: cmd for cmd in config.get("commands", [])}
|
config_commands = {cmd["name"]: cmd for cmd in config.get("commands", [])}
|
||||||
|
|
||||||
|
# some flags that apply to every command
|
||||||
|
flags = []
|
||||||
|
if verbose:
|
||||||
|
flags.append("--verbose")
|
||||||
|
if quiet:
|
||||||
|
flags.append("--quiet")
|
||||||
|
|
||||||
for name in workflows[workflow]:
|
for name in workflows[workflow]:
|
||||||
command = config_commands[name]
|
command = config_commands[name]
|
||||||
deps = command.get("deps", [])
|
deps = command.get("deps", [])
|
||||||
|
@ -118,14 +129,26 @@ def update_dvc_config(
|
||||||
deps_cmd = [c for cl in [["-d", p] for p in deps] for c in cl]
|
deps_cmd = [c for cl in [["-d", p] for p in deps] for c in cl]
|
||||||
outputs_cmd = [c for cl in [["-o", p] for p in outputs] for c in cl]
|
outputs_cmd = [c for cl in [["-o", p] for p in outputs] for c in cl]
|
||||||
outputs_nc_cmd = [c for cl in [["-O", p] for p in outputs_no_cache] for c in cl]
|
outputs_nc_cmd = [c for cl in [["-O", p] for p in outputs_no_cache] for c in cl]
|
||||||
dvc_cmd = ["run", "-n", name, "-w", str(path), "--no-exec"]
|
|
||||||
|
dvc_cmd = ["run", *flags, "-n", name, "-w", str(path), "--no-exec"]
|
||||||
if command.get("no_skip"):
|
if command.get("no_skip"):
|
||||||
dvc_cmd.append("--always-changed")
|
dvc_cmd.append("--always-changed")
|
||||||
full_cmd = [*dvc_cmd, *deps_cmd, *outputs_cmd, *outputs_nc_cmd, *project_cmd]
|
full_cmd = [*dvc_cmd, *deps_cmd, *outputs_cmd, *outputs_nc_cmd, *project_cmd]
|
||||||
dvc_commands.append(join_command(full_cmd))
|
dvc_commands.append(join_command(full_cmd))
|
||||||
|
|
||||||
|
if not dvc_commands:
|
||||||
|
# If we don't check for this, then there will be an error when reading the
|
||||||
|
# config, since DVC wouldn't create it.
|
||||||
|
msg.fail(
|
||||||
|
"No usable commands for DVC found. This can happen if none of your "
|
||||||
|
"commands have dependencies or outputs.",
|
||||||
|
exits=1,
|
||||||
|
)
|
||||||
|
|
||||||
with working_dir(path):
|
with working_dir(path):
|
||||||
dvc_flags = {"--verbose": verbose, "--quiet": silent}
|
for c in dvc_commands:
|
||||||
run_dvc_commands(dvc_commands, flags=dvc_flags)
|
dvc_command = "dvc " + c
|
||||||
|
run_command(dvc_command)
|
||||||
with dvc_config_path.open("r+", encoding="utf8") as f:
|
with dvc_config_path.open("r+", encoding="utf8") as f:
|
||||||
content = f.read()
|
content = f.read()
|
||||||
f.seek(0, 0)
|
f.seek(0, 0)
|
||||||
|
@ -133,26 +156,6 @@ def update_dvc_config(
|
||||||
return True
|
return True
|
||||||
|
|
||||||
|
|
||||||
def run_dvc_commands(
|
|
||||||
commands: Iterable[str] = SimpleFrozenList(), flags: Dict[str, bool] = {}
|
|
||||||
) -> None:
|
|
||||||
"""Run a sequence of DVC commands in a subprocess, in order.
|
|
||||||
|
|
||||||
commands (List[str]): The string commands without the leading "dvc".
|
|
||||||
flags (Dict[str, bool]): Conditional flags to be added to command. Makes it
|
|
||||||
easier to pass flags like --quiet that depend on a variable or
|
|
||||||
command-line setting while avoiding lots of nested conditionals.
|
|
||||||
"""
|
|
||||||
for c in commands:
|
|
||||||
command = split_command(c)
|
|
||||||
dvc_command = ["dvc", *command]
|
|
||||||
# Add the flags if they are set to True
|
|
||||||
for flag, is_active in flags.items():
|
|
||||||
if is_active:
|
|
||||||
dvc_command.append(flag)
|
|
||||||
run_command(dvc_command)
|
|
||||||
|
|
||||||
|
|
||||||
def check_workflows(workflows: List[str], workflow: Optional[str] = None) -> None:
|
def check_workflows(workflows: List[str], workflow: Optional[str] = None) -> None:
|
||||||
"""Validate workflows provided in project.yml and check that a given
|
"""Validate workflows provided in project.yml and check that a given
|
||||||
workflow can be used to generate a DVC config.
|
workflow can be used to generate a DVC config.
|
||||||
|
|
|
@ -1,5 +1,8 @@
|
||||||
from typing import Optional, List, Dict, Sequence, Any, Iterable
|
from typing import Optional, List, Dict, Sequence, Any, Iterable, Tuple
|
||||||
|
import os.path
|
||||||
from pathlib import Path
|
from pathlib import Path
|
||||||
|
|
||||||
|
import pkg_resources
|
||||||
from wasabi import msg
|
from wasabi import msg
|
||||||
from wasabi.util import locale_escape
|
from wasabi.util import locale_escape
|
||||||
import sys
|
import sys
|
||||||
|
@ -71,6 +74,12 @@ def project_run(
|
||||||
commands = {cmd["name"]: cmd for cmd in config.get("commands", [])}
|
commands = {cmd["name"]: cmd for cmd in config.get("commands", [])}
|
||||||
workflows = config.get("workflows", {})
|
workflows = config.get("workflows", {})
|
||||||
validate_subcommand(list(commands.keys()), list(workflows.keys()), subcommand)
|
validate_subcommand(list(commands.keys()), list(workflows.keys()), subcommand)
|
||||||
|
|
||||||
|
req_path = project_dir / "requirements.txt"
|
||||||
|
if config.get("check_requirements", True) and os.path.exists(req_path):
|
||||||
|
with req_path.open() as requirements_file:
|
||||||
|
_check_requirements([req.replace("\n", "") for req in requirements_file])
|
||||||
|
|
||||||
if subcommand in workflows:
|
if subcommand in workflows:
|
||||||
msg.info(f"Running workflow '{subcommand}'")
|
msg.info(f"Running workflow '{subcommand}'")
|
||||||
for cmd in workflows[subcommand]:
|
for cmd in workflows[subcommand]:
|
||||||
|
@ -195,6 +204,8 @@ def validate_subcommand(
|
||||||
msg.fail(f"No commands or workflows defined in {PROJECT_FILE}", exits=1)
|
msg.fail(f"No commands or workflows defined in {PROJECT_FILE}", exits=1)
|
||||||
if subcommand not in commands and subcommand not in workflows:
|
if subcommand not in commands and subcommand not in workflows:
|
||||||
help_msg = []
|
help_msg = []
|
||||||
|
if subcommand in ["assets", "asset"]:
|
||||||
|
help_msg.append("Did you mean to run: python -m spacy project assets?")
|
||||||
if commands:
|
if commands:
|
||||||
help_msg.append(f"Available commands: {', '.join(commands)}")
|
help_msg.append(f"Available commands: {', '.join(commands)}")
|
||||||
if workflows:
|
if workflows:
|
||||||
|
@ -308,3 +319,32 @@ def get_fileinfo(project_dir: Path, paths: List[str]) -> List[Dict[str, Optional
|
||||||
md5 = get_checksum(file_path) if file_path.exists() else None
|
md5 = get_checksum(file_path) if file_path.exists() else None
|
||||||
data.append({"path": path, "md5": md5})
|
data.append({"path": path, "md5": md5})
|
||||||
return data
|
return data
|
||||||
|
|
||||||
|
|
||||||
|
def _check_requirements(requirements: List[str]) -> Tuple[bool, bool]:
|
||||||
|
"""Checks whether requirements are installed and free of version conflicts.
|
||||||
|
requirements (List[str]): List of requirements.
|
||||||
|
RETURNS (Tuple[bool, bool]): Whether (1) any packages couldn't be imported, (2) any packages with version conflicts
|
||||||
|
exist.
|
||||||
|
"""
|
||||||
|
|
||||||
|
failed_pkgs_msgs: List[str] = []
|
||||||
|
conflicting_pkgs_msgs: List[str] = []
|
||||||
|
|
||||||
|
for req in requirements:
|
||||||
|
try:
|
||||||
|
pkg_resources.require(req)
|
||||||
|
except pkg_resources.DistributionNotFound as dnf:
|
||||||
|
failed_pkgs_msgs.append(dnf.report())
|
||||||
|
except pkg_resources.VersionConflict as vc:
|
||||||
|
conflicting_pkgs_msgs.append(vc.report())
|
||||||
|
|
||||||
|
if len(failed_pkgs_msgs) or len(conflicting_pkgs_msgs):
|
||||||
|
msg.warn(
|
||||||
|
title="Missing requirements or requirement conflicts detected. Make sure your Python environment is set up "
|
||||||
|
"correctly and you installed all requirements specified in your project's requirements.txt: "
|
||||||
|
)
|
||||||
|
for pgk_msg in failed_pkgs_msgs + conflicting_pkgs_msgs:
|
||||||
|
msg.text(pgk_msg)
|
||||||
|
|
||||||
|
return len(failed_pkgs_msgs) > 0, len(conflicting_pkgs_msgs) > 0
|
||||||
|
|
|
@ -271,13 +271,8 @@ factory = "tok2vec"
|
||||||
[components.tok2vec.model.embed]
|
[components.tok2vec.model.embed]
|
||||||
@architectures = "spacy.MultiHashEmbed.v2"
|
@architectures = "spacy.MultiHashEmbed.v2"
|
||||||
width = ${components.tok2vec.model.encode.width}
|
width = ${components.tok2vec.model.encode.width}
|
||||||
{% if has_letters -%}
|
|
||||||
attrs = ["NORM", "PREFIX", "SUFFIX", "SHAPE"]
|
attrs = ["NORM", "PREFIX", "SUFFIX", "SHAPE"]
|
||||||
rows = [5000, 2500, 2500, 2500]
|
rows = [5000, 1000, 2500, 2500]
|
||||||
{% else -%}
|
|
||||||
attrs = ["ORTH", "SHAPE"]
|
|
||||||
rows = [5000, 2500]
|
|
||||||
{% endif -%}
|
|
||||||
include_static_vectors = {{ "true" if optimize == "accuracy" else "false" }}
|
include_static_vectors = {{ "true" if optimize == "accuracy" else "false" }}
|
||||||
|
|
||||||
[components.tok2vec.model.encode]
|
[components.tok2vec.model.encode]
|
||||||
|
|
|
@ -271,4 +271,3 @@ zh:
|
||||||
accuracy:
|
accuracy:
|
||||||
name: bert-base-chinese
|
name: bert-base-chinese
|
||||||
size_factor: 3
|
size_factor: 3
|
||||||
has_letters: false
|
|
||||||
|
|
|
@ -212,6 +212,8 @@ class Warnings(metaclass=ErrorsWithCodes):
|
||||||
W121 = ("Attempting to trace non-existent method '{method}' in pipe '{pipe}'")
|
W121 = ("Attempting to trace non-existent method '{method}' in pipe '{pipe}'")
|
||||||
W122 = ("Couldn't trace method '{method}' in pipe '{pipe}'. This can happen if the pipe class "
|
W122 = ("Couldn't trace method '{method}' in pipe '{pipe}'. This can happen if the pipe class "
|
||||||
"is a Cython extension type.")
|
"is a Cython extension type.")
|
||||||
|
W123 = ("Argument {arg} with value {arg_value} is used instead of {config_value} as specified in the config. Be "
|
||||||
|
"aware that this might affect other components in your pipeline.")
|
||||||
|
|
||||||
|
|
||||||
class Errors(metaclass=ErrorsWithCodes):
|
class Errors(metaclass=ErrorsWithCodes):
|
||||||
|
@ -230,8 +232,9 @@ class Errors(metaclass=ErrorsWithCodes):
|
||||||
"initialized component.")
|
"initialized component.")
|
||||||
E004 = ("Can't set up pipeline component: a factory for '{name}' already "
|
E004 = ("Can't set up pipeline component: a factory for '{name}' already "
|
||||||
"exists. Existing factory: {func}. New factory: {new_func}")
|
"exists. Existing factory: {func}. New factory: {new_func}")
|
||||||
E005 = ("Pipeline component '{name}' returned None. If you're using a "
|
E005 = ("Pipeline component '{name}' returned {returned_type} instead of a "
|
||||||
"custom component, maybe you forgot to return the processed Doc?")
|
"Doc. If you're using a custom component, maybe you forgot to "
|
||||||
|
"return the processed Doc?")
|
||||||
E006 = ("Invalid constraints for adding pipeline component. You can only "
|
E006 = ("Invalid constraints for adding pipeline component. You can only "
|
||||||
"set one of the following: before (component name or index), "
|
"set one of the following: before (component name or index), "
|
||||||
"after (component name or index), first (True) or last (True). "
|
"after (component name or index), first (True) or last (True). "
|
||||||
|
@ -249,7 +252,7 @@ class Errors(metaclass=ErrorsWithCodes):
|
||||||
E012 = ("Cannot add pattern for zero tokens to matcher.\nKey: {key}")
|
E012 = ("Cannot add pattern for zero tokens to matcher.\nKey: {key}")
|
||||||
E016 = ("MultitaskObjective target should be function or one of: dep, "
|
E016 = ("MultitaskObjective target should be function or one of: dep, "
|
||||||
"tag, ent, dep_tag_offset, ent_tag.")
|
"tag, ent, dep_tag_offset, ent_tag.")
|
||||||
E017 = ("Can only add unicode or bytes. Got type: {value_type}")
|
E017 = ("Can only add 'str' inputs to StringStore. Got type: {value_type}")
|
||||||
E018 = ("Can't retrieve string for hash '{hash_value}'. This usually "
|
E018 = ("Can't retrieve string for hash '{hash_value}'. This usually "
|
||||||
"refers to an issue with the `Vocab` or `StringStore`.")
|
"refers to an issue with the `Vocab` or `StringStore`.")
|
||||||
E019 = ("Can't create transition with unknown action ID: {action}. Action "
|
E019 = ("Can't create transition with unknown action ID: {action}. Action "
|
||||||
|
@ -457,13 +460,13 @@ class Errors(metaclass=ErrorsWithCodes):
|
||||||
"same, but found '{nlp}' and '{vocab}' respectively.")
|
"same, but found '{nlp}' and '{vocab}' respectively.")
|
||||||
E152 = ("The attribute {attr} is not supported for token patterns. "
|
E152 = ("The attribute {attr} is not supported for token patterns. "
|
||||||
"Please use the option `validate=True` with the Matcher, PhraseMatcher, "
|
"Please use the option `validate=True` with the Matcher, PhraseMatcher, "
|
||||||
"EntityRuler or AttributeRuler for more details.")
|
"SpanRuler or AttributeRuler for more details.")
|
||||||
E153 = ("The value type {vtype} is not supported for token patterns. "
|
E153 = ("The value type {vtype} is not supported for token patterns. "
|
||||||
"Please use the option validate=True with Matcher, PhraseMatcher, "
|
"Please use the option validate=True with Matcher, PhraseMatcher, "
|
||||||
"EntityRuler or AttributeRuler for more details.")
|
"SpanRuler or AttributeRuler for more details.")
|
||||||
E154 = ("One of the attributes or values is not supported for token "
|
E154 = ("One of the attributes or values is not supported for token "
|
||||||
"patterns. Please use the option `validate=True` with the Matcher, "
|
"patterns. Please use the option `validate=True` with the Matcher, "
|
||||||
"PhraseMatcher, or EntityRuler for more details.")
|
"PhraseMatcher, or SpanRuler for more details.")
|
||||||
E155 = ("The pipeline needs to include a {pipe} in order to use "
|
E155 = ("The pipeline needs to include a {pipe} in order to use "
|
||||||
"Matcher or PhraseMatcher with the attribute {attr}. "
|
"Matcher or PhraseMatcher with the attribute {attr}. "
|
||||||
"Try using `nlp()` instead of `nlp.make_doc()` or `list(nlp.pipe())` "
|
"Try using `nlp()` instead of `nlp.make_doc()` or `list(nlp.pipe())` "
|
||||||
|
@ -537,6 +540,8 @@ class Errors(metaclass=ErrorsWithCodes):
|
||||||
E199 = ("Unable to merge 0-length span at `doc[{start}:{end}]`.")
|
E199 = ("Unable to merge 0-length span at `doc[{start}:{end}]`.")
|
||||||
E200 = ("Can't set {attr} from Span.")
|
E200 = ("Can't set {attr} from Span.")
|
||||||
E202 = ("Unsupported {name} mode '{mode}'. Supported modes: {modes}.")
|
E202 = ("Unsupported {name} mode '{mode}'. Supported modes: {modes}.")
|
||||||
|
E203 = ("If the {name} embedding layer is not updated "
|
||||||
|
"during training, make sure to include it in 'annotating components'")
|
||||||
|
|
||||||
# New errors added in v3.x
|
# New errors added in v3.x
|
||||||
E853 = ("Unsupported component factory name '{name}'. The character '.' is "
|
E853 = ("Unsupported component factory name '{name}'. The character '.' is "
|
||||||
|
@ -706,11 +711,11 @@ class Errors(metaclass=ErrorsWithCodes):
|
||||||
"need to modify the pipeline, use the built-in methods like "
|
"need to modify the pipeline, use the built-in methods like "
|
||||||
"`nlp.add_pipe`, `nlp.remove_pipe`, `nlp.disable_pipe` or "
|
"`nlp.add_pipe`, `nlp.remove_pipe`, `nlp.disable_pipe` or "
|
||||||
"`nlp.enable_pipe` instead.")
|
"`nlp.enable_pipe` instead.")
|
||||||
E927 = ("Can't write to frozen list Maybe you're trying to modify a computed "
|
E927 = ("Can't write to frozen list. Maybe you're trying to modify a computed "
|
||||||
"property or default function argument?")
|
"property or default function argument?")
|
||||||
E928 = ("A KnowledgeBase can only be serialized to/from from a directory, "
|
E928 = ("An InMemoryLookupKB can only be serialized to/from from a directory, "
|
||||||
"but the provided argument {loc} points to a file.")
|
"but the provided argument {loc} points to a file.")
|
||||||
E929 = ("Couldn't read KnowledgeBase from {loc}. The path does not seem to exist.")
|
E929 = ("Couldn't read InMemoryLookupKB from {loc}. The path does not seem to exist.")
|
||||||
E930 = ("Received invalid get_examples callback in `{method}`. "
|
E930 = ("Received invalid get_examples callback in `{method}`. "
|
||||||
"Expected function that returns an iterable of Example objects but "
|
"Expected function that returns an iterable of Example objects but "
|
||||||
"got: {obj}")
|
"got: {obj}")
|
||||||
|
@ -912,8 +917,6 @@ class Errors(metaclass=ErrorsWithCodes):
|
||||||
E1021 = ("`pos` value \"{pp}\" is not a valid Universal Dependencies tag. "
|
E1021 = ("`pos` value \"{pp}\" is not a valid Universal Dependencies tag. "
|
||||||
"Non-UD tags should use the `tag` property.")
|
"Non-UD tags should use the `tag` property.")
|
||||||
E1022 = ("Words must be of type str or int, but input is of type '{wtype}'")
|
E1022 = ("Words must be of type str or int, but input is of type '{wtype}'")
|
||||||
E1023 = ("Couldn't read EntityRuler from the {path}. This file doesn't "
|
|
||||||
"exist.")
|
|
||||||
E1024 = ("A pattern with {attr_type} '{label}' is not present in "
|
E1024 = ("A pattern with {attr_type} '{label}' is not present in "
|
||||||
"'{component}' patterns.")
|
"'{component}' patterns.")
|
||||||
E1025 = ("Cannot intify the value '{value}' as an IOB string. The only "
|
E1025 = ("Cannot intify the value '{value}' as an IOB string. The only "
|
||||||
|
@ -936,13 +939,22 @@ class Errors(metaclass=ErrorsWithCodes):
|
||||||
E1040 = ("Doc.from_json requires all tokens to have the same attributes. "
|
E1040 = ("Doc.from_json requires all tokens to have the same attributes. "
|
||||||
"Some tokens do not contain annotation for: {partial_attrs}")
|
"Some tokens do not contain annotation for: {partial_attrs}")
|
||||||
E1041 = ("Expected a string, Doc, or bytes as input, but got: {type}")
|
E1041 = ("Expected a string, Doc, or bytes as input, but got: {type}")
|
||||||
E1042 = ("Function was called with `{arg1}`={arg1_values} and "
|
E1042 = ("`enable={enable}` and `disable={disable}` are inconsistent with each other.\nIf you only passed "
|
||||||
"`{arg2}`={arg2_values} but these arguments are conflicting.")
|
"one of `enable` or `disable`, the other argument is specified in your pipeline's configuration.\nIn that "
|
||||||
|
"case pass an empty list for the previously not specified argument to avoid this error.")
|
||||||
E1043 = ("Expected None or a value in range [{range_start}, {range_end}] for entity linker threshold, but got "
|
E1043 = ("Expected None or a value in range [{range_start}, {range_end}] for entity linker threshold, but got "
|
||||||
"{value}.")
|
"{value}.")
|
||||||
|
E1044 = ("Expected `candidates_batch_size` to be >= 1, but got: {value}")
|
||||||
|
E1045 = ("Encountered {parent} subclass without `{parent}.{method}` "
|
||||||
|
"method in '{name}'. If you want to use this method, make "
|
||||||
|
"sure it's overwritten on the subclass.")
|
||||||
|
E1046 = ("{cls_name} is an abstract class and cannot be instantiated. If you are looking for spaCy's default "
|
||||||
|
"knowledge base, use `InMemoryLookupKB`.")
|
||||||
|
|
||||||
# v4 error strings
|
# v4 error strings
|
||||||
E4000 = ("Expected a Doc as input, but got: '{type}'")
|
E4000 = ("Expected a Doc as input, but got: '{type}'")
|
||||||
|
E4001 = ("Expected input to be one of the following types: ({expected_types}), "
|
||||||
|
"but got '{received_type}'")
|
||||||
|
|
||||||
|
|
||||||
# Deprecated model shortcuts, only used in errors and warnings
|
# Deprecated model shortcuts, only used in errors and warnings
|
||||||
|
|
3
spacy/kb/__init__.py
Normal file
3
spacy/kb/__init__.py
Normal file
|
@ -0,0 +1,3 @@
|
||||||
|
from .kb import KnowledgeBase
|
||||||
|
from .kb_in_memory import InMemoryLookupKB
|
||||||
|
from .candidate import Candidate, get_candidates, get_candidates_batch
|
12
spacy/kb/candidate.pxd
Normal file
12
spacy/kb/candidate.pxd
Normal file
|
@ -0,0 +1,12 @@
|
||||||
|
from .kb cimport KnowledgeBase
|
||||||
|
from libcpp.vector cimport vector
|
||||||
|
from ..typedefs cimport hash_t
|
||||||
|
|
||||||
|
# Object used by the Entity Linker that summarizes one entity-alias candidate combination.
|
||||||
|
cdef class Candidate:
|
||||||
|
cdef readonly KnowledgeBase kb
|
||||||
|
cdef hash_t entity_hash
|
||||||
|
cdef float entity_freq
|
||||||
|
cdef vector[float] entity_vector
|
||||||
|
cdef hash_t alias_hash
|
||||||
|
cdef float prior_prob
|
74
spacy/kb/candidate.pyx
Normal file
74
spacy/kb/candidate.pyx
Normal file
|
@ -0,0 +1,74 @@
|
||||||
|
# cython: infer_types=True, profile=True
|
||||||
|
|
||||||
|
from typing import Iterable
|
||||||
|
from .kb cimport KnowledgeBase
|
||||||
|
from ..tokens import Span
|
||||||
|
|
||||||
|
cdef class Candidate:
|
||||||
|
"""A `Candidate` object refers to a textual mention (`alias`) that may or may not be resolved
|
||||||
|
to a specific `entity` from a Knowledge Base. This will be used as input for the entity linking
|
||||||
|
algorithm which will disambiguate the various candidates to the correct one.
|
||||||
|
Each candidate (alias, entity) pair is assigned a certain prior probability.
|
||||||
|
|
||||||
|
DOCS: https://spacy.io/api/kb/#candidate-init
|
||||||
|
"""
|
||||||
|
|
||||||
|
def __init__(self, KnowledgeBase kb, entity_hash, entity_freq, entity_vector, alias_hash, prior_prob):
|
||||||
|
self.kb = kb
|
||||||
|
self.entity_hash = entity_hash
|
||||||
|
self.entity_freq = entity_freq
|
||||||
|
self.entity_vector = entity_vector
|
||||||
|
self.alias_hash = alias_hash
|
||||||
|
self.prior_prob = prior_prob
|
||||||
|
|
||||||
|
@property
|
||||||
|
def entity(self) -> int:
|
||||||
|
"""RETURNS (uint64): hash of the entity's KB ID/name"""
|
||||||
|
return self.entity_hash
|
||||||
|
|
||||||
|
@property
|
||||||
|
def entity_(self) -> str:
|
||||||
|
"""RETURNS (str): ID/name of this entity in the KB"""
|
||||||
|
return self.kb.vocab.strings[self.entity_hash]
|
||||||
|
|
||||||
|
@property
|
||||||
|
def alias(self) -> int:
|
||||||
|
"""RETURNS (uint64): hash of the alias"""
|
||||||
|
return self.alias_hash
|
||||||
|
|
||||||
|
@property
|
||||||
|
def alias_(self) -> str:
|
||||||
|
"""RETURNS (str): ID of the original alias"""
|
||||||
|
return self.kb.vocab.strings[self.alias_hash]
|
||||||
|
|
||||||
|
@property
|
||||||
|
def entity_freq(self) -> float:
|
||||||
|
return self.entity_freq
|
||||||
|
|
||||||
|
@property
|
||||||
|
def entity_vector(self) -> Iterable[float]:
|
||||||
|
return self.entity_vector
|
||||||
|
|
||||||
|
@property
|
||||||
|
def prior_prob(self) -> float:
|
||||||
|
return self.prior_prob
|
||||||
|
|
||||||
|
|
||||||
|
def get_candidates(kb: KnowledgeBase, mention: Span) -> Iterable[Candidate]:
|
||||||
|
"""
|
||||||
|
Return candidate entities for a given mention and fetching appropriate entries from the index.
|
||||||
|
kb (KnowledgeBase): Knowledge base to query.
|
||||||
|
mention (Span): Entity mention for which to identify candidates.
|
||||||
|
RETURNS (Iterable[Candidate]): Identified candidates.
|
||||||
|
"""
|
||||||
|
return kb.get_candidates(mention)
|
||||||
|
|
||||||
|
|
||||||
|
def get_candidates_batch(kb: KnowledgeBase, mentions: Iterable[Span]) -> Iterable[Iterable[Candidate]]:
|
||||||
|
"""
|
||||||
|
Return candidate entities for the given mentions and fetching appropriate entries from the index.
|
||||||
|
kb (KnowledgeBase): Knowledge base to query.
|
||||||
|
mention (Iterable[Span]): Entity mentions for which to identify candidates.
|
||||||
|
RETURNS (Iterable[Iterable[Candidate]]): Identified candidates.
|
||||||
|
"""
|
||||||
|
return kb.get_candidates_batch(mentions)
|
10
spacy/kb/kb.pxd
Normal file
10
spacy/kb/kb.pxd
Normal file
|
@ -0,0 +1,10 @@
|
||||||
|
"""Knowledge-base for entity or concept linking."""
|
||||||
|
|
||||||
|
from cymem.cymem cimport Pool
|
||||||
|
from libc.stdint cimport int64_t
|
||||||
|
from ..vocab cimport Vocab
|
||||||
|
|
||||||
|
cdef class KnowledgeBase:
|
||||||
|
cdef Pool mem
|
||||||
|
cdef readonly Vocab vocab
|
||||||
|
cdef readonly int64_t entity_vector_length
|
108
spacy/kb/kb.pyx
Normal file
108
spacy/kb/kb.pyx
Normal file
|
@ -0,0 +1,108 @@
|
||||||
|
# cython: infer_types=True, profile=True
|
||||||
|
|
||||||
|
from pathlib import Path
|
||||||
|
from typing import Iterable, Tuple, Union
|
||||||
|
from cymem.cymem cimport Pool
|
||||||
|
|
||||||
|
from .candidate import Candidate
|
||||||
|
from ..tokens import Span
|
||||||
|
from ..util import SimpleFrozenList
|
||||||
|
from ..errors import Errors
|
||||||
|
|
||||||
|
|
||||||
|
cdef class KnowledgeBase:
|
||||||
|
"""A `KnowledgeBase` instance stores unique identifiers for entities and their textual aliases,
|
||||||
|
to support entity linking of named entities to real-world concepts.
|
||||||
|
This is an abstract class and requires its operations to be implemented.
|
||||||
|
|
||||||
|
DOCS: https://spacy.io/api/kb
|
||||||
|
"""
|
||||||
|
|
||||||
|
def __init__(self, vocab: Vocab, entity_vector_length: int):
|
||||||
|
"""Create a KnowledgeBase."""
|
||||||
|
# Make sure abstract KB is not instantiated.
|
||||||
|
if self.__class__ == KnowledgeBase:
|
||||||
|
raise TypeError(
|
||||||
|
Errors.E1046.format(cls_name=self.__class__.__name__)
|
||||||
|
)
|
||||||
|
|
||||||
|
self.vocab = vocab
|
||||||
|
self.entity_vector_length = entity_vector_length
|
||||||
|
self.mem = Pool()
|
||||||
|
|
||||||
|
def get_candidates_batch(self, mentions: Iterable[Span]) -> Iterable[Iterable[Candidate]]:
|
||||||
|
"""
|
||||||
|
Return candidate entities for specified texts. Each candidate defines the entity, the original alias,
|
||||||
|
and the prior probability of that alias resolving to that entity.
|
||||||
|
If no candidate is found for a given text, an empty list is returned.
|
||||||
|
mentions (Iterable[Span]): Mentions for which to get candidates.
|
||||||
|
RETURNS (Iterable[Iterable[Candidate]]): Identified candidates.
|
||||||
|
"""
|
||||||
|
return [self.get_candidates(span) for span in mentions]
|
||||||
|
|
||||||
|
def get_candidates(self, mention: Span) -> Iterable[Candidate]:
|
||||||
|
"""
|
||||||
|
Return candidate entities for specified text. Each candidate defines the entity, the original alias,
|
||||||
|
and the prior probability of that alias resolving to that entity.
|
||||||
|
If the no candidate is found for a given text, an empty list is returned.
|
||||||
|
mention (Span): Mention for which to get candidates.
|
||||||
|
RETURNS (Iterable[Candidate]): Identified candidates.
|
||||||
|
"""
|
||||||
|
raise NotImplementedError(
|
||||||
|
Errors.E1045.format(parent="KnowledgeBase", method="get_candidates", name=self.__name__)
|
||||||
|
)
|
||||||
|
|
||||||
|
def get_vectors(self, entities: Iterable[str]) -> Iterable[Iterable[float]]:
|
||||||
|
"""
|
||||||
|
Return vectors for entities.
|
||||||
|
entity (str): Entity name/ID.
|
||||||
|
RETURNS (Iterable[Iterable[float]]): Vectors for specified entities.
|
||||||
|
"""
|
||||||
|
return [self.get_vector(entity) for entity in entities]
|
||||||
|
|
||||||
|
def get_vector(self, str entity) -> Iterable[float]:
|
||||||
|
"""
|
||||||
|
Return vector for entity.
|
||||||
|
entity (str): Entity name/ID.
|
||||||
|
RETURNS (Iterable[float]): Vector for specified entity.
|
||||||
|
"""
|
||||||
|
raise NotImplementedError(
|
||||||
|
Errors.E1045.format(parent="KnowledgeBase", method="get_vector", name=self.__name__)
|
||||||
|
)
|
||||||
|
|
||||||
|
def to_bytes(self, **kwargs) -> bytes:
|
||||||
|
"""Serialize the current state to a binary string.
|
||||||
|
RETURNS (bytes): Current state as binary string.
|
||||||
|
"""
|
||||||
|
raise NotImplementedError(
|
||||||
|
Errors.E1045.format(parent="KnowledgeBase", method="to_bytes", name=self.__name__)
|
||||||
|
)
|
||||||
|
|
||||||
|
def from_bytes(self, bytes_data: bytes, *, exclude: Tuple[str] = tuple()):
|
||||||
|
"""Load state from a binary string.
|
||||||
|
bytes_data (bytes): KB state.
|
||||||
|
exclude (Tuple[str]): Properties to exclude when restoring KB.
|
||||||
|
"""
|
||||||
|
raise NotImplementedError(
|
||||||
|
Errors.E1045.format(parent="KnowledgeBase", method="from_bytes", name=self.__name__)
|
||||||
|
)
|
||||||
|
|
||||||
|
def to_disk(self, path: Union[str, Path], exclude: Iterable[str] = SimpleFrozenList()) -> None:
|
||||||
|
"""
|
||||||
|
Write KnowledgeBase content to disk.
|
||||||
|
path (Union[str, Path]): Target file path.
|
||||||
|
exclude (Iterable[str]): List of components to exclude.
|
||||||
|
"""
|
||||||
|
raise NotImplementedError(
|
||||||
|
Errors.E1045.format(parent="KnowledgeBase", method="to_disk", name=self.__name__)
|
||||||
|
)
|
||||||
|
|
||||||
|
def from_disk(self, path: Union[str, Path], exclude: Iterable[str] = SimpleFrozenList()) -> None:
|
||||||
|
"""
|
||||||
|
Load KnowledgeBase content from disk.
|
||||||
|
path (Union[str, Path]): Target file path.
|
||||||
|
exclude (Iterable[str]): List of components to exclude.
|
||||||
|
"""
|
||||||
|
raise NotImplementedError(
|
||||||
|
Errors.E1045.format(parent="KnowledgeBase", method="from_disk", name=self.__name__)
|
||||||
|
)
|
|
@ -1,14 +1,12 @@
|
||||||
"""Knowledge-base for entity or concept linking."""
|
"""Knowledge-base for entity or concept linking."""
|
||||||
from cymem.cymem cimport Pool
|
|
||||||
from preshed.maps cimport PreshMap
|
from preshed.maps cimport PreshMap
|
||||||
from libcpp.vector cimport vector
|
from libcpp.vector cimport vector
|
||||||
from libc.stdint cimport int32_t, int64_t
|
from libc.stdint cimport int32_t, int64_t
|
||||||
from libc.stdio cimport FILE
|
from libc.stdio cimport FILE
|
||||||
|
|
||||||
from .vocab cimport Vocab
|
from ..typedefs cimport hash_t
|
||||||
from .typedefs cimport hash_t
|
from ..structs cimport KBEntryC, AliasC
|
||||||
from .structs cimport KBEntryC, AliasC
|
from .kb cimport KnowledgeBase
|
||||||
|
|
||||||
|
|
||||||
ctypedef vector[KBEntryC] entry_vec
|
ctypedef vector[KBEntryC] entry_vec
|
||||||
ctypedef vector[AliasC] alias_vec
|
ctypedef vector[AliasC] alias_vec
|
||||||
|
@ -16,21 +14,7 @@ ctypedef vector[float] float_vec
|
||||||
ctypedef vector[float_vec] float_matrix
|
ctypedef vector[float_vec] float_matrix
|
||||||
|
|
||||||
|
|
||||||
# Object used by the Entity Linker that summarizes one entity-alias candidate combination.
|
cdef class InMemoryLookupKB(KnowledgeBase):
|
||||||
cdef class Candidate:
|
|
||||||
cdef readonly KnowledgeBase kb
|
|
||||||
cdef hash_t entity_hash
|
|
||||||
cdef float entity_freq
|
|
||||||
cdef vector[float] entity_vector
|
|
||||||
cdef hash_t alias_hash
|
|
||||||
cdef float prior_prob
|
|
||||||
|
|
||||||
|
|
||||||
cdef class KnowledgeBase:
|
|
||||||
cdef Pool mem
|
|
||||||
cdef readonly Vocab vocab
|
|
||||||
cdef int64_t entity_vector_length
|
|
||||||
|
|
||||||
# This maps 64bit keys (hash of unique entity string)
|
# This maps 64bit keys (hash of unique entity string)
|
||||||
# to 64bit values (position of the _KBEntryC struct in the _entries vector).
|
# to 64bit values (position of the _KBEntryC struct in the _entries vector).
|
||||||
# The PreshMap is pretty space efficient, as it uses open addressing. So
|
# The PreshMap is pretty space efficient, as it uses open addressing. So
|
|
@ -1,8 +1,7 @@
|
||||||
# cython: infer_types=True, profile=True
|
# cython: infer_types=True, profile=True
|
||||||
from typing import Iterator, Iterable, Callable, Dict, Any
|
from typing import Iterable, Callable, Dict, Any, Union
|
||||||
|
|
||||||
import srsly
|
import srsly
|
||||||
from cymem.cymem cimport Pool
|
|
||||||
from preshed.maps cimport PreshMap
|
from preshed.maps cimport PreshMap
|
||||||
from cpython.exc cimport PyErr_SetFromErrno
|
from cpython.exc cimport PyErr_SetFromErrno
|
||||||
from libc.stdio cimport fopen, fclose, fread, fwrite, feof, fseek
|
from libc.stdio cimport fopen, fclose, fread, fwrite, feof, fseek
|
||||||
|
@ -12,85 +11,28 @@ from libcpp.vector cimport vector
|
||||||
from pathlib import Path
|
from pathlib import Path
|
||||||
import warnings
|
import warnings
|
||||||
|
|
||||||
from .typedefs cimport hash_t
|
from ..tokens import Span
|
||||||
from .errors import Errors, Warnings
|
from ..typedefs cimport hash_t
|
||||||
from . import util
|
from ..errors import Errors, Warnings
|
||||||
from .util import SimpleFrozenList, ensure_path
|
from .. import util
|
||||||
|
from ..util import SimpleFrozenList, ensure_path
|
||||||
cdef class Candidate:
|
from ..vocab cimport Vocab
|
||||||
"""A `Candidate` object refers to a textual mention (`alias`) that may or may not be resolved
|
from .kb cimport KnowledgeBase
|
||||||
to a specific `entity` from a Knowledge Base. This will be used as input for the entity linking
|
from .candidate import Candidate as Candidate
|
||||||
algorithm which will disambiguate the various candidates to the correct one.
|
|
||||||
Each candidate (alias, entity) pair is assigned to a certain prior probability.
|
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/kb/#candidate_init
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(self, KnowledgeBase kb, entity_hash, entity_freq, entity_vector, alias_hash, prior_prob):
|
|
||||||
self.kb = kb
|
|
||||||
self.entity_hash = entity_hash
|
|
||||||
self.entity_freq = entity_freq
|
|
||||||
self.entity_vector = entity_vector
|
|
||||||
self.alias_hash = alias_hash
|
|
||||||
self.prior_prob = prior_prob
|
|
||||||
|
|
||||||
@property
|
|
||||||
def entity(self):
|
|
||||||
"""RETURNS (uint64): hash of the entity's KB ID/name"""
|
|
||||||
return self.entity_hash
|
|
||||||
|
|
||||||
@property
|
|
||||||
def entity_(self):
|
|
||||||
"""RETURNS (str): ID/name of this entity in the KB"""
|
|
||||||
return self.kb.vocab.strings[self.entity_hash]
|
|
||||||
|
|
||||||
@property
|
|
||||||
def alias(self):
|
|
||||||
"""RETURNS (uint64): hash of the alias"""
|
|
||||||
return self.alias_hash
|
|
||||||
|
|
||||||
@property
|
|
||||||
def alias_(self):
|
|
||||||
"""RETURNS (str): ID of the original alias"""
|
|
||||||
return self.kb.vocab.strings[self.alias_hash]
|
|
||||||
|
|
||||||
@property
|
|
||||||
def entity_freq(self):
|
|
||||||
return self.entity_freq
|
|
||||||
|
|
||||||
@property
|
|
||||||
def entity_vector(self):
|
|
||||||
return self.entity_vector
|
|
||||||
|
|
||||||
@property
|
|
||||||
def prior_prob(self):
|
|
||||||
return self.prior_prob
|
|
||||||
|
|
||||||
|
|
||||||
def get_candidates(KnowledgeBase kb, span) -> Iterator[Candidate]:
|
cdef class InMemoryLookupKB(KnowledgeBase):
|
||||||
"""
|
"""An `InMemoryLookupKB` instance stores unique identifiers for entities and their textual aliases,
|
||||||
Return candidate entities for a given span by using the text of the span as the alias
|
|
||||||
and fetching appropriate entries from the index.
|
|
||||||
This particular function is optimized to work with the built-in KB functionality,
|
|
||||||
but any other custom candidate generation method can be used in combination with the KB as well.
|
|
||||||
"""
|
|
||||||
return kb.get_alias_candidates(span.text)
|
|
||||||
|
|
||||||
|
|
||||||
cdef class KnowledgeBase:
|
|
||||||
"""A `KnowledgeBase` instance stores unique identifiers for entities and their textual aliases,
|
|
||||||
to support entity linking of named entities to real-world concepts.
|
to support entity linking of named entities to real-world concepts.
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/kb
|
DOCS: https://spacy.io/api/kb_in_memory
|
||||||
"""
|
"""
|
||||||
|
|
||||||
def __init__(self, Vocab vocab, entity_vector_length):
|
def __init__(self, Vocab vocab, entity_vector_length):
|
||||||
"""Create a KnowledgeBase."""
|
"""Create an InMemoryLookupKB."""
|
||||||
self.mem = Pool()
|
super().__init__(vocab, entity_vector_length)
|
||||||
self.entity_vector_length = entity_vector_length
|
|
||||||
self._entry_index = PreshMap()
|
self._entry_index = PreshMap()
|
||||||
self._alias_index = PreshMap()
|
self._alias_index = PreshMap()
|
||||||
self.vocab = vocab
|
|
||||||
self._create_empty_vectors(dummy_hash=self.vocab.strings[""])
|
self._create_empty_vectors(dummy_hash=self.vocab.strings[""])
|
||||||
|
|
||||||
def _initialize_entities(self, int64_t nr_entities):
|
def _initialize_entities(self, int64_t nr_entities):
|
||||||
|
@ -104,11 +46,6 @@ cdef class KnowledgeBase:
|
||||||
self._alias_index = PreshMap(nr_aliases + 1)
|
self._alias_index = PreshMap(nr_aliases + 1)
|
||||||
self._aliases_table = alias_vec(nr_aliases + 1)
|
self._aliases_table = alias_vec(nr_aliases + 1)
|
||||||
|
|
||||||
@property
|
|
||||||
def entity_vector_length(self):
|
|
||||||
"""RETURNS (uint64): length of the entity vectors"""
|
|
||||||
return self.entity_vector_length
|
|
||||||
|
|
||||||
def __len__(self):
|
def __len__(self):
|
||||||
return self.get_size_entities()
|
return self.get_size_entities()
|
||||||
|
|
||||||
|
@ -286,7 +223,10 @@ cdef class KnowledgeBase:
|
||||||
alias_entry.probs = probs
|
alias_entry.probs = probs
|
||||||
self._aliases_table[alias_index] = alias_entry
|
self._aliases_table[alias_index] = alias_entry
|
||||||
|
|
||||||
def get_alias_candidates(self, str alias) -> Iterator[Candidate]:
|
def get_candidates(self, mention: Span) -> Iterable[Candidate]:
|
||||||
|
return self.get_alias_candidates(mention.text) # type: ignore
|
||||||
|
|
||||||
|
def get_alias_candidates(self, str alias) -> Iterable[Candidate]:
|
||||||
"""
|
"""
|
||||||
Return candidate entities for an alias. Each candidate defines the entity, the original alias,
|
Return candidate entities for an alias. Each candidate defines the entity, the original alias,
|
||||||
and the prior probability of that alias resolving to that entity.
|
and the prior probability of that alias resolving to that entity.
|
|
@ -72,10 +72,10 @@ class CatalanLemmatizer(Lemmatizer):
|
||||||
oov_forms.append(form)
|
oov_forms.append(form)
|
||||||
if not forms:
|
if not forms:
|
||||||
forms.extend(oov_forms)
|
forms.extend(oov_forms)
|
||||||
if not forms and string in lookup_table.keys():
|
|
||||||
forms.append(self.lookup_lemmatize(token)[0])
|
# use lookups, and fall back to the token itself
|
||||||
if not forms:
|
if not forms:
|
||||||
forms.append(string)
|
forms.append(lookup_table.get(string, [string])[0])
|
||||||
forms = list(dict.fromkeys(forms))
|
forms = list(dict.fromkeys(forms))
|
||||||
self.cache[cache_key] = forms
|
self.cache[cache_key] = forms
|
||||||
return forms
|
return forms
|
||||||
|
|
|
@ -280,7 +280,7 @@ _currency = (
|
||||||
_punct = (
|
_punct = (
|
||||||
r"… …… , : ; \! \? ¿ ؟ ¡ \( \) \[ \] \{ \} < > _ # \* & 。 ? ! , 、 ; : ~ · । ، ۔ ؛ ٪"
|
r"… …… , : ; \! \? ¿ ؟ ¡ \( \) \[ \] \{ \} < > _ # \* & 。 ? ! , 、 ; : ~ · । ، ۔ ؛ ٪"
|
||||||
)
|
)
|
||||||
_quotes = r'\' " ” “ ` ‘ ´ ’ ‚ , „ » « 「 」 『 』 ( ) 〔 〕 【 】 《 》 〈 〉'
|
_quotes = r'\' " ” “ ` ‘ ´ ’ ‚ , „ » « 「 」 『 』 ( ) 〔 〕 【 】 《 》 〈 〉 〈 〉 ⟦ ⟧'
|
||||||
_hyphens = "- – — -- --- —— ~"
|
_hyphens = "- – — -- --- —— ~"
|
||||||
|
|
||||||
# Various symbols like dingbats, but also emoji
|
# Various symbols like dingbats, but also emoji
|
||||||
|
|
|
@ -53,11 +53,16 @@ class FrenchLemmatizer(Lemmatizer):
|
||||||
rules = rules_table.get(univ_pos, [])
|
rules = rules_table.get(univ_pos, [])
|
||||||
string = string.lower()
|
string = string.lower()
|
||||||
forms = []
|
forms = []
|
||||||
|
# first try lookup in table based on upos
|
||||||
if string in index:
|
if string in index:
|
||||||
forms.append(string)
|
forms.append(string)
|
||||||
self.cache[cache_key] = forms
|
self.cache[cache_key] = forms
|
||||||
return forms
|
return forms
|
||||||
|
|
||||||
|
# then add anything in the exceptions table
|
||||||
forms.extend(exceptions.get(string, []))
|
forms.extend(exceptions.get(string, []))
|
||||||
|
|
||||||
|
# if nothing found yet, use the rules
|
||||||
oov_forms = []
|
oov_forms = []
|
||||||
if not forms:
|
if not forms:
|
||||||
for old, new in rules:
|
for old, new in rules:
|
||||||
|
@ -69,12 +74,14 @@ class FrenchLemmatizer(Lemmatizer):
|
||||||
forms.append(form)
|
forms.append(form)
|
||||||
else:
|
else:
|
||||||
oov_forms.append(form)
|
oov_forms.append(form)
|
||||||
|
|
||||||
|
# if still nothing, add the oov forms from rules
|
||||||
if not forms:
|
if not forms:
|
||||||
forms.extend(oov_forms)
|
forms.extend(oov_forms)
|
||||||
if not forms and string in lookup_table.keys():
|
|
||||||
forms.append(self.lookup_lemmatize(token)[0])
|
# use lookups, which fall back to the token itself
|
||||||
if not forms:
|
if not forms:
|
||||||
forms.append(string)
|
forms.append(lookup_table.get(string, [string])[0])
|
||||||
forms = list(dict.fromkeys(forms))
|
forms = list(dict.fromkeys(forms))
|
||||||
self.cache[cache_key] = forms
|
self.cache[cache_key] = forms
|
||||||
return forms
|
return forms
|
||||||
|
|
|
@ -1,11 +1,15 @@
|
||||||
from .tokenizer_exceptions import TOKENIZER_EXCEPTIONS
|
from .tokenizer_exceptions import TOKENIZER_EXCEPTIONS
|
||||||
from .stop_words import STOP_WORDS
|
from .stop_words import STOP_WORDS
|
||||||
from .lex_attrs import LEX_ATTRS
|
from .lex_attrs import LEX_ATTRS
|
||||||
|
from .punctuation import TOKENIZER_PREFIXES, TOKENIZER_SUFFIXES, TOKENIZER_INFIXES
|
||||||
from ...language import Language, BaseDefaults
|
from ...language import Language, BaseDefaults
|
||||||
|
|
||||||
|
|
||||||
class AncientGreekDefaults(BaseDefaults):
|
class AncientGreekDefaults(BaseDefaults):
|
||||||
tokenizer_exceptions = TOKENIZER_EXCEPTIONS
|
tokenizer_exceptions = TOKENIZER_EXCEPTIONS
|
||||||
|
prefixes = TOKENIZER_PREFIXES
|
||||||
|
suffixes = TOKENIZER_SUFFIXES
|
||||||
|
infixes = TOKENIZER_INFIXES
|
||||||
lex_attr_getters = LEX_ATTRS
|
lex_attr_getters = LEX_ATTRS
|
||||||
stop_words = STOP_WORDS
|
stop_words = STOP_WORDS
|
||||||
|
|
||||||
|
|
46
spacy/lang/grc/punctuation.py
Normal file
46
spacy/lang/grc/punctuation.py
Normal file
|
@ -0,0 +1,46 @@
|
||||||
|
from ..char_classes import LIST_PUNCT, LIST_ELLIPSES, LIST_QUOTES, LIST_CURRENCY
|
||||||
|
from ..char_classes import LIST_ICONS, ALPHA_LOWER, ALPHA_UPPER, ALPHA, HYPHENS
|
||||||
|
from ..char_classes import CONCAT_QUOTES
|
||||||
|
|
||||||
|
_prefixes = (
|
||||||
|
[
|
||||||
|
"†",
|
||||||
|
"⸏",
|
||||||
|
]
|
||||||
|
+ LIST_PUNCT
|
||||||
|
+ LIST_ELLIPSES
|
||||||
|
+ LIST_QUOTES
|
||||||
|
+ LIST_CURRENCY
|
||||||
|
+ LIST_ICONS
|
||||||
|
)
|
||||||
|
|
||||||
|
_suffixes = (
|
||||||
|
LIST_PUNCT
|
||||||
|
+ LIST_ELLIPSES
|
||||||
|
+ LIST_QUOTES
|
||||||
|
+ LIST_ICONS
|
||||||
|
+ [
|
||||||
|
"†",
|
||||||
|
"⸎",
|
||||||
|
r"(?<=[\u1F00-\u1FFF\u0370-\u03FF])[\-\.⸏]",
|
||||||
|
]
|
||||||
|
)
|
||||||
|
|
||||||
|
_infixes = (
|
||||||
|
LIST_ELLIPSES
|
||||||
|
+ LIST_ICONS
|
||||||
|
+ [
|
||||||
|
r"(?<=[0-9])[+\-\*^](?=[0-9-])",
|
||||||
|
r"(?<=[{al}{q}])\.(?=[{au}{q}])".format(
|
||||||
|
al=ALPHA_LOWER, au=ALPHA_UPPER, q=CONCAT_QUOTES
|
||||||
|
),
|
||||||
|
r"(?<=[{a}]),(?=[{a}])".format(a=ALPHA),
|
||||||
|
r"(?<=[{a}0-9])(?:{h})(?=[{a}])".format(a=ALPHA, h=HYPHENS),
|
||||||
|
r"(?<=[{a}0-9])[:<>=/](?=[{a}])".format(a=ALPHA),
|
||||||
|
r"(?<=[\u1F00-\u1FFF\u0370-\u03FF])—",
|
||||||
|
]
|
||||||
|
)
|
||||||
|
|
||||||
|
TOKENIZER_PREFIXES = _prefixes
|
||||||
|
TOKENIZER_SUFFIXES = _suffixes
|
||||||
|
TOKENIZER_INFIXES = _infixes
|
18
spacy/lang/la/__init__.py
Normal file
18
spacy/lang/la/__init__.py
Normal file
|
@ -0,0 +1,18 @@
|
||||||
|
from ...language import Language, BaseDefaults
|
||||||
|
from .tokenizer_exceptions import TOKENIZER_EXCEPTIONS
|
||||||
|
from .stop_words import STOP_WORDS
|
||||||
|
from .lex_attrs import LEX_ATTRS
|
||||||
|
|
||||||
|
|
||||||
|
class LatinDefaults(BaseDefaults):
|
||||||
|
tokenizer_exceptions = TOKENIZER_EXCEPTIONS
|
||||||
|
stop_words = STOP_WORDS
|
||||||
|
lex_attr_getters = LEX_ATTRS
|
||||||
|
|
||||||
|
|
||||||
|
class Latin(Language):
|
||||||
|
lang = "la"
|
||||||
|
Defaults = LatinDefaults
|
||||||
|
|
||||||
|
|
||||||
|
__all__ = ["Latin"]
|
34
spacy/lang/la/lex_attrs.py
Normal file
34
spacy/lang/la/lex_attrs.py
Normal file
|
@ -0,0 +1,34 @@
|
||||||
|
from ...attrs import LIKE_NUM
|
||||||
|
import re
|
||||||
|
|
||||||
|
# cf. Goyvaerts/Levithan 2009; case-insensitive, allow 4
|
||||||
|
roman_numerals_compile = re.compile(
|
||||||
|
r"(?i)^(?=[MDCLXVI])M*(C[MD]|D?C{0,4})(X[CL]|L?X{0,4})(I[XV]|V?I{0,4})$"
|
||||||
|
)
|
||||||
|
|
||||||
|
_num_words = set(
|
||||||
|
"""
|
||||||
|
unus una unum duo duae tres tria quattuor quinque sex septem octo novem decem
|
||||||
|
""".split()
|
||||||
|
)
|
||||||
|
|
||||||
|
_ordinal_words = set(
|
||||||
|
"""
|
||||||
|
primus prima primum secundus secunda secundum tertius tertia tertium
|
||||||
|
""".split()
|
||||||
|
)
|
||||||
|
|
||||||
|
|
||||||
|
def like_num(text):
|
||||||
|
if text.isdigit():
|
||||||
|
return True
|
||||||
|
if roman_numerals_compile.match(text):
|
||||||
|
return True
|
||||||
|
if text.lower() in _num_words:
|
||||||
|
return True
|
||||||
|
if text.lower() in _ordinal_words:
|
||||||
|
return True
|
||||||
|
return False
|
||||||
|
|
||||||
|
|
||||||
|
LEX_ATTRS = {LIKE_NUM: like_num}
|
37
spacy/lang/la/stop_words.py
Normal file
37
spacy/lang/la/stop_words.py
Normal file
|
@ -0,0 +1,37 @@
|
||||||
|
# Corrected Perseus list, cf. https://wiki.digitalclassicist.org/Stopwords_for_Greek_and_Latin
|
||||||
|
|
||||||
|
STOP_WORDS = set(
|
||||||
|
"""
|
||||||
|
ab ac ad adhuc aliqui aliquis an ante apud at atque aut autem
|
||||||
|
|
||||||
|
cum cur
|
||||||
|
|
||||||
|
de deinde dum
|
||||||
|
|
||||||
|
ego enim ergo es est et etiam etsi ex
|
||||||
|
|
||||||
|
fio
|
||||||
|
|
||||||
|
haud hic
|
||||||
|
|
||||||
|
iam idem igitur ille in infra inter interim ipse is ita
|
||||||
|
|
||||||
|
magis modo mox
|
||||||
|
|
||||||
|
nam ne nec necque neque nisi non nos
|
||||||
|
|
||||||
|
o ob
|
||||||
|
|
||||||
|
per possum post pro
|
||||||
|
|
||||||
|
quae quam quare qui quia quicumque quidem quilibet quis quisnam quisquam quisque quisquis quo quoniam
|
||||||
|
|
||||||
|
sed si sic sive sub sui sum super suus
|
||||||
|
|
||||||
|
tam tamen trans tu tum
|
||||||
|
|
||||||
|
ubi uel uero
|
||||||
|
|
||||||
|
vel vero
|
||||||
|
""".split()
|
||||||
|
)
|
76
spacy/lang/la/tokenizer_exceptions.py
Normal file
76
spacy/lang/la/tokenizer_exceptions.py
Normal file
|
@ -0,0 +1,76 @@
|
||||||
|
from ..tokenizer_exceptions import BASE_EXCEPTIONS
|
||||||
|
from ...symbols import ORTH
|
||||||
|
from ...util import update_exc
|
||||||
|
|
||||||
|
|
||||||
|
## TODO: Look into systematically handling u/v
|
||||||
|
_exc = {
|
||||||
|
"mecum": [{ORTH: "me"}, {ORTH: "cum"}],
|
||||||
|
"tecum": [{ORTH: "te"}, {ORTH: "cum"}],
|
||||||
|
"nobiscum": [{ORTH: "nobis"}, {ORTH: "cum"}],
|
||||||
|
"vobiscum": [{ORTH: "vobis"}, {ORTH: "cum"}],
|
||||||
|
"uobiscum": [{ORTH: "uobis"}, {ORTH: "cum"}],
|
||||||
|
}
|
||||||
|
|
||||||
|
for orth in [
|
||||||
|
"A.",
|
||||||
|
"Agr.",
|
||||||
|
"Ap.",
|
||||||
|
"C.",
|
||||||
|
"Cn.",
|
||||||
|
"D.",
|
||||||
|
"F.",
|
||||||
|
"K.",
|
||||||
|
"L.",
|
||||||
|
"M'.",
|
||||||
|
"M.",
|
||||||
|
"Mam.",
|
||||||
|
"N.",
|
||||||
|
"Oct.",
|
||||||
|
"Opet.",
|
||||||
|
"P.",
|
||||||
|
"Paul.",
|
||||||
|
"Post.",
|
||||||
|
"Pro.",
|
||||||
|
"Q.",
|
||||||
|
"S.",
|
||||||
|
"Ser.",
|
||||||
|
"Sert.",
|
||||||
|
"Sex.",
|
||||||
|
"St.",
|
||||||
|
"Sta.",
|
||||||
|
"T.",
|
||||||
|
"Ti.",
|
||||||
|
"V.",
|
||||||
|
"Vol.",
|
||||||
|
"Vop.",
|
||||||
|
"U.",
|
||||||
|
"Uol.",
|
||||||
|
"Uop.",
|
||||||
|
"Ian.",
|
||||||
|
"Febr.",
|
||||||
|
"Mart.",
|
||||||
|
"Apr.",
|
||||||
|
"Mai.",
|
||||||
|
"Iun.",
|
||||||
|
"Iul.",
|
||||||
|
"Aug.",
|
||||||
|
"Sept.",
|
||||||
|
"Oct.",
|
||||||
|
"Nov.",
|
||||||
|
"Nou.",
|
||||||
|
"Dec.",
|
||||||
|
"Non.",
|
||||||
|
"Id.",
|
||||||
|
"A.D.",
|
||||||
|
"Coll.",
|
||||||
|
"Cos.",
|
||||||
|
"Ord.",
|
||||||
|
"Pl.",
|
||||||
|
"S.C.",
|
||||||
|
"Suff.",
|
||||||
|
"Trib.",
|
||||||
|
]:
|
||||||
|
_exc[orth] = [{ORTH: orth}]
|
||||||
|
|
||||||
|
TOKENIZER_EXCEPTIONS = update_exc(BASE_EXCEPTIONS, _exc)
|
|
@ -23,7 +23,7 @@ class RussianLemmatizer(Lemmatizer):
|
||||||
overwrite: bool = False,
|
overwrite: bool = False,
|
||||||
scorer: Optional[Callable] = lemmatizer_score,
|
scorer: Optional[Callable] = lemmatizer_score,
|
||||||
) -> None:
|
) -> None:
|
||||||
if mode == "pymorphy2":
|
if mode in {"pymorphy2", "pymorphy2_lookup"}:
|
||||||
try:
|
try:
|
||||||
from pymorphy2 import MorphAnalyzer
|
from pymorphy2 import MorphAnalyzer
|
||||||
except ImportError:
|
except ImportError:
|
||||||
|
|
|
@ -18,7 +18,7 @@ class UkrainianLemmatizer(RussianLemmatizer):
|
||||||
overwrite: bool = False,
|
overwrite: bool = False,
|
||||||
scorer: Optional[Callable] = lemmatizer_score,
|
scorer: Optional[Callable] = lemmatizer_score,
|
||||||
) -> None:
|
) -> None:
|
||||||
if mode == "pymorphy2":
|
if mode in {"pymorphy2", "pymorphy2_lookup"}:
|
||||||
try:
|
try:
|
||||||
from pymorphy2 import MorphAnalyzer
|
from pymorphy2 import MorphAnalyzer
|
||||||
except ImportError:
|
except ImportError:
|
||||||
|
|
|
@ -1,4 +1,4 @@
|
||||||
from typing import Iterator, Optional, Any, Dict, Callable, Iterable, Collection
|
from typing import Iterator, Optional, Any, Dict, Callable, Iterable
|
||||||
from typing import Union, Tuple, List, Set, Pattern, Sequence
|
from typing import Union, Tuple, List, Set, Pattern, Sequence
|
||||||
from typing import NoReturn, TYPE_CHECKING, TypeVar, cast, overload
|
from typing import NoReturn, TYPE_CHECKING, TypeVar, cast, overload
|
||||||
|
|
||||||
|
@ -10,6 +10,7 @@ from contextlib import contextmanager
|
||||||
from copy import deepcopy
|
from copy import deepcopy
|
||||||
from pathlib import Path
|
from pathlib import Path
|
||||||
import warnings
|
import warnings
|
||||||
|
|
||||||
from thinc.api import get_current_ops, Config, CupyOps, Optimizer
|
from thinc.api import get_current_ops, Config, CupyOps, Optimizer
|
||||||
import srsly
|
import srsly
|
||||||
import multiprocessing as mp
|
import multiprocessing as mp
|
||||||
|
@ -24,7 +25,7 @@ from .pipe_analysis import validate_attrs, analyze_pipes, print_pipe_analysis
|
||||||
from .training import Example, validate_examples
|
from .training import Example, validate_examples
|
||||||
from .training.initialize import init_vocab, init_tok2vec
|
from .training.initialize import init_vocab, init_tok2vec
|
||||||
from .scorer import Scorer
|
from .scorer import Scorer
|
||||||
from .util import registry, SimpleFrozenList, _pipe, raise_error
|
from .util import registry, SimpleFrozenList, _pipe, raise_error, _DEFAULT_EMPTY_PIPES
|
||||||
from .util import SimpleFrozenDict, combine_score_weights, CONFIG_SECTION_ORDER
|
from .util import SimpleFrozenDict, combine_score_weights, CONFIG_SECTION_ORDER
|
||||||
from .util import warn_if_jupyter_cupy
|
from .util import warn_if_jupyter_cupy
|
||||||
from .lang.tokenizer_exceptions import URL_MATCH, BASE_EXCEPTIONS
|
from .lang.tokenizer_exceptions import URL_MATCH, BASE_EXCEPTIONS
|
||||||
|
@ -1028,8 +1029,8 @@ class Language:
|
||||||
raise ValueError(Errors.E109.format(name=name)) from e
|
raise ValueError(Errors.E109.format(name=name)) from e
|
||||||
except Exception as e:
|
except Exception as e:
|
||||||
error_handler(name, proc, [doc], e)
|
error_handler(name, proc, [doc], e)
|
||||||
if doc is None:
|
if not isinstance(doc, Doc):
|
||||||
raise ValueError(Errors.E005.format(name=name))
|
raise ValueError(Errors.E005.format(name=name, returned_type=type(doc)))
|
||||||
return doc
|
return doc
|
||||||
|
|
||||||
def disable_pipes(self, *names) -> "DisabledPipes":
|
def disable_pipes(self, *names) -> "DisabledPipes":
|
||||||
|
@ -1063,7 +1064,7 @@ class Language:
|
||||||
"""
|
"""
|
||||||
if enable is None and disable is None:
|
if enable is None and disable is None:
|
||||||
raise ValueError(Errors.E991)
|
raise ValueError(Errors.E991)
|
||||||
if disable is not None and isinstance(disable, str):
|
if isinstance(disable, str):
|
||||||
disable = [disable]
|
disable = [disable]
|
||||||
if enable is not None:
|
if enable is not None:
|
||||||
if isinstance(enable, str):
|
if isinstance(enable, str):
|
||||||
|
@ -1698,9 +1699,9 @@ class Language:
|
||||||
config: Union[Dict[str, Any], Config] = {},
|
config: Union[Dict[str, Any], Config] = {},
|
||||||
*,
|
*,
|
||||||
vocab: Union[Vocab, bool] = True,
|
vocab: Union[Vocab, bool] = True,
|
||||||
disable: Iterable[str] = SimpleFrozenList(),
|
disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
|
||||||
enable: Iterable[str] = SimpleFrozenList(),
|
enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
|
||||||
exclude: Iterable[str] = SimpleFrozenList(),
|
exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
|
||||||
meta: Dict[str, Any] = SimpleFrozenDict(),
|
meta: Dict[str, Any] = SimpleFrozenDict(),
|
||||||
auto_fill: bool = True,
|
auto_fill: bool = True,
|
||||||
validate: bool = True,
|
validate: bool = True,
|
||||||
|
@ -1711,12 +1712,12 @@ class Language:
|
||||||
|
|
||||||
config (Dict[str, Any] / Config): The loaded config.
|
config (Dict[str, Any] / Config): The loaded config.
|
||||||
vocab (Vocab): A Vocab object. If True, a vocab is created.
|
vocab (Vocab): A Vocab object. If True, a vocab is created.
|
||||||
disable (Iterable[str]): Names of pipeline components to disable.
|
disable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to disable.
|
||||||
Disabled pipes will be loaded but they won't be run unless you
|
Disabled pipes will be loaded but they won't be run unless you
|
||||||
explicitly enable them by calling nlp.enable_pipe.
|
explicitly enable them by calling nlp.enable_pipe.
|
||||||
enable (Iterable[str]): Names of pipeline components to enable. All other
|
enable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to enable. All other
|
||||||
pipes will be disabled (and can be enabled using `nlp.enable_pipe`).
|
pipes will be disabled (and can be enabled using `nlp.enable_pipe`).
|
||||||
exclude (Iterable[str]): Names of pipeline components to exclude.
|
exclude (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to exclude.
|
||||||
Excluded components won't be loaded.
|
Excluded components won't be loaded.
|
||||||
meta (Dict[str, Any]): Meta overrides for nlp.meta.
|
meta (Dict[str, Any]): Meta overrides for nlp.meta.
|
||||||
auto_fill (bool): Automatically fill in missing values in config based
|
auto_fill (bool): Automatically fill in missing values in config based
|
||||||
|
@ -1871,9 +1872,38 @@ class Language:
|
||||||
nlp.vocab.from_bytes(vocab_b)
|
nlp.vocab.from_bytes(vocab_b)
|
||||||
|
|
||||||
# Resolve disabled/enabled settings.
|
# Resolve disabled/enabled settings.
|
||||||
|
if isinstance(disable, str):
|
||||||
|
disable = [disable]
|
||||||
|
if isinstance(enable, str):
|
||||||
|
enable = [enable]
|
||||||
|
if isinstance(exclude, str):
|
||||||
|
exclude = [exclude]
|
||||||
|
|
||||||
|
def fetch_pipes_status(value: Iterable[str], key: str) -> Iterable[str]:
|
||||||
|
"""Fetch value for `enable` or `disable` w.r.t. the specified config and passed arguments passed to
|
||||||
|
.load(). If both arguments and config specified values for this field, the passed arguments take precedence
|
||||||
|
and a warning is printed.
|
||||||
|
value (Iterable[str]): Passed value for `enable` or `disable`.
|
||||||
|
key (str): Key for field in config (either "enabled" or "disabled").
|
||||||
|
RETURN (Iterable[str]):
|
||||||
|
"""
|
||||||
|
# We assume that no argument was passed if the value is the specified default value.
|
||||||
|
if id(value) == id(_DEFAULT_EMPTY_PIPES):
|
||||||
|
return config["nlp"].get(key, [])
|
||||||
|
else:
|
||||||
|
if len(config["nlp"].get(key, [])):
|
||||||
|
warnings.warn(
|
||||||
|
Warnings.W123.format(
|
||||||
|
arg=key[:-1],
|
||||||
|
arg_value=value,
|
||||||
|
config_value=config["nlp"][key],
|
||||||
|
)
|
||||||
|
)
|
||||||
|
return value
|
||||||
|
|
||||||
disabled_pipes = cls._resolve_component_status(
|
disabled_pipes = cls._resolve_component_status(
|
||||||
[*config["nlp"]["disabled"], *disable],
|
fetch_pipes_status(disable, "disabled"),
|
||||||
[*config["nlp"].get("enabled", []), *enable],
|
fetch_pipes_status(enable, "enabled"),
|
||||||
config["nlp"]["pipeline"],
|
config["nlp"]["pipeline"],
|
||||||
)
|
)
|
||||||
nlp._disabled = set(p for p in disabled_pipes if p not in exclude)
|
nlp._disabled = set(p for p in disabled_pipes if p not in exclude)
|
||||||
|
@ -2031,37 +2061,34 @@ class Language:
|
||||||
|
|
||||||
@staticmethod
|
@staticmethod
|
||||||
def _resolve_component_status(
|
def _resolve_component_status(
|
||||||
disable: Iterable[str], enable: Iterable[str], pipe_names: Collection[str]
|
disable: Union[str, Iterable[str]],
|
||||||
|
enable: Union[str, Iterable[str]],
|
||||||
|
pipe_names: Iterable[str],
|
||||||
) -> Tuple[str, ...]:
|
) -> Tuple[str, ...]:
|
||||||
"""Derives whether (1) `disable` and `enable` values are consistent and (2)
|
"""Derives whether (1) `disable` and `enable` values are consistent and (2)
|
||||||
resolves those to a single set of disabled components. Raises an error in
|
resolves those to a single set of disabled components. Raises an error in
|
||||||
case of inconsistency.
|
case of inconsistency.
|
||||||
|
|
||||||
disable (Iterable[str]): Names of components or serialization fields to disable.
|
disable (Union[str, Iterable[str]]): Name(s) of component(s) or serialization fields to disable.
|
||||||
enable (Iterable[str]): Names of pipeline components to enable.
|
enable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to enable.
|
||||||
pipe_names (Iterable[str]): Names of all pipeline components.
|
pipe_names (Iterable[str]): Names of all pipeline components.
|
||||||
|
|
||||||
RETURNS (Tuple[str, ...]): Names of components to exclude from pipeline w.r.t.
|
RETURNS (Tuple[str, ...]): Names of components to exclude from pipeline w.r.t.
|
||||||
specified includes and excludes.
|
specified includes and excludes.
|
||||||
"""
|
"""
|
||||||
|
|
||||||
if disable is not None and isinstance(disable, str):
|
if isinstance(disable, str):
|
||||||
disable = [disable]
|
disable = [disable]
|
||||||
to_disable = disable
|
to_disable = disable
|
||||||
|
|
||||||
if enable:
|
if enable:
|
||||||
|
if isinstance(enable, str):
|
||||||
|
enable = [enable]
|
||||||
to_disable = [
|
to_disable = [
|
||||||
pipe_name for pipe_name in pipe_names if pipe_name not in enable
|
pipe_name for pipe_name in pipe_names if pipe_name not in enable
|
||||||
]
|
]
|
||||||
if disable and disable != to_disable:
|
if disable and disable != to_disable:
|
||||||
raise ValueError(
|
raise ValueError(Errors.E1042.format(enable=enable, disable=disable))
|
||||||
Errors.E1042.format(
|
|
||||||
arg1="enable",
|
|
||||||
arg2="disable",
|
|
||||||
arg1_values=enable,
|
|
||||||
arg2_values=disable,
|
|
||||||
)
|
|
||||||
)
|
|
||||||
|
|
||||||
return tuple(to_disable)
|
return tuple(to_disable)
|
||||||
|
|
||||||
|
|
|
@ -1,5 +1,6 @@
|
||||||
from .matcher import Matcher
|
from .matcher import Matcher
|
||||||
from .phrasematcher import PhraseMatcher
|
from .phrasematcher import PhraseMatcher
|
||||||
from .dependencymatcher import DependencyMatcher
|
from .dependencymatcher import DependencyMatcher
|
||||||
|
from .levenshtein import levenshtein
|
||||||
|
|
||||||
__all__ = ["Matcher", "PhraseMatcher", "DependencyMatcher"]
|
__all__ = ["Matcher", "PhraseMatcher", "DependencyMatcher", "levenshtein"]
|
||||||
|
|
15
spacy/matcher/levenshtein.pyx
Normal file
15
spacy/matcher/levenshtein.pyx
Normal file
|
@ -0,0 +1,15 @@
|
||||||
|
# cython: profile=True, binding=True, infer_types=True
|
||||||
|
from cpython.object cimport PyObject
|
||||||
|
from libc.stdint cimport int64_t
|
||||||
|
|
||||||
|
from typing import Optional
|
||||||
|
|
||||||
|
|
||||||
|
cdef extern from "polyleven.c":
|
||||||
|
int64_t polyleven(PyObject *o1, PyObject *o2, int64_t k)
|
||||||
|
|
||||||
|
|
||||||
|
cpdef int64_t levenshtein(a: str, b: str, k: Optional[int] = None):
|
||||||
|
if k is None:
|
||||||
|
k = -1
|
||||||
|
return polyleven(<PyObject*>a, <PyObject*>b, k)
|
|
@ -1,5 +1,5 @@
|
||||||
# cython: infer_types=True, cython: profile=True
|
# cython: infer_types=True, cython: profile=True
|
||||||
from typing import List
|
from typing import List, Iterable
|
||||||
|
|
||||||
from libcpp.vector cimport vector
|
from libcpp.vector cimport vector
|
||||||
from libc.stdint cimport int32_t, int8_t
|
from libc.stdint cimport int32_t, int8_t
|
||||||
|
@ -22,7 +22,7 @@ from ..attrs cimport ID, attr_id_t, NULL_ATTR, ORTH, POS, TAG, DEP, LEMMA, MORPH
|
||||||
|
|
||||||
from ..schemas import validate_token_pattern
|
from ..schemas import validate_token_pattern
|
||||||
from ..errors import Errors, MatchPatternError, Warnings
|
from ..errors import Errors, MatchPatternError, Warnings
|
||||||
from ..strings import get_string_id
|
from ..strings cimport get_string_id
|
||||||
from ..attrs import IDS
|
from ..attrs import IDS
|
||||||
|
|
||||||
|
|
||||||
|
@ -868,20 +868,27 @@ class _SetPredicate:
|
||||||
|
|
||||||
def __call__(self, Token token):
|
def __call__(self, Token token):
|
||||||
if self.is_extension:
|
if self.is_extension:
|
||||||
value = get_string_id(token._.get(self.attr))
|
value = token._.get(self.attr)
|
||||||
else:
|
else:
|
||||||
value = get_token_attr_for_matcher(token.c, self.attr)
|
value = get_token_attr_for_matcher(token.c, self.attr)
|
||||||
|
|
||||||
if self.predicate in ("IS_SUBSET", "IS_SUPERSET", "INTERSECTS"):
|
if self.predicate in ("IN", "NOT_IN"):
|
||||||
|
if isinstance(value, (str, int)):
|
||||||
|
value = get_string_id(value)
|
||||||
|
else:
|
||||||
|
return False
|
||||||
|
elif self.predicate in ("IS_SUBSET", "IS_SUPERSET", "INTERSECTS"):
|
||||||
|
# ensure that all values are enclosed in a set
|
||||||
if self.attr == MORPH:
|
if self.attr == MORPH:
|
||||||
# break up MORPH into individual Feat=Val values
|
# break up MORPH into individual Feat=Val values
|
||||||
value = set(get_string_id(v) for v in MorphAnalysis.from_id(self.vocab, value))
|
value = set(get_string_id(v) for v in MorphAnalysis.from_id(self.vocab, value))
|
||||||
|
elif isinstance(value, (str, int)):
|
||||||
|
value = set((get_string_id(value),))
|
||||||
|
elif isinstance(value, Iterable) and all(isinstance(v, (str, int)) for v in value):
|
||||||
|
value = set(get_string_id(v) for v in value)
|
||||||
else:
|
else:
|
||||||
# treat a single value as a list
|
return False
|
||||||
if isinstance(value, (str, int)):
|
|
||||||
value = set([get_string_id(value)])
|
|
||||||
else:
|
|
||||||
value = set(get_string_id(v) for v in value)
|
|
||||||
if self.predicate == "IN":
|
if self.predicate == "IN":
|
||||||
return value in self.value
|
return value in self.value
|
||||||
elif self.predicate == "NOT_IN":
|
elif self.predicate == "NOT_IN":
|
||||||
|
|
384
spacy/matcher/polyleven.c
Normal file
384
spacy/matcher/polyleven.c
Normal file
|
@ -0,0 +1,384 @@
|
||||||
|
/*
|
||||||
|
* Adapted from Polyleven (https://ceptord.net/)
|
||||||
|
*
|
||||||
|
* Source: https://github.com/fujimotos/polyleven/blob/c3f95a080626c5652f0151a2e449963288ccae84/polyleven.c
|
||||||
|
*
|
||||||
|
* Copyright (c) 2021 Fujimoto Seiji <fujimoto@ceptord.net>
|
||||||
|
* Copyright (c) 2021 Max Bachmann <kontakt@maxbachmann.de>
|
||||||
|
* Copyright (c) 2022 Nick Mazuk
|
||||||
|
* Copyright (c) 2022 Michael Weiss <code@mweiss.ch>
|
||||||
|
*
|
||||||
|
* Permission is hereby granted, free of charge, to any person obtaining a copy
|
||||||
|
* of this software and associated documentation files (the "Software"), to deal
|
||||||
|
* in the Software without restriction, including without limitation the rights
|
||||||
|
* to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
|
||||||
|
* copies of the Software, and to permit persons to whom the Software is
|
||||||
|
* furnished to do so, subject to the following conditions:
|
||||||
|
*
|
||||||
|
* The above copyright notice and this permission notice shall be included in all
|
||||||
|
* copies or substantial portions of the Software.
|
||||||
|
*
|
||||||
|
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
|
||||||
|
* IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
|
||||||
|
* FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
|
||||||
|
* AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
|
||||||
|
* LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
|
||||||
|
* OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
|
||||||
|
* SOFTWARE.
|
||||||
|
*/
|
||||||
|
|
||||||
|
#include <Python.h>
|
||||||
|
#include <stdint.h>
|
||||||
|
|
||||||
|
#define MIN(a,b) ((a) < (b) ? (a) : (b))
|
||||||
|
#define MAX(a,b) ((a) > (b) ? (a) : (b))
|
||||||
|
#define CDIV(a,b) ((a) / (b) + ((a) % (b) > 0))
|
||||||
|
#define BIT(i,n) (((i) >> (n)) & 1)
|
||||||
|
#define FLIP(i,n) ((i) ^ ((uint64_t) 1 << (n)))
|
||||||
|
#define ISASCII(kd) ((kd) == PyUnicode_1BYTE_KIND)
|
||||||
|
|
||||||
|
/*
|
||||||
|
* Bare bone of PyUnicode
|
||||||
|
*/
|
||||||
|
struct strbuf {
|
||||||
|
void *ptr;
|
||||||
|
int kind;
|
||||||
|
int64_t len;
|
||||||
|
};
|
||||||
|
|
||||||
|
static void strbuf_init(struct strbuf *s, PyObject *o)
|
||||||
|
{
|
||||||
|
s->ptr = PyUnicode_DATA(o);
|
||||||
|
s->kind = PyUnicode_KIND(o);
|
||||||
|
s->len = PyUnicode_GET_LENGTH(o);
|
||||||
|
}
|
||||||
|
|
||||||
|
#define strbuf_read(s, i) PyUnicode_READ((s)->kind, (s)->ptr, (i))
|
||||||
|
|
||||||
|
/*
|
||||||
|
* An encoded mbleven model table.
|
||||||
|
*
|
||||||
|
* Each 8-bit integer represents an edit sequence, with using two
|
||||||
|
* bits for a single operation.
|
||||||
|
*
|
||||||
|
* 01 = DELETE, 10 = INSERT, 11 = REPLACE
|
||||||
|
*
|
||||||
|
* For example, 13 is '1101' in binary notation, so it means
|
||||||
|
* DELETE + REPLACE.
|
||||||
|
*/
|
||||||
|
static const uint8_t MBLEVEN_MATRIX[] = {
|
||||||
|
3, 0, 0, 0, 0, 0, 0, 0,
|
||||||
|
1, 0, 0, 0, 0, 0, 0, 0,
|
||||||
|
15, 9, 6, 0, 0, 0, 0, 0,
|
||||||
|
13, 7, 0, 0, 0, 0, 0, 0,
|
||||||
|
5, 0, 0, 0, 0, 0, 0, 0,
|
||||||
|
63, 39, 45, 57, 54, 30, 27, 0,
|
||||||
|
61, 55, 31, 37, 25, 22, 0, 0,
|
||||||
|
53, 29, 23, 0, 0, 0, 0, 0,
|
||||||
|
21, 0, 0, 0, 0, 0, 0, 0,
|
||||||
|
};
|
||||||
|
|
||||||
|
#define MBLEVEN_MATRIX_GET(k, d) ((((k) + (k) * (k)) / 2 - 1) + (d)) * 8
|
||||||
|
|
||||||
|
static int64_t mbleven_ascii(char *s1, int64_t len1,
|
||||||
|
char *s2, int64_t len2, int k)
|
||||||
|
{
|
||||||
|
int pos;
|
||||||
|
uint8_t m;
|
||||||
|
int64_t i, j, c, r;
|
||||||
|
|
||||||
|
pos = MBLEVEN_MATRIX_GET(k, len1 - len2);
|
||||||
|
r = k + 1;
|
||||||
|
|
||||||
|
while (MBLEVEN_MATRIX[pos]) {
|
||||||
|
m = MBLEVEN_MATRIX[pos++];
|
||||||
|
i = j = c = 0;
|
||||||
|
while (i < len1 && j < len2) {
|
||||||
|
if (s1[i] != s2[j]) {
|
||||||
|
c++;
|
||||||
|
if (!m) break;
|
||||||
|
if (m & 1) i++;
|
||||||
|
if (m & 2) j++;
|
||||||
|
m >>= 2;
|
||||||
|
} else {
|
||||||
|
i++;
|
||||||
|
j++;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
c += (len1 - i) + (len2 - j);
|
||||||
|
r = MIN(r, c);
|
||||||
|
if (r < 2) {
|
||||||
|
return r;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return r;
|
||||||
|
}
|
||||||
|
|
||||||
|
static int64_t mbleven(PyObject *o1, PyObject *o2, int64_t k)
|
||||||
|
{
|
||||||
|
int pos;
|
||||||
|
uint8_t m;
|
||||||
|
int64_t i, j, c, r;
|
||||||
|
struct strbuf s1, s2;
|
||||||
|
|
||||||
|
strbuf_init(&s1, o1);
|
||||||
|
strbuf_init(&s2, o2);
|
||||||
|
|
||||||
|
if (s1.len < s2.len)
|
||||||
|
return mbleven(o2, o1, k);
|
||||||
|
|
||||||
|
if (k > 3)
|
||||||
|
return -1;
|
||||||
|
|
||||||
|
if (k < s1.len - s2.len)
|
||||||
|
return k + 1;
|
||||||
|
|
||||||
|
if (ISASCII(s1.kind) && ISASCII(s2.kind))
|
||||||
|
return mbleven_ascii(s1.ptr, s1.len, s2.ptr, s2.len, k);
|
||||||
|
|
||||||
|
pos = MBLEVEN_MATRIX_GET(k, s1.len - s2.len);
|
||||||
|
r = k + 1;
|
||||||
|
|
||||||
|
while (MBLEVEN_MATRIX[pos]) {
|
||||||
|
m = MBLEVEN_MATRIX[pos++];
|
||||||
|
i = j = c = 0;
|
||||||
|
while (i < s1.len && j < s2.len) {
|
||||||
|
if (strbuf_read(&s1, i) != strbuf_read(&s2, j)) {
|
||||||
|
c++;
|
||||||
|
if (!m) break;
|
||||||
|
if (m & 1) i++;
|
||||||
|
if (m & 2) j++;
|
||||||
|
m >>= 2;
|
||||||
|
} else {
|
||||||
|
i++;
|
||||||
|
j++;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
c += (s1.len - i) + (s2.len - j);
|
||||||
|
r = MIN(r, c);
|
||||||
|
if (r < 2) {
|
||||||
|
return r;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
return r;
|
||||||
|
}
|
||||||
|
|
||||||
|
/*
|
||||||
|
* Data structure to store Peq (equality bit-vector).
|
||||||
|
*/
|
||||||
|
struct blockmap_entry {
|
||||||
|
uint32_t key[128];
|
||||||
|
uint64_t val[128];
|
||||||
|
};
|
||||||
|
|
||||||
|
struct blockmap {
|
||||||
|
int64_t nr;
|
||||||
|
struct blockmap_entry *list;
|
||||||
|
};
|
||||||
|
|
||||||
|
#define blockmap_key(c) ((c) | 0x80000000U)
|
||||||
|
#define blockmap_hash(c) ((c) % 128)
|
||||||
|
|
||||||
|
static int blockmap_init(struct blockmap *map, struct strbuf *s)
|
||||||
|
{
|
||||||
|
int64_t i;
|
||||||
|
struct blockmap_entry *be;
|
||||||
|
uint32_t c, k;
|
||||||
|
uint8_t h;
|
||||||
|
|
||||||
|
map->nr = CDIV(s->len, 64);
|
||||||
|
map->list = calloc(1, map->nr * sizeof(struct blockmap_entry));
|
||||||
|
if (map->list == NULL) {
|
||||||
|
PyErr_NoMemory();
|
||||||
|
return -1;
|
||||||
|
}
|
||||||
|
|
||||||
|
for (i = 0; i < s->len; i++) {
|
||||||
|
be = &(map->list[i / 64]);
|
||||||
|
c = strbuf_read(s, i);
|
||||||
|
h = blockmap_hash(c);
|
||||||
|
k = blockmap_key(c);
|
||||||
|
|
||||||
|
while (be->key[h] && be->key[h] != k)
|
||||||
|
h = blockmap_hash(h + 1);
|
||||||
|
be->key[h] = k;
|
||||||
|
be->val[h] |= (uint64_t) 1 << (i % 64);
|
||||||
|
}
|
||||||
|
return 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
static void blockmap_clear(struct blockmap *map)
|
||||||
|
{
|
||||||
|
if (map->list)
|
||||||
|
free(map->list);
|
||||||
|
map->list = NULL;
|
||||||
|
map->nr = 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
static uint64_t blockmap_get(struct blockmap *map, int block, uint32_t c)
|
||||||
|
{
|
||||||
|
struct blockmap_entry *be;
|
||||||
|
uint8_t h;
|
||||||
|
uint32_t k;
|
||||||
|
|
||||||
|
h = blockmap_hash(c);
|
||||||
|
k = blockmap_key(c);
|
||||||
|
|
||||||
|
be = &(map->list[block]);
|
||||||
|
while (be->key[h] && be->key[h] != k)
|
||||||
|
h = blockmap_hash(h + 1);
|
||||||
|
return be->key[h] == k ? be->val[h] : 0;
|
||||||
|
}
|
||||||
|
|
||||||
|
/*
|
||||||
|
* Myers' bit-parallel algorithm
|
||||||
|
*
|
||||||
|
* See: G. Myers. "A fast bit-vector algorithm for approximate string
|
||||||
|
* matching based on dynamic programming." Journal of the ACM, 1999.
|
||||||
|
*/
|
||||||
|
static int64_t myers1999_block(struct strbuf *s1, struct strbuf *s2,
|
||||||
|
struct blockmap *map)
|
||||||
|
{
|
||||||
|
uint64_t Eq, Xv, Xh, Ph, Mh, Pv, Mv, Last;
|
||||||
|
uint64_t *Mhc, *Phc;
|
||||||
|
int64_t i, b, hsize, vsize, Score;
|
||||||
|
uint8_t Pb, Mb;
|
||||||
|
|
||||||
|
hsize = CDIV(s1->len, 64);
|
||||||
|
vsize = CDIV(s2->len, 64);
|
||||||
|
Score = s2->len;
|
||||||
|
|
||||||
|
Phc = malloc(hsize * 2 * sizeof(uint64_t));
|
||||||
|
if (Phc == NULL) {
|
||||||
|
PyErr_NoMemory();
|
||||||
|
return -1;
|
||||||
|
}
|
||||||
|
Mhc = Phc + hsize;
|
||||||
|
memset(Phc, -1, hsize * sizeof(uint64_t));
|
||||||
|
memset(Mhc, 0, hsize * sizeof(uint64_t));
|
||||||
|
Last = (uint64_t)1 << ((s2->len - 1) % 64);
|
||||||
|
|
||||||
|
for (b = 0; b < vsize; b++) {
|
||||||
|
Mv = 0;
|
||||||
|
Pv = (uint64_t) -1;
|
||||||
|
Score = s2->len;
|
||||||
|
|
||||||
|
for (i = 0; i < s1->len; i++) {
|
||||||
|
Eq = blockmap_get(map, b, strbuf_read(s1, i));
|
||||||
|
|
||||||
|
Pb = BIT(Phc[i / 64], i % 64);
|
||||||
|
Mb = BIT(Mhc[i / 64], i % 64);
|
||||||
|
|
||||||
|
Xv = Eq | Mv;
|
||||||
|
Xh = ((((Eq | Mb) & Pv) + Pv) ^ Pv) | Eq | Mb;
|
||||||
|
|
||||||
|
Ph = Mv | ~ (Xh | Pv);
|
||||||
|
Mh = Pv & Xh;
|
||||||
|
|
||||||
|
if (Ph & Last) Score++;
|
||||||
|
if (Mh & Last) Score--;
|
||||||
|
|
||||||
|
if ((Ph >> 63) ^ Pb)
|
||||||
|
Phc[i / 64] = FLIP(Phc[i / 64], i % 64);
|
||||||
|
|
||||||
|
if ((Mh >> 63) ^ Mb)
|
||||||
|
Mhc[i / 64] = FLIP(Mhc[i / 64], i % 64);
|
||||||
|
|
||||||
|
Ph = (Ph << 1) | Pb;
|
||||||
|
Mh = (Mh << 1) | Mb;
|
||||||
|
|
||||||
|
Pv = Mh | ~ (Xv | Ph);
|
||||||
|
Mv = Ph & Xv;
|
||||||
|
}
|
||||||
|
}
|
||||||
|
free(Phc);
|
||||||
|
return Score;
|
||||||
|
}
|
||||||
|
|
||||||
|
static int64_t myers1999_simple(uint8_t *s1, int64_t len1, uint8_t *s2, int64_t len2)
|
||||||
|
{
|
||||||
|
uint64_t Peq[256];
|
||||||
|
uint64_t Eq, Xv, Xh, Ph, Mh, Pv, Mv, Last;
|
||||||
|
int64_t i;
|
||||||
|
int64_t Score = len2;
|
||||||
|
|
||||||
|
memset(Peq, 0, sizeof(Peq));
|
||||||
|
|
||||||
|
for (i = 0; i < len2; i++)
|
||||||
|
Peq[s2[i]] |= (uint64_t) 1 << i;
|
||||||
|
|
||||||
|
Mv = 0;
|
||||||
|
Pv = (uint64_t) -1;
|
||||||
|
Last = (uint64_t) 1 << (len2 - 1);
|
||||||
|
|
||||||
|
for (i = 0; i < len1; i++) {
|
||||||
|
Eq = Peq[s1[i]];
|
||||||
|
|
||||||
|
Xv = Eq | Mv;
|
||||||
|
Xh = (((Eq & Pv) + Pv) ^ Pv) | Eq;
|
||||||
|
|
||||||
|
Ph = Mv | ~ (Xh | Pv);
|
||||||
|
Mh = Pv & Xh;
|
||||||
|
|
||||||
|
if (Ph & Last) Score++;
|
||||||
|
if (Mh & Last) Score--;
|
||||||
|
|
||||||
|
Ph = (Ph << 1) | 1;
|
||||||
|
Mh = (Mh << 1);
|
||||||
|
|
||||||
|
Pv = Mh | ~ (Xv | Ph);
|
||||||
|
Mv = Ph & Xv;
|
||||||
|
}
|
||||||
|
return Score;
|
||||||
|
}
|
||||||
|
|
||||||
|
static int64_t myers1999(PyObject *o1, PyObject *o2)
|
||||||
|
{
|
||||||
|
struct strbuf s1, s2;
|
||||||
|
struct blockmap map;
|
||||||
|
int64_t ret;
|
||||||
|
|
||||||
|
strbuf_init(&s1, o1);
|
||||||
|
strbuf_init(&s2, o2);
|
||||||
|
|
||||||
|
if (s1.len < s2.len)
|
||||||
|
return myers1999(o2, o1);
|
||||||
|
|
||||||
|
if (ISASCII(s1.kind) && ISASCII(s2.kind) && s2.len < 65)
|
||||||
|
return myers1999_simple(s1.ptr, s1.len, s2.ptr, s2.len);
|
||||||
|
|
||||||
|
if (blockmap_init(&map, &s2))
|
||||||
|
return -1;
|
||||||
|
|
||||||
|
ret = myers1999_block(&s1, &s2, &map);
|
||||||
|
blockmap_clear(&map);
|
||||||
|
return ret;
|
||||||
|
}
|
||||||
|
|
||||||
|
/*
|
||||||
|
* Interface functions
|
||||||
|
*/
|
||||||
|
static int64_t polyleven(PyObject *o1, PyObject *o2, int64_t k)
|
||||||
|
{
|
||||||
|
int64_t len1, len2;
|
||||||
|
|
||||||
|
len1 = PyUnicode_GET_LENGTH(o1);
|
||||||
|
len2 = PyUnicode_GET_LENGTH(o2);
|
||||||
|
|
||||||
|
if (len1 < len2)
|
||||||
|
return polyleven(o2, o1, k);
|
||||||
|
|
||||||
|
if (k == 0)
|
||||||
|
return PyUnicode_Compare(o1, o2) ? 1 : 0;
|
||||||
|
|
||||||
|
if (0 < k && k < len1 - len2)
|
||||||
|
return k + 1;
|
||||||
|
|
||||||
|
if (len2 == 0)
|
||||||
|
return len1;
|
||||||
|
|
||||||
|
if (0 < k && k < 4)
|
||||||
|
return mbleven(o1, o2, k);
|
||||||
|
|
||||||
|
return myers1999(o1, o2);
|
||||||
|
}
|
|
@ -89,11 +89,14 @@ def pipes_with_nvtx_range(
|
||||||
types.MethodType(nvtx_range_wrapper_for_pipe_method, pipe), func
|
types.MethodType(nvtx_range_wrapper_for_pipe_method, pipe), func
|
||||||
)
|
)
|
||||||
|
|
||||||
# Try to preserve the original function signature.
|
# We need to preserve the original function signature so that
|
||||||
|
# the original parameters are passed to pydantic for validation downstream.
|
||||||
try:
|
try:
|
||||||
wrapped_func.__signature__ = inspect.signature(func) # type: ignore
|
wrapped_func.__signature__ = inspect.signature(func) # type: ignore
|
||||||
except:
|
except:
|
||||||
pass
|
# Can fail for Cython methods that do not have bindings.
|
||||||
|
warnings.warn(Warnings.W122.format(method=name, pipe=pipe.name))
|
||||||
|
continue
|
||||||
|
|
||||||
try:
|
try:
|
||||||
setattr(
|
setattr(
|
||||||
|
|
|
@ -1,11 +1,12 @@
|
||||||
from pathlib import Path
|
from pathlib import Path
|
||||||
from typing import Optional, Callable, Iterable, List, Tuple
|
from typing import Optional, Callable, Iterable, List, Tuple
|
||||||
from thinc.types import Floats2d
|
from thinc.types import Floats2d
|
||||||
from thinc.api import chain, clone, list2ragged, reduce_mean, residual
|
from thinc.api import chain, list2ragged, reduce_mean, residual
|
||||||
from thinc.api import Model, Maxout, Linear, noop, tuplify, Ragged
|
from thinc.api import Model, Maxout, Linear, tuplify, Ragged
|
||||||
|
|
||||||
from ...util import registry
|
from ...util import registry
|
||||||
from ...kb import KnowledgeBase, Candidate, get_candidates
|
from ...kb import KnowledgeBase, InMemoryLookupKB
|
||||||
|
from ...kb import Candidate, get_candidates, get_candidates_batch
|
||||||
from ...vocab import Vocab
|
from ...vocab import Vocab
|
||||||
from ...tokens import Span, Doc
|
from ...tokens import Span, Doc
|
||||||
from ..extract_spans import extract_spans
|
from ..extract_spans import extract_spans
|
||||||
|
@ -70,17 +71,18 @@ def span_maker_forward(model, docs: List[Doc], is_train) -> Tuple[Ragged, Callab
|
||||||
cands.append((start_token, end_token))
|
cands.append((start_token, end_token))
|
||||||
|
|
||||||
candidates.append(ops.asarray2i(cands))
|
candidates.append(ops.asarray2i(cands))
|
||||||
candlens = ops.asarray1i([len(cands) for cands in candidates])
|
lengths = model.ops.asarray1i([len(cands) for cands in candidates])
|
||||||
candidates = ops.xp.concatenate(candidates)
|
out = Ragged(model.ops.flatten(candidates), lengths)
|
||||||
outputs = Ragged(candidates, candlens)
|
|
||||||
# because this is just rearranging docs, the backprop does nothing
|
# because this is just rearranging docs, the backprop does nothing
|
||||||
return outputs, lambda x: []
|
return out, lambda x: []
|
||||||
|
|
||||||
|
|
||||||
@registry.misc("spacy.KBFromFile.v1")
|
@registry.misc("spacy.KBFromFile.v1")
|
||||||
def load_kb(kb_path: Path) -> Callable[[Vocab], KnowledgeBase]:
|
def load_kb(
|
||||||
def kb_from_file(vocab):
|
kb_path: Path,
|
||||||
kb = KnowledgeBase(vocab, entity_vector_length=1)
|
) -> Callable[[Vocab], KnowledgeBase]:
|
||||||
|
def kb_from_file(vocab: Vocab):
|
||||||
|
kb = InMemoryLookupKB(vocab, entity_vector_length=1)
|
||||||
kb.from_disk(kb_path)
|
kb.from_disk(kb_path)
|
||||||
return kb
|
return kb
|
||||||
|
|
||||||
|
@ -88,9 +90,11 @@ def load_kb(kb_path: Path) -> Callable[[Vocab], KnowledgeBase]:
|
||||||
|
|
||||||
|
|
||||||
@registry.misc("spacy.EmptyKB.v1")
|
@registry.misc("spacy.EmptyKB.v1")
|
||||||
def empty_kb(entity_vector_length: int) -> Callable[[Vocab], KnowledgeBase]:
|
def empty_kb(
|
||||||
def empty_kb_factory(vocab):
|
entity_vector_length: int,
|
||||||
return KnowledgeBase(vocab=vocab, entity_vector_length=entity_vector_length)
|
) -> Callable[[Vocab], KnowledgeBase]:
|
||||||
|
def empty_kb_factory(vocab: Vocab):
|
||||||
|
return InMemoryLookupKB(vocab=vocab, entity_vector_length=entity_vector_length)
|
||||||
|
|
||||||
return empty_kb_factory
|
return empty_kb_factory
|
||||||
|
|
||||||
|
@ -98,3 +102,10 @@ def empty_kb(entity_vector_length: int) -> Callable[[Vocab], KnowledgeBase]:
|
||||||
@registry.misc("spacy.CandidateGenerator.v1")
|
@registry.misc("spacy.CandidateGenerator.v1")
|
||||||
def create_candidates() -> Callable[[KnowledgeBase, Span], Iterable[Candidate]]:
|
def create_candidates() -> Callable[[KnowledgeBase, Span], Iterable[Candidate]]:
|
||||||
return get_candidates
|
return get_candidates
|
||||||
|
|
||||||
|
|
||||||
|
@registry.misc("spacy.CandidateBatchGenerator.v1")
|
||||||
|
def create_candidates_batch() -> Callable[
|
||||||
|
[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]
|
||||||
|
]:
|
||||||
|
return get_candidates_batch
|
||||||
|
|
|
@ -3,22 +3,22 @@ from . cimport symbols
|
||||||
cpdef enum univ_pos_t:
|
cpdef enum univ_pos_t:
|
||||||
NO_TAG = 0
|
NO_TAG = 0
|
||||||
ADJ = symbols.ADJ
|
ADJ = symbols.ADJ
|
||||||
ADP
|
ADP = symbols.ADP
|
||||||
ADV
|
ADV = symbols.ADV
|
||||||
AUX
|
AUX = symbols.AUX
|
||||||
CONJ
|
CONJ = symbols.CONJ
|
||||||
CCONJ # U20
|
CCONJ = symbols.CCONJ # U20
|
||||||
DET
|
DET = symbols.DET
|
||||||
INTJ
|
INTJ = symbols.INTJ
|
||||||
NOUN
|
NOUN = symbols.NOUN
|
||||||
NUM
|
NUM = symbols.NUM
|
||||||
PART
|
PART = symbols.PART
|
||||||
PRON
|
PRON = symbols.PRON
|
||||||
PROPN
|
PROPN = symbols.PROPN
|
||||||
PUNCT
|
PUNCT = symbols.PUNCT
|
||||||
SCONJ
|
SCONJ = symbols.SCONJ
|
||||||
SYM
|
SYM = symbols.SYM
|
||||||
VERB
|
VERB = symbols.VERB
|
||||||
X
|
X = symbols.X
|
||||||
EOL
|
EOL = symbols.EOL
|
||||||
SPACE
|
SPACE = symbols.SPACE
|
||||||
|
|
|
@ -3,7 +3,6 @@ from .dep_parser import DependencyParser
|
||||||
from .edit_tree_lemmatizer import EditTreeLemmatizer
|
from .edit_tree_lemmatizer import EditTreeLemmatizer
|
||||||
from .entity_linker import EntityLinker
|
from .entity_linker import EntityLinker
|
||||||
from .ner import EntityRecognizer
|
from .ner import EntityRecognizer
|
||||||
from .entity_ruler import EntityRuler
|
|
||||||
from .lemmatizer import Lemmatizer
|
from .lemmatizer import Lemmatizer
|
||||||
from .morphologizer import Morphologizer
|
from .morphologizer import Morphologizer
|
||||||
from .pipe import Pipe
|
from .pipe import Pipe
|
||||||
|
@ -23,7 +22,6 @@ __all__ = [
|
||||||
"DependencyParser",
|
"DependencyParser",
|
||||||
"EntityLinker",
|
"EntityLinker",
|
||||||
"EntityRecognizer",
|
"EntityRecognizer",
|
||||||
"EntityRuler",
|
|
||||||
"Morphologizer",
|
"Morphologizer",
|
||||||
"Lemmatizer",
|
"Lemmatizer",
|
||||||
"MultiLabel_TextCategorizer",
|
"MultiLabel_TextCategorizer",
|
||||||
|
|
|
@ -1,13 +1,12 @@
|
||||||
from typing import cast, Any, Callable, Dict, Iterable, List, Optional
|
from typing import cast, Any, Callable, Dict, Iterable, List, Optional, Union
|
||||||
from typing import Sequence, Tuple, Union
|
from typing import Tuple
|
||||||
from collections import Counter
|
from collections import Counter
|
||||||
from copy import deepcopy
|
|
||||||
from itertools import islice
|
from itertools import islice
|
||||||
import numpy as np
|
import numpy as np
|
||||||
|
|
||||||
import srsly
|
import srsly
|
||||||
from thinc.api import Config, Model, SequenceCategoricalCrossentropy
|
from thinc.api import Config, Model, SequenceCategoricalCrossentropy
|
||||||
from thinc.types import Floats2d, Ints1d, Ints2d
|
from thinc.types import ArrayXd, Floats2d, Ints1d
|
||||||
|
|
||||||
from ._edit_tree_internals.edit_trees import EditTrees
|
from ._edit_tree_internals.edit_trees import EditTrees
|
||||||
from ._edit_tree_internals.schemas import validate_edit_tree
|
from ._edit_tree_internals.schemas import validate_edit_tree
|
||||||
|
@ -21,6 +20,9 @@ from ..vocab import Vocab
|
||||||
from .. import util
|
from .. import util
|
||||||
|
|
||||||
|
|
||||||
|
ActivationsT = Dict[str, Union[List[Floats2d], List[Ints1d]]]
|
||||||
|
|
||||||
|
|
||||||
default_model_config = """
|
default_model_config = """
|
||||||
[model]
|
[model]
|
||||||
@architectures = "spacy.Tagger.v2"
|
@architectures = "spacy.Tagger.v2"
|
||||||
|
@ -49,6 +51,7 @@ DEFAULT_EDIT_TREE_LEMMATIZER_MODEL = Config().from_str(default_model_config)["mo
|
||||||
"overwrite": False,
|
"overwrite": False,
|
||||||
"top_k": 1,
|
"top_k": 1,
|
||||||
"scorer": {"@scorers": "spacy.lemmatizer_scorer.v1"},
|
"scorer": {"@scorers": "spacy.lemmatizer_scorer.v1"},
|
||||||
|
"save_activations": False,
|
||||||
},
|
},
|
||||||
default_score_weights={"lemma_acc": 1.0},
|
default_score_weights={"lemma_acc": 1.0},
|
||||||
)
|
)
|
||||||
|
@ -61,6 +64,7 @@ def make_edit_tree_lemmatizer(
|
||||||
overwrite: bool,
|
overwrite: bool,
|
||||||
top_k: int,
|
top_k: int,
|
||||||
scorer: Optional[Callable],
|
scorer: Optional[Callable],
|
||||||
|
save_activations: bool,
|
||||||
):
|
):
|
||||||
"""Construct an EditTreeLemmatizer component."""
|
"""Construct an EditTreeLemmatizer component."""
|
||||||
return EditTreeLemmatizer(
|
return EditTreeLemmatizer(
|
||||||
|
@ -72,6 +76,7 @@ def make_edit_tree_lemmatizer(
|
||||||
overwrite=overwrite,
|
overwrite=overwrite,
|
||||||
top_k=top_k,
|
top_k=top_k,
|
||||||
scorer=scorer,
|
scorer=scorer,
|
||||||
|
save_activations=save_activations,
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|
||||||
|
@ -91,6 +96,7 @@ class EditTreeLemmatizer(TrainablePipe):
|
||||||
overwrite: bool = False,
|
overwrite: bool = False,
|
||||||
top_k: int = 1,
|
top_k: int = 1,
|
||||||
scorer: Optional[Callable] = lemmatizer_score,
|
scorer: Optional[Callable] = lemmatizer_score,
|
||||||
|
save_activations: bool = False,
|
||||||
):
|
):
|
||||||
"""
|
"""
|
||||||
Construct an edit tree lemmatizer.
|
Construct an edit tree lemmatizer.
|
||||||
|
@ -102,6 +108,7 @@ class EditTreeLemmatizer(TrainablePipe):
|
||||||
frequency in the training data.
|
frequency in the training data.
|
||||||
overwrite (bool): overwrite existing lemma annotations.
|
overwrite (bool): overwrite existing lemma annotations.
|
||||||
top_k (int): try to apply at most the k most probable edit trees.
|
top_k (int): try to apply at most the k most probable edit trees.
|
||||||
|
save_activations (bool): save model activations in Doc when annotating.
|
||||||
"""
|
"""
|
||||||
self.vocab = vocab
|
self.vocab = vocab
|
||||||
self.model = model
|
self.model = model
|
||||||
|
@ -116,6 +123,7 @@ class EditTreeLemmatizer(TrainablePipe):
|
||||||
|
|
||||||
self.cfg: Dict[str, Any] = {"labels": []}
|
self.cfg: Dict[str, Any] = {"labels": []}
|
||||||
self.scorer = scorer
|
self.scorer = scorer
|
||||||
|
self.save_activations = save_activations
|
||||||
|
|
||||||
def get_loss(
|
def get_loss(
|
||||||
self, examples: Iterable[Example], scores: List[Floats2d]
|
self, examples: Iterable[Example], scores: List[Floats2d]
|
||||||
|
@ -144,21 +152,24 @@ class EditTreeLemmatizer(TrainablePipe):
|
||||||
|
|
||||||
return float(loss), d_scores
|
return float(loss), d_scores
|
||||||
|
|
||||||
def predict(self, docs: Iterable[Doc]) -> List[Ints2d]:
|
def predict(self, docs: Iterable[Doc]) -> ActivationsT:
|
||||||
n_docs = len(list(docs))
|
n_docs = len(list(docs))
|
||||||
if not any(len(doc) for doc in docs):
|
if not any(len(doc) for doc in docs):
|
||||||
# Handle cases where there are no tokens in any docs.
|
# Handle cases where there are no tokens in any docs.
|
||||||
n_labels = len(self.cfg["labels"])
|
n_labels = len(self.cfg["labels"])
|
||||||
guesses: List[Ints2d] = [
|
guesses: List[Ints1d] = [
|
||||||
|
self.model.ops.alloc((0,), dtype="i") for doc in docs
|
||||||
|
]
|
||||||
|
scores: List[Floats2d] = [
|
||||||
self.model.ops.alloc((0, n_labels), dtype="i") for doc in docs
|
self.model.ops.alloc((0, n_labels), dtype="i") for doc in docs
|
||||||
]
|
]
|
||||||
assert len(guesses) == n_docs
|
assert len(guesses) == n_docs
|
||||||
return guesses
|
return {"probabilities": scores, "tree_ids": guesses}
|
||||||
scores = self.model.predict(docs)
|
scores = self.model.predict(docs)
|
||||||
assert len(scores) == n_docs
|
assert len(scores) == n_docs
|
||||||
guesses = self._scores2guesses(docs, scores)
|
guesses = self._scores2guesses(docs, scores)
|
||||||
assert len(guesses) == n_docs
|
assert len(guesses) == n_docs
|
||||||
return guesses
|
return {"probabilities": scores, "tree_ids": guesses}
|
||||||
|
|
||||||
def _scores2guesses(self, docs, scores):
|
def _scores2guesses(self, docs, scores):
|
||||||
guesses = []
|
guesses = []
|
||||||
|
@ -186,8 +197,13 @@ class EditTreeLemmatizer(TrainablePipe):
|
||||||
|
|
||||||
return guesses
|
return guesses
|
||||||
|
|
||||||
def set_annotations(self, docs: Iterable[Doc], batch_tree_ids):
|
def set_annotations(self, docs: Iterable[Doc], activations: ActivationsT):
|
||||||
|
batch_tree_ids = activations["tree_ids"]
|
||||||
for i, doc in enumerate(docs):
|
for i, doc in enumerate(docs):
|
||||||
|
if self.save_activations:
|
||||||
|
doc.activations[self.name] = {}
|
||||||
|
for act_name, acts in activations.items():
|
||||||
|
doc.activations[self.name][act_name] = acts[i]
|
||||||
doc_tree_ids = batch_tree_ids[i]
|
doc_tree_ids = batch_tree_ids[i]
|
||||||
if hasattr(doc_tree_ids, "get"):
|
if hasattr(doc_tree_ids, "get"):
|
||||||
doc_tree_ids = doc_tree_ids.get()
|
doc_tree_ids = doc_tree_ids.get()
|
||||||
|
|
|
@ -1,5 +1,7 @@
|
||||||
from typing import Optional, Iterable, Callable, Dict, Union, List, Any
|
from typing import Optional, Iterable, Callable, Dict, Sequence, Union, List, Any
|
||||||
from thinc.types import Floats2d
|
from typing import cast
|
||||||
|
from numpy import dtype
|
||||||
|
from thinc.types import Floats1d, Floats2d, Ints1d, Ragged
|
||||||
from pathlib import Path
|
from pathlib import Path
|
||||||
from itertools import islice
|
from itertools import islice
|
||||||
import srsly
|
import srsly
|
||||||
|
@ -21,6 +23,11 @@ from ..util import SimpleFrozenList, registry
|
||||||
from .. import util
|
from .. import util
|
||||||
from ..scorer import Scorer
|
from ..scorer import Scorer
|
||||||
|
|
||||||
|
|
||||||
|
ActivationsT = Dict[str, Union[List[Ragged], List[str]]]
|
||||||
|
|
||||||
|
KNOWLEDGE_BASE_IDS = "kb_ids"
|
||||||
|
|
||||||
# See #9050
|
# See #9050
|
||||||
BACKWARD_OVERWRITE = True
|
BACKWARD_OVERWRITE = True
|
||||||
|
|
||||||
|
@ -53,10 +60,13 @@ DEFAULT_NEL_MODEL = Config().from_str(default_model_config)["model"]
|
||||||
"incl_context": True,
|
"incl_context": True,
|
||||||
"entity_vector_length": 64,
|
"entity_vector_length": 64,
|
||||||
"get_candidates": {"@misc": "spacy.CandidateGenerator.v1"},
|
"get_candidates": {"@misc": "spacy.CandidateGenerator.v1"},
|
||||||
|
"get_candidates_batch": {"@misc": "spacy.CandidateBatchGenerator.v1"},
|
||||||
"overwrite": True,
|
"overwrite": True,
|
||||||
"scorer": {"@scorers": "spacy.entity_linker_scorer.v1"},
|
"scorer": {"@scorers": "spacy.entity_linker_scorer.v1"},
|
||||||
"use_gold_ents": True,
|
"use_gold_ents": True,
|
||||||
|
"candidates_batch_size": 1,
|
||||||
"threshold": None,
|
"threshold": None,
|
||||||
|
"save_activations": False,
|
||||||
},
|
},
|
||||||
default_score_weights={
|
default_score_weights={
|
||||||
"nel_micro_f": 1.0,
|
"nel_micro_f": 1.0,
|
||||||
|
@ -75,10 +85,15 @@ def make_entity_linker(
|
||||||
incl_context: bool,
|
incl_context: bool,
|
||||||
entity_vector_length: int,
|
entity_vector_length: int,
|
||||||
get_candidates: Callable[[KnowledgeBase, Span], Iterable[Candidate]],
|
get_candidates: Callable[[KnowledgeBase, Span], Iterable[Candidate]],
|
||||||
|
get_candidates_batch: Callable[
|
||||||
|
[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]
|
||||||
|
],
|
||||||
overwrite: bool,
|
overwrite: bool,
|
||||||
scorer: Optional[Callable],
|
scorer: Optional[Callable],
|
||||||
use_gold_ents: bool,
|
use_gold_ents: bool,
|
||||||
|
candidates_batch_size: int,
|
||||||
threshold: Optional[float] = None,
|
threshold: Optional[float] = None,
|
||||||
|
save_activations: bool,
|
||||||
):
|
):
|
||||||
"""Construct an EntityLinker component.
|
"""Construct an EntityLinker component.
|
||||||
|
|
||||||
|
@ -90,17 +105,22 @@ def make_entity_linker(
|
||||||
incl_prior (bool): Whether or not to include prior probabilities from the KB in the model.
|
incl_prior (bool): Whether or not to include prior probabilities from the KB in the model.
|
||||||
incl_context (bool): Whether or not to include the local context in the model.
|
incl_context (bool): Whether or not to include the local context in the model.
|
||||||
entity_vector_length (int): Size of encoding vectors in the KB.
|
entity_vector_length (int): Size of encoding vectors in the KB.
|
||||||
get_candidates (Callable[[KnowledgeBase, "Span"], Iterable[Candidate]]): Function that
|
get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that
|
||||||
produces a list of candidates, given a certain knowledge base and a textual mention.
|
produces a list of candidates, given a certain knowledge base and a textual mention.
|
||||||
|
get_candidates_batch (
|
||||||
|
Callable[[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]], Iterable[Candidate]]
|
||||||
|
): Function that produces a list of candidates, given a certain knowledge base and several textual mentions.
|
||||||
scorer (Optional[Callable]): The scoring method.
|
scorer (Optional[Callable]): The scoring method.
|
||||||
use_gold_ents (bool): Whether to copy entities from gold docs or not. If false, another
|
use_gold_ents (bool): Whether to copy entities from gold docs or not. If false, another
|
||||||
component must provide entity annotations.
|
component must provide entity annotations.
|
||||||
|
candidates_batch_size (int): Size of batches for entity candidate generation.
|
||||||
threshold (Optional[float]): Confidence threshold for entity predictions. If confidence is below the threshold,
|
threshold (Optional[float]): Confidence threshold for entity predictions. If confidence is below the threshold,
|
||||||
prediction is discarded. If None, predictions are not filtered by any threshold.
|
prediction is discarded. If None, predictions are not filtered by any threshold.
|
||||||
|
save_activations (bool): save model activations in Doc when annotating.
|
||||||
"""
|
"""
|
||||||
|
|
||||||
if not model.attrs.get("include_span_maker", False):
|
if not model.attrs.get("include_span_maker", False):
|
||||||
# The only difference in arguments here is that use_gold_ents is not available
|
# The only difference in arguments here is that use_gold_ents and threshold aren't available.
|
||||||
return EntityLinker_v1(
|
return EntityLinker_v1(
|
||||||
nlp.vocab,
|
nlp.vocab,
|
||||||
model,
|
model,
|
||||||
|
@ -124,10 +144,13 @@ def make_entity_linker(
|
||||||
incl_context=incl_context,
|
incl_context=incl_context,
|
||||||
entity_vector_length=entity_vector_length,
|
entity_vector_length=entity_vector_length,
|
||||||
get_candidates=get_candidates,
|
get_candidates=get_candidates,
|
||||||
|
get_candidates_batch=get_candidates_batch,
|
||||||
overwrite=overwrite,
|
overwrite=overwrite,
|
||||||
scorer=scorer,
|
scorer=scorer,
|
||||||
use_gold_ents=use_gold_ents,
|
use_gold_ents=use_gold_ents,
|
||||||
|
candidates_batch_size=candidates_batch_size,
|
||||||
threshold=threshold,
|
threshold=threshold,
|
||||||
|
save_activations=save_activations,
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|
||||||
|
@ -160,10 +183,15 @@ class EntityLinker(TrainablePipe):
|
||||||
incl_context: bool,
|
incl_context: bool,
|
||||||
entity_vector_length: int,
|
entity_vector_length: int,
|
||||||
get_candidates: Callable[[KnowledgeBase, Span], Iterable[Candidate]],
|
get_candidates: Callable[[KnowledgeBase, Span], Iterable[Candidate]],
|
||||||
|
get_candidates_batch: Callable[
|
||||||
|
[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]
|
||||||
|
],
|
||||||
overwrite: bool = BACKWARD_OVERWRITE,
|
overwrite: bool = BACKWARD_OVERWRITE,
|
||||||
scorer: Optional[Callable] = entity_linker_score,
|
scorer: Optional[Callable] = entity_linker_score,
|
||||||
use_gold_ents: bool,
|
use_gold_ents: bool,
|
||||||
|
candidates_batch_size: int,
|
||||||
threshold: Optional[float] = None,
|
threshold: Optional[float] = None,
|
||||||
|
save_activations: bool = False,
|
||||||
) -> None:
|
) -> None:
|
||||||
"""Initialize an entity linker.
|
"""Initialize an entity linker.
|
||||||
|
|
||||||
|
@ -178,10 +206,14 @@ class EntityLinker(TrainablePipe):
|
||||||
entity_vector_length (int): Size of encoding vectors in the KB.
|
entity_vector_length (int): Size of encoding vectors in the KB.
|
||||||
get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that
|
get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that
|
||||||
produces a list of candidates, given a certain knowledge base and a textual mention.
|
produces a list of candidates, given a certain knowledge base and a textual mention.
|
||||||
scorer (Optional[Callable]): The scoring method. Defaults to
|
get_candidates_batch (
|
||||||
Scorer.score_links.
|
Callable[[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]],
|
||||||
|
Iterable[Candidate]]
|
||||||
|
): Function that produces a list of candidates, given a certain knowledge base and several textual mentions.
|
||||||
|
scorer (Optional[Callable]): The scoring method. Defaults to Scorer.score_links.
|
||||||
use_gold_ents (bool): Whether to copy entities from gold docs or not. If false, another
|
use_gold_ents (bool): Whether to copy entities from gold docs or not. If false, another
|
||||||
component must provide entity annotations.
|
component must provide entity annotations.
|
||||||
|
candidates_batch_size (int): Size of batches for entity candidate generation.
|
||||||
threshold (Optional[float]): Confidence threshold for entity predictions. If confidence is below the
|
threshold (Optional[float]): Confidence threshold for entity predictions. If confidence is below the
|
||||||
threshold, prediction is discarded. If None, predictions are not filtered by any threshold.
|
threshold, prediction is discarded. If None, predictions are not filtered by any threshold.
|
||||||
DOCS: https://spacy.io/api/entitylinker#init
|
DOCS: https://spacy.io/api/entitylinker#init
|
||||||
|
@ -204,14 +236,20 @@ class EntityLinker(TrainablePipe):
|
||||||
self.incl_prior = incl_prior
|
self.incl_prior = incl_prior
|
||||||
self.incl_context = incl_context
|
self.incl_context = incl_context
|
||||||
self.get_candidates = get_candidates
|
self.get_candidates = get_candidates
|
||||||
|
self.get_candidates_batch = get_candidates_batch
|
||||||
self.cfg: Dict[str, Any] = {"overwrite": overwrite}
|
self.cfg: Dict[str, Any] = {"overwrite": overwrite}
|
||||||
self.distance = CosineDistance(normalize=False)
|
self.distance = CosineDistance(normalize=False)
|
||||||
# how many neighbour sentences to take into account
|
# how many neighbour sentences to take into account
|
||||||
# create an empty KB by default. If you want to load a predefined one, specify it in 'initialize'.
|
# create an empty KB by default
|
||||||
self.kb = empty_kb(entity_vector_length)(self.vocab)
|
self.kb = empty_kb(entity_vector_length)(self.vocab)
|
||||||
self.scorer = scorer
|
self.scorer = scorer
|
||||||
self.use_gold_ents = use_gold_ents
|
self.use_gold_ents = use_gold_ents
|
||||||
|
self.candidates_batch_size = candidates_batch_size
|
||||||
self.threshold = threshold
|
self.threshold = threshold
|
||||||
|
self.save_activations = save_activations
|
||||||
|
|
||||||
|
if candidates_batch_size < 1:
|
||||||
|
raise ValueError(Errors.E1044)
|
||||||
|
|
||||||
def set_kb(self, kb_loader: Callable[[Vocab], KnowledgeBase]):
|
def set_kb(self, kb_loader: Callable[[Vocab], KnowledgeBase]):
|
||||||
"""Define the KB of this pipe by providing a function that will
|
"""Define the KB of this pipe by providing a function that will
|
||||||
|
@ -219,7 +257,7 @@ class EntityLinker(TrainablePipe):
|
||||||
if not callable(kb_loader):
|
if not callable(kb_loader):
|
||||||
raise ValueError(Errors.E885.format(arg_type=type(kb_loader)))
|
raise ValueError(Errors.E885.format(arg_type=type(kb_loader)))
|
||||||
|
|
||||||
self.kb = kb_loader(self.vocab)
|
self.kb = kb_loader(self.vocab) # type: ignore
|
||||||
|
|
||||||
def validate_kb(self) -> None:
|
def validate_kb(self) -> None:
|
||||||
# Raise an error if the knowledge base is not initialized.
|
# Raise an error if the knowledge base is not initialized.
|
||||||
|
@ -241,8 +279,8 @@ class EntityLinker(TrainablePipe):
|
||||||
get_examples (Callable[[], Iterable[Example]]): Function that
|
get_examples (Callable[[], Iterable[Example]]): Function that
|
||||||
returns a representative sample of gold-standard Example objects.
|
returns a representative sample of gold-standard Example objects.
|
||||||
nlp (Language): The current nlp object the component is part of.
|
nlp (Language): The current nlp object the component is part of.
|
||||||
kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates a KnowledgeBase from a Vocab instance.
|
kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates a KnowledgeBase from a Vocab
|
||||||
Note that providing this argument, will overwrite all data accumulated in the current KB.
|
instance. Note that providing this argument will overwrite all data accumulated in the current KB.
|
||||||
Use this only when loading a KB as-such from file.
|
Use this only when loading a KB as-such from file.
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entitylinker#initialize
|
DOCS: https://spacy.io/api/entitylinker#initialize
|
||||||
|
@ -397,7 +435,7 @@ class EntityLinker(TrainablePipe):
|
||||||
loss = loss / len(entity_encodings)
|
loss = loss / len(entity_encodings)
|
||||||
return float(loss), out
|
return float(loss), out
|
||||||
|
|
||||||
def predict(self, docs: Iterable[Doc]) -> List[str]:
|
def predict(self, docs: Iterable[Doc]) -> ActivationsT:
|
||||||
"""Apply the pipeline's model to a batch of docs, without modifying them.
|
"""Apply the pipeline's model to a batch of docs, without modifying them.
|
||||||
Returns the KB IDs for each entity in each doc, including NIL if there is
|
Returns the KB IDs for each entity in each doc, including NIL if there is
|
||||||
no prediction.
|
no prediction.
|
||||||
|
@ -410,96 +448,168 @@ class EntityLinker(TrainablePipe):
|
||||||
self.validate_kb()
|
self.validate_kb()
|
||||||
entity_count = 0
|
entity_count = 0
|
||||||
final_kb_ids: List[str] = []
|
final_kb_ids: List[str] = []
|
||||||
xp = self.model.ops.xp
|
ops = self.model.ops
|
||||||
|
xp = ops.xp
|
||||||
|
docs_ents: List[Ragged] = []
|
||||||
|
docs_scores: List[Ragged] = []
|
||||||
if not docs:
|
if not docs:
|
||||||
return final_kb_ids
|
return {KNOWLEDGE_BASE_IDS: final_kb_ids, "ents": docs_ents, "scores": docs_scores}
|
||||||
if isinstance(docs, Doc):
|
if isinstance(docs, Doc):
|
||||||
docs = [docs]
|
docs = [docs]
|
||||||
for i, doc in enumerate(docs):
|
for doc in docs:
|
||||||
|
doc_ents: List[Ints1d] = []
|
||||||
|
doc_scores: List[Floats1d] = []
|
||||||
if len(doc) == 0:
|
if len(doc) == 0:
|
||||||
|
docs_scores.append(Ragged(ops.alloc1f(0), ops.alloc1i(0)))
|
||||||
|
docs_ents.append(Ragged(xp.zeros(0, dtype="uint64"), ops.alloc1i(0)))
|
||||||
continue
|
continue
|
||||||
sentences = [s for s in doc.sents]
|
sentences = [s for s in doc.sents]
|
||||||
# Looping through each entity (TODO: rewrite)
|
|
||||||
for ent in doc.ents:
|
|
||||||
sent_index = sentences.index(ent.sent)
|
|
||||||
assert sent_index >= 0
|
|
||||||
|
|
||||||
if self.incl_context:
|
# Loop over entities in batches.
|
||||||
# get n_neighbour sentences, clipped to the length of the document
|
for ent_idx in range(0, len(doc.ents), self.candidates_batch_size):
|
||||||
start_sentence = max(0, sent_index - self.n_sents)
|
ent_batch = doc.ents[ent_idx : ent_idx + self.candidates_batch_size]
|
||||||
end_sentence = min(len(sentences) - 1, sent_index + self.n_sents)
|
|
||||||
start_token = sentences[start_sentence].start
|
# Look up candidate entities.
|
||||||
end_token = sentences[end_sentence].end
|
valid_ent_idx = [
|
||||||
sent_doc = doc[start_token:end_token].as_doc()
|
idx
|
||||||
# currently, the context is the same for each entity in a sentence (should be refined)
|
for idx in range(len(ent_batch))
|
||||||
sentence_encoding = self.model.predict([sent_doc])[0]
|
if ent_batch[idx].label_ not in self.labels_discard
|
||||||
sentence_encoding_t = sentence_encoding.T
|
]
|
||||||
sentence_norm = xp.linalg.norm(sentence_encoding_t)
|
|
||||||
entity_count += 1
|
batch_candidates = list(
|
||||||
if ent.label_ in self.labels_discard:
|
self.get_candidates_batch(
|
||||||
# ignoring this entity - setting to NIL
|
self.kb, [ent_batch[idx] for idx in valid_ent_idx]
|
||||||
final_kb_ids.append(self.NIL)
|
)
|
||||||
else:
|
if self.candidates_batch_size > 1
|
||||||
candidates = list(self.get_candidates(self.kb, ent))
|
else [
|
||||||
if not candidates:
|
self.get_candidates(self.kb, ent_batch[idx])
|
||||||
# no prediction possible for this entity - setting to NIL
|
for idx in valid_ent_idx
|
||||||
final_kb_ids.append(self.NIL)
|
]
|
||||||
elif len(candidates) == 1 and self.threshold is None:
|
)
|
||||||
# shortcut for efficiency reasons: take the 1 candidate
|
|
||||||
final_kb_ids.append(candidates[0].entity_)
|
# Looping through each entity in batch (TODO: rewrite)
|
||||||
else:
|
for j, ent in enumerate(ent_batch):
|
||||||
random.shuffle(candidates)
|
sent_index = sentences.index(ent.sent)
|
||||||
# set all prior probabilities to 0 if incl_prior=False
|
assert sent_index >= 0
|
||||||
prior_probs = xp.asarray([c.prior_prob for c in candidates])
|
|
||||||
if not self.incl_prior:
|
if self.incl_context:
|
||||||
prior_probs = xp.asarray([0.0 for _ in candidates])
|
# get n_neighbour sentences, clipped to the length of the document
|
||||||
scores = prior_probs
|
start_sentence = max(0, sent_index - self.n_sents)
|
||||||
# add in similarity from the context
|
end_sentence = min(
|
||||||
if self.incl_context:
|
len(sentences) - 1, sent_index + self.n_sents
|
||||||
entity_encodings = xp.asarray(
|
|
||||||
[c.entity_vector for c in candidates]
|
|
||||||
)
|
|
||||||
entity_norm = xp.linalg.norm(entity_encodings, axis=1)
|
|
||||||
if len(entity_encodings) != len(prior_probs):
|
|
||||||
raise RuntimeError(
|
|
||||||
Errors.E147.format(
|
|
||||||
method="predict",
|
|
||||||
msg="vectors not of equal length",
|
|
||||||
)
|
|
||||||
)
|
|
||||||
# cosine similarity
|
|
||||||
sims = xp.dot(entity_encodings, sentence_encoding_t) / (
|
|
||||||
sentence_norm * entity_norm
|
|
||||||
)
|
|
||||||
if sims.shape != prior_probs.shape:
|
|
||||||
raise ValueError(Errors.E161)
|
|
||||||
scores = prior_probs + sims - (prior_probs * sims)
|
|
||||||
final_kb_ids.append(
|
|
||||||
candidates[scores.argmax().item()].entity_
|
|
||||||
if self.threshold is None or scores.max() >= self.threshold
|
|
||||||
else EntityLinker.NIL
|
|
||||||
)
|
)
|
||||||
|
start_token = sentences[start_sentence].start
|
||||||
|
end_token = sentences[end_sentence].end
|
||||||
|
sent_doc = doc[start_token:end_token].as_doc()
|
||||||
|
# currently, the context is the same for each entity in a sentence (should be refined)
|
||||||
|
sentence_encoding = self.model.predict([sent_doc])[0]
|
||||||
|
sentence_encoding_t = sentence_encoding.T
|
||||||
|
sentence_norm = xp.linalg.norm(sentence_encoding_t)
|
||||||
|
entity_count += 1
|
||||||
|
if ent.label_ in self.labels_discard:
|
||||||
|
# ignoring this entity - setting to NIL
|
||||||
|
final_kb_ids.append(self.NIL)
|
||||||
|
self._add_activations(
|
||||||
|
doc_scores=doc_scores,
|
||||||
|
doc_ents=doc_ents,
|
||||||
|
scores=[0.0],
|
||||||
|
ents=[0],
|
||||||
|
)
|
||||||
|
else:
|
||||||
|
candidates = list(batch_candidates[j])
|
||||||
|
if not candidates:
|
||||||
|
# no prediction possible for this entity - setting to NIL
|
||||||
|
final_kb_ids.append(self.NIL)
|
||||||
|
self._add_activations(
|
||||||
|
doc_scores=doc_scores,
|
||||||
|
doc_ents=doc_ents,
|
||||||
|
scores=[0.0],
|
||||||
|
ents=[0],
|
||||||
|
)
|
||||||
|
elif len(candidates) == 1 and self.threshold is None:
|
||||||
|
# shortcut for efficiency reasons: take the 1 candidate
|
||||||
|
final_kb_ids.append(candidates[0].entity_)
|
||||||
|
self._add_activations(
|
||||||
|
doc_scores=doc_scores,
|
||||||
|
doc_ents=doc_ents,
|
||||||
|
scores=[1.0],
|
||||||
|
ents=[candidates[0].entity_],
|
||||||
|
)
|
||||||
|
else:
|
||||||
|
random.shuffle(candidates)
|
||||||
|
# set all prior probabilities to 0 if incl_prior=False
|
||||||
|
prior_probs = xp.asarray([c.prior_prob for c in candidates])
|
||||||
|
if not self.incl_prior:
|
||||||
|
prior_probs = xp.asarray([0.0 for _ in candidates])
|
||||||
|
scores = prior_probs
|
||||||
|
# add in similarity from the context
|
||||||
|
if self.incl_context:
|
||||||
|
entity_encodings = xp.asarray(
|
||||||
|
[c.entity_vector for c in candidates]
|
||||||
|
)
|
||||||
|
entity_norm = xp.linalg.norm(entity_encodings, axis=1)
|
||||||
|
if len(entity_encodings) != len(prior_probs):
|
||||||
|
raise RuntimeError(
|
||||||
|
Errors.E147.format(
|
||||||
|
method="predict",
|
||||||
|
msg="vectors not of equal length",
|
||||||
|
)
|
||||||
|
)
|
||||||
|
# cosine similarity
|
||||||
|
sims = xp.dot(entity_encodings, sentence_encoding_t) / (
|
||||||
|
sentence_norm * entity_norm
|
||||||
|
)
|
||||||
|
if sims.shape != prior_probs.shape:
|
||||||
|
raise ValueError(Errors.E161)
|
||||||
|
scores = prior_probs + sims - (prior_probs * sims)
|
||||||
|
final_kb_ids.append(
|
||||||
|
candidates[scores.argmax().item()].entity_
|
||||||
|
if self.threshold is None
|
||||||
|
or scores.max() >= self.threshold
|
||||||
|
else EntityLinker.NIL
|
||||||
|
)
|
||||||
|
self._add_activations(
|
||||||
|
doc_scores=doc_scores,
|
||||||
|
doc_ents=doc_ents,
|
||||||
|
scores=scores,
|
||||||
|
ents=[c.entity for c in candidates],
|
||||||
|
)
|
||||||
|
self._add_doc_activations(
|
||||||
|
docs_scores=docs_scores,
|
||||||
|
docs_ents=docs_ents,
|
||||||
|
doc_scores=doc_scores,
|
||||||
|
doc_ents=doc_ents,
|
||||||
|
)
|
||||||
if not (len(final_kb_ids) == entity_count):
|
if not (len(final_kb_ids) == entity_count):
|
||||||
err = Errors.E147.format(
|
err = Errors.E147.format(
|
||||||
method="predict", msg="result variables not of equal length"
|
method="predict", msg="result variables not of equal length"
|
||||||
)
|
)
|
||||||
raise RuntimeError(err)
|
raise RuntimeError(err)
|
||||||
return final_kb_ids
|
return {KNOWLEDGE_BASE_IDS: final_kb_ids, "ents": docs_ents, "scores": docs_scores}
|
||||||
|
|
||||||
def set_annotations(self, docs: Iterable[Doc], kb_ids: List[str]) -> None:
|
def set_annotations(self, docs: Iterable[Doc], activations: ActivationsT) -> None:
|
||||||
"""Modify a batch of documents, using pre-computed scores.
|
"""Modify a batch of documents, using pre-computed scores.
|
||||||
|
|
||||||
docs (Iterable[Doc]): The documents to modify.
|
docs (Iterable[Doc]): The documents to modify.
|
||||||
kb_ids (List[str]): The IDs to set, produced by EntityLinker.predict.
|
activations (ActivationsT): The activations used for setting annotations, produced
|
||||||
|
by EntityLinker.predict.
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entitylinker#set_annotations
|
DOCS: https://spacy.io/api/entitylinker#set_annotations
|
||||||
"""
|
"""
|
||||||
|
kb_ids = cast(List[str], activations[KNOWLEDGE_BASE_IDS])
|
||||||
count_ents = len([ent for doc in docs for ent in doc.ents])
|
count_ents = len([ent for doc in docs for ent in doc.ents])
|
||||||
if count_ents != len(kb_ids):
|
if count_ents != len(kb_ids):
|
||||||
raise ValueError(Errors.E148.format(ents=count_ents, ids=len(kb_ids)))
|
raise ValueError(Errors.E148.format(ents=count_ents, ids=len(kb_ids)))
|
||||||
i = 0
|
i = 0
|
||||||
overwrite = self.cfg["overwrite"]
|
overwrite = self.cfg["overwrite"]
|
||||||
for doc in docs:
|
for j, doc in enumerate(docs):
|
||||||
|
if self.save_activations:
|
||||||
|
doc.activations[self.name] = {}
|
||||||
|
for act_name, acts in activations.items():
|
||||||
|
if act_name != KNOWLEDGE_BASE_IDS:
|
||||||
|
# We only copy activations that are Ragged.
|
||||||
|
doc.activations[self.name][act_name] = cast(Ragged, acts[j])
|
||||||
|
|
||||||
for ent in doc.ents:
|
for ent in doc.ents:
|
||||||
kb_id = kb_ids[i]
|
kb_id = kb_ids[i]
|
||||||
i += 1
|
i += 1
|
||||||
|
@ -598,3 +708,32 @@ class EntityLinker(TrainablePipe):
|
||||||
|
|
||||||
def add_label(self, label):
|
def add_label(self, label):
|
||||||
raise NotImplementedError
|
raise NotImplementedError
|
||||||
|
|
||||||
|
def _add_doc_activations(
|
||||||
|
self,
|
||||||
|
*,
|
||||||
|
docs_scores: List[Ragged],
|
||||||
|
docs_ents: List[Ragged],
|
||||||
|
doc_scores: List[Floats1d],
|
||||||
|
doc_ents: List[Ints1d],
|
||||||
|
):
|
||||||
|
if not self.save_activations:
|
||||||
|
return
|
||||||
|
ops = self.model.ops
|
||||||
|
lengths = ops.asarray1i([s.shape[0] for s in doc_scores])
|
||||||
|
docs_scores.append(Ragged(ops.flatten(doc_scores), lengths))
|
||||||
|
docs_ents.append(Ragged(ops.flatten(doc_ents), lengths))
|
||||||
|
|
||||||
|
def _add_activations(
|
||||||
|
self,
|
||||||
|
*,
|
||||||
|
doc_scores: List[Floats1d],
|
||||||
|
doc_ents: List[Ints1d],
|
||||||
|
scores: Sequence[float],
|
||||||
|
ents: Sequence[int],
|
||||||
|
):
|
||||||
|
if not self.save_activations:
|
||||||
|
return
|
||||||
|
ops = self.model.ops
|
||||||
|
doc_scores.append(ops.asarray1f(scores))
|
||||||
|
doc_ents.append(ops.asarray1i(ents, dtype="uint64"))
|
||||||
|
|
|
@ -1,526 +0,0 @@
|
||||||
import warnings
|
|
||||||
from typing import Optional, Union, List, Dict, Tuple, Iterable, Any, Callable, Sequence
|
|
||||||
from typing import cast
|
|
||||||
from collections import defaultdict
|
|
||||||
from pathlib import Path
|
|
||||||
import srsly
|
|
||||||
|
|
||||||
from .pipe import Pipe
|
|
||||||
from ..training import Example
|
|
||||||
from ..language import Language
|
|
||||||
from ..errors import Errors, Warnings
|
|
||||||
from ..util import ensure_path, to_disk, from_disk, SimpleFrozenList, registry
|
|
||||||
from ..tokens import Doc, Span
|
|
||||||
from ..matcher import Matcher, PhraseMatcher
|
|
||||||
from ..scorer import get_ner_prf
|
|
||||||
|
|
||||||
|
|
||||||
DEFAULT_ENT_ID_SEP = "||"
|
|
||||||
PatternType = Dict[str, Union[str, List[Dict[str, Any]]]]
|
|
||||||
|
|
||||||
|
|
||||||
@Language.factory(
|
|
||||||
"entity_ruler",
|
|
||||||
assigns=["doc.ents", "token.ent_type", "token.ent_iob"],
|
|
||||||
default_config={
|
|
||||||
"phrase_matcher_attr": None,
|
|
||||||
"validate": False,
|
|
||||||
"overwrite_ents": False,
|
|
||||||
"ent_id_sep": DEFAULT_ENT_ID_SEP,
|
|
||||||
"scorer": {"@scorers": "spacy.entity_ruler_scorer.v1"},
|
|
||||||
},
|
|
||||||
default_score_weights={
|
|
||||||
"ents_f": 1.0,
|
|
||||||
"ents_p": 0.0,
|
|
||||||
"ents_r": 0.0,
|
|
||||||
"ents_per_type": None,
|
|
||||||
},
|
|
||||||
)
|
|
||||||
def make_entity_ruler(
|
|
||||||
nlp: Language,
|
|
||||||
name: str,
|
|
||||||
phrase_matcher_attr: Optional[Union[int, str]],
|
|
||||||
validate: bool,
|
|
||||||
overwrite_ents: bool,
|
|
||||||
ent_id_sep: str,
|
|
||||||
scorer: Optional[Callable],
|
|
||||||
):
|
|
||||||
return EntityRuler(
|
|
||||||
nlp,
|
|
||||||
name,
|
|
||||||
phrase_matcher_attr=phrase_matcher_attr,
|
|
||||||
validate=validate,
|
|
||||||
overwrite_ents=overwrite_ents,
|
|
||||||
ent_id_sep=ent_id_sep,
|
|
||||||
scorer=scorer,
|
|
||||||
)
|
|
||||||
|
|
||||||
|
|
||||||
def entity_ruler_score(examples, **kwargs):
|
|
||||||
return get_ner_prf(examples)
|
|
||||||
|
|
||||||
|
|
||||||
@registry.scorers("spacy.entity_ruler_scorer.v1")
|
|
||||||
def make_entity_ruler_scorer():
|
|
||||||
return entity_ruler_score
|
|
||||||
|
|
||||||
|
|
||||||
class EntityRuler(Pipe):
|
|
||||||
"""The EntityRuler lets you add spans to the `Doc.ents` using token-based
|
|
||||||
rules or exact phrase matches. It can be combined with the statistical
|
|
||||||
`EntityRecognizer` to boost accuracy, or used on its own to implement a
|
|
||||||
purely rule-based entity recognition system. After initialization, the
|
|
||||||
component is typically added to the pipeline using `nlp.add_pipe`.
|
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entityruler
|
|
||||||
USAGE: https://spacy.io/usage/rule-based-matching#entityruler
|
|
||||||
"""
|
|
||||||
|
|
||||||
def __init__(
|
|
||||||
self,
|
|
||||||
nlp: Language,
|
|
||||||
name: str = "entity_ruler",
|
|
||||||
*,
|
|
||||||
phrase_matcher_attr: Optional[Union[int, str]] = None,
|
|
||||||
validate: bool = False,
|
|
||||||
overwrite_ents: bool = False,
|
|
||||||
ent_id_sep: str = DEFAULT_ENT_ID_SEP,
|
|
||||||
patterns: Optional[List[PatternType]] = None,
|
|
||||||
scorer: Optional[Callable] = entity_ruler_score,
|
|
||||||
) -> None:
|
|
||||||
"""Initialize the entity ruler. If patterns are supplied here, they
|
|
||||||
need to be a list of dictionaries with a `"label"` and `"pattern"`
|
|
||||||
key. A pattern can either be a token pattern (list) or a phrase pattern
|
|
||||||
(string). For example: `{'label': 'ORG', 'pattern': 'Apple'}`.
|
|
||||||
|
|
||||||
nlp (Language): The shared nlp object to pass the vocab to the matchers
|
|
||||||
and process phrase patterns.
|
|
||||||
name (str): Instance name of the current pipeline component. Typically
|
|
||||||
passed in automatically from the factory when the component is
|
|
||||||
added. Used to disable the current entity ruler while creating
|
|
||||||
phrase patterns with the nlp object.
|
|
||||||
phrase_matcher_attr (int / str): Token attribute to match on, passed
|
|
||||||
to the internal PhraseMatcher as `attr`
|
|
||||||
validate (bool): Whether patterns should be validated, passed to
|
|
||||||
Matcher and PhraseMatcher as `validate`
|
|
||||||
patterns (iterable): Optional patterns to load in.
|
|
||||||
overwrite_ents (bool): If existing entities are present, e.g. entities
|
|
||||||
added by the model, overwrite them by matches if necessary.
|
|
||||||
ent_id_sep (str): Separator used internally for entity IDs.
|
|
||||||
scorer (Optional[Callable]): The scoring method. Defaults to
|
|
||||||
spacy.scorer.get_ner_prf.
|
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entityruler#init
|
|
||||||
"""
|
|
||||||
self.nlp = nlp
|
|
||||||
self.name = name
|
|
||||||
self.overwrite = overwrite_ents
|
|
||||||
self.token_patterns = defaultdict(list) # type: ignore
|
|
||||||
self.phrase_patterns = defaultdict(list) # type: ignore
|
|
||||||
self._validate = validate
|
|
||||||
self.matcher = Matcher(nlp.vocab, validate=validate)
|
|
||||||
self.phrase_matcher_attr = phrase_matcher_attr
|
|
||||||
self.phrase_matcher = PhraseMatcher(
|
|
||||||
nlp.vocab, attr=self.phrase_matcher_attr, validate=validate
|
|
||||||
)
|
|
||||||
self.ent_id_sep = ent_id_sep
|
|
||||||
self._ent_ids = defaultdict(tuple) # type: ignore
|
|
||||||
if patterns is not None:
|
|
||||||
self.add_patterns(patterns)
|
|
||||||
self.scorer = scorer
|
|
||||||
|
|
||||||
def __len__(self) -> int:
|
|
||||||
"""The number of all patterns added to the entity ruler."""
|
|
||||||
n_token_patterns = sum(len(p) for p in self.token_patterns.values())
|
|
||||||
n_phrase_patterns = sum(len(p) for p in self.phrase_patterns.values())
|
|
||||||
return n_token_patterns + n_phrase_patterns
|
|
||||||
|
|
||||||
def __contains__(self, label: str) -> bool:
|
|
||||||
"""Whether a label is present in the patterns."""
|
|
||||||
return label in self.token_patterns or label in self.phrase_patterns
|
|
||||||
|
|
||||||
def __call__(self, doc: Doc) -> Doc:
|
|
||||||
"""Find matches in document and add them as entities.
|
|
||||||
|
|
||||||
doc (Doc): The Doc object in the pipeline.
|
|
||||||
RETURNS (Doc): The Doc with added entities, if available.
|
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entityruler#call
|
|
||||||
"""
|
|
||||||
error_handler = self.get_error_handler()
|
|
||||||
try:
|
|
||||||
matches = self.match(doc)
|
|
||||||
self.set_annotations(doc, matches)
|
|
||||||
return doc
|
|
||||||
except Exception as e:
|
|
||||||
return error_handler(self.name, self, [doc], e)
|
|
||||||
|
|
||||||
def match(self, doc: Doc):
|
|
||||||
self._require_patterns()
|
|
||||||
with warnings.catch_warnings():
|
|
||||||
warnings.filterwarnings("ignore", message="\\[W036")
|
|
||||||
matches = list(self.matcher(doc)) + list(self.phrase_matcher(doc))
|
|
||||||
|
|
||||||
final_matches = set(
|
|
||||||
[(m_id, start, end) for m_id, start, end in matches if start != end]
|
|
||||||
)
|
|
||||||
get_sort_key = lambda m: (m[2] - m[1], -m[1])
|
|
||||||
final_matches = sorted(final_matches, key=get_sort_key, reverse=True)
|
|
||||||
return final_matches
|
|
||||||
|
|
||||||
def set_annotations(self, doc, matches):
|
|
||||||
"""Modify the document in place"""
|
|
||||||
entities = list(doc.ents)
|
|
||||||
new_entities = []
|
|
||||||
seen_tokens = set()
|
|
||||||
for match_id, start, end in matches:
|
|
||||||
if any(t.ent_type for t in doc[start:end]) and not self.overwrite:
|
|
||||||
continue
|
|
||||||
# check for end - 1 here because boundaries are inclusive
|
|
||||||
if start not in seen_tokens and end - 1 not in seen_tokens:
|
|
||||||
if match_id in self._ent_ids:
|
|
||||||
label, ent_id = self._ent_ids[match_id]
|
|
||||||
span = Span(doc, start, end, label=label, span_id=ent_id)
|
|
||||||
else:
|
|
||||||
span = Span(doc, start, end, label=match_id)
|
|
||||||
new_entities.append(span)
|
|
||||||
entities = [
|
|
||||||
e for e in entities if not (e.start < end and e.end > start)
|
|
||||||
]
|
|
||||||
seen_tokens.update(range(start, end))
|
|
||||||
doc.ents = entities + new_entities
|
|
||||||
|
|
||||||
@property
|
|
||||||
def labels(self) -> Tuple[str, ...]:
|
|
||||||
"""All labels present in the match patterns.
|
|
||||||
|
|
||||||
RETURNS (set): The string labels.
|
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entityruler#labels
|
|
||||||
"""
|
|
||||||
keys = set(self.token_patterns.keys())
|
|
||||||
keys.update(self.phrase_patterns.keys())
|
|
||||||
all_labels = set()
|
|
||||||
|
|
||||||
for l in keys:
|
|
||||||
if self.ent_id_sep in l:
|
|
||||||
label, _ = self._split_label(l)
|
|
||||||
all_labels.add(label)
|
|
||||||
else:
|
|
||||||
all_labels.add(l)
|
|
||||||
return tuple(sorted(all_labels))
|
|
||||||
|
|
||||||
def initialize(
|
|
||||||
self,
|
|
||||||
get_examples: Callable[[], Iterable[Example]],
|
|
||||||
*,
|
|
||||||
nlp: Optional[Language] = None,
|
|
||||||
patterns: Optional[Sequence[PatternType]] = None,
|
|
||||||
):
|
|
||||||
"""Initialize the pipe for training.
|
|
||||||
|
|
||||||
get_examples (Callable[[], Iterable[Example]]): Function that
|
|
||||||
returns a representative sample of gold-standard Example objects.
|
|
||||||
nlp (Language): The current nlp object the component is part of.
|
|
||||||
patterns Optional[Iterable[PatternType]]: The list of patterns.
|
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entityruler#initialize
|
|
||||||
"""
|
|
||||||
self.clear()
|
|
||||||
if patterns:
|
|
||||||
self.add_patterns(patterns) # type: ignore[arg-type]
|
|
||||||
|
|
||||||
@property
|
|
||||||
def ent_ids(self) -> Tuple[Optional[str], ...]:
|
|
||||||
"""All entity ids present in the match patterns `id` properties
|
|
||||||
|
|
||||||
RETURNS (set): The string entity ids.
|
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entityruler#ent_ids
|
|
||||||
"""
|
|
||||||
keys = set(self.token_patterns.keys())
|
|
||||||
keys.update(self.phrase_patterns.keys())
|
|
||||||
all_ent_ids = set()
|
|
||||||
|
|
||||||
for l in keys:
|
|
||||||
if self.ent_id_sep in l:
|
|
||||||
_, ent_id = self._split_label(l)
|
|
||||||
all_ent_ids.add(ent_id)
|
|
||||||
return tuple(all_ent_ids)
|
|
||||||
|
|
||||||
@property
|
|
||||||
def patterns(self) -> List[PatternType]:
|
|
||||||
"""Get all patterns that were added to the entity ruler.
|
|
||||||
|
|
||||||
RETURNS (list): The original patterns, one dictionary per pattern.
|
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entityruler#patterns
|
|
||||||
"""
|
|
||||||
all_patterns = []
|
|
||||||
for label, patterns in self.token_patterns.items():
|
|
||||||
for pattern in patterns:
|
|
||||||
ent_label, ent_id = self._split_label(label)
|
|
||||||
p = {"label": ent_label, "pattern": pattern}
|
|
||||||
if ent_id:
|
|
||||||
p["id"] = ent_id
|
|
||||||
all_patterns.append(p)
|
|
||||||
for label, patterns in self.phrase_patterns.items():
|
|
||||||
for pattern in patterns:
|
|
||||||
ent_label, ent_id = self._split_label(label)
|
|
||||||
p = {"label": ent_label, "pattern": pattern.text}
|
|
||||||
if ent_id:
|
|
||||||
p["id"] = ent_id
|
|
||||||
all_patterns.append(p)
|
|
||||||
return all_patterns
|
|
||||||
|
|
||||||
def add_patterns(self, patterns: List[PatternType]) -> None:
|
|
||||||
"""Add patterns to the entity ruler. A pattern can either be a token
|
|
||||||
pattern (list of dicts) or a phrase pattern (string). For example:
|
|
||||||
{'label': 'ORG', 'pattern': 'Apple'}
|
|
||||||
{'label': 'GPE', 'pattern': [{'lower': 'san'}, {'lower': 'francisco'}]}
|
|
||||||
|
|
||||||
patterns (list): The patterns to add.
|
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entityruler#add_patterns
|
|
||||||
"""
|
|
||||||
|
|
||||||
# disable the nlp components after this one in case they hadn't been initialized / deserialised yet
|
|
||||||
try:
|
|
||||||
current_index = -1
|
|
||||||
for i, (name, pipe) in enumerate(self.nlp.pipeline):
|
|
||||||
if self == pipe:
|
|
||||||
current_index = i
|
|
||||||
break
|
|
||||||
subsequent_pipes = [pipe for pipe in self.nlp.pipe_names[current_index:]]
|
|
||||||
except ValueError:
|
|
||||||
subsequent_pipes = []
|
|
||||||
with self.nlp.select_pipes(disable=subsequent_pipes):
|
|
||||||
token_patterns = []
|
|
||||||
phrase_pattern_labels = []
|
|
||||||
phrase_pattern_texts = []
|
|
||||||
phrase_pattern_ids = []
|
|
||||||
for entry in patterns:
|
|
||||||
if isinstance(entry["pattern"], str):
|
|
||||||
phrase_pattern_labels.append(entry["label"])
|
|
||||||
phrase_pattern_texts.append(entry["pattern"])
|
|
||||||
phrase_pattern_ids.append(entry.get("id"))
|
|
||||||
elif isinstance(entry["pattern"], list):
|
|
||||||
token_patterns.append(entry)
|
|
||||||
phrase_patterns = []
|
|
||||||
for label, pattern, ent_id in zip(
|
|
||||||
phrase_pattern_labels,
|
|
||||||
self.nlp.pipe(phrase_pattern_texts),
|
|
||||||
phrase_pattern_ids,
|
|
||||||
):
|
|
||||||
phrase_pattern = {"label": label, "pattern": pattern}
|
|
||||||
if ent_id:
|
|
||||||
phrase_pattern["id"] = ent_id
|
|
||||||
phrase_patterns.append(phrase_pattern)
|
|
||||||
for entry in token_patterns + phrase_patterns: # type: ignore[operator]
|
|
||||||
label = entry["label"]
|
|
||||||
if "id" in entry:
|
|
||||||
ent_label = label
|
|
||||||
label = self._create_label(label, entry["id"])
|
|
||||||
key = self.matcher._normalize_key(label)
|
|
||||||
self._ent_ids[key] = (ent_label, entry["id"])
|
|
||||||
pattern = entry["pattern"] # type: ignore
|
|
||||||
if isinstance(pattern, Doc):
|
|
||||||
self.phrase_patterns[label].append(pattern)
|
|
||||||
self.phrase_matcher.add(label, [pattern]) # type: ignore
|
|
||||||
elif isinstance(pattern, list):
|
|
||||||
self.token_patterns[label].append(pattern)
|
|
||||||
self.matcher.add(label, [pattern])
|
|
||||||
else:
|
|
||||||
raise ValueError(Errors.E097.format(pattern=pattern))
|
|
||||||
|
|
||||||
def clear(self) -> None:
|
|
||||||
"""Reset all patterns."""
|
|
||||||
self.token_patterns = defaultdict(list)
|
|
||||||
self.phrase_patterns = defaultdict(list)
|
|
||||||
self._ent_ids = defaultdict(tuple)
|
|
||||||
self.matcher = Matcher(self.nlp.vocab, validate=self._validate)
|
|
||||||
self.phrase_matcher = PhraseMatcher(
|
|
||||||
self.nlp.vocab, attr=self.phrase_matcher_attr, validate=self._validate
|
|
||||||
)
|
|
||||||
|
|
||||||
def remove(self, ent_id: str) -> None:
|
|
||||||
"""Remove a pattern by its ent_id if a pattern with this ent_id was added before
|
|
||||||
|
|
||||||
ent_id (str): id of the pattern to be removed
|
|
||||||
RETURNS: None
|
|
||||||
DOCS: https://spacy.io/api/entityruler#remove
|
|
||||||
"""
|
|
||||||
label_id_pairs = [
|
|
||||||
(label, eid) for (label, eid) in self._ent_ids.values() if eid == ent_id
|
|
||||||
]
|
|
||||||
if not label_id_pairs:
|
|
||||||
raise ValueError(
|
|
||||||
Errors.E1024.format(attr_type="ID", label=ent_id, component=self.name)
|
|
||||||
)
|
|
||||||
created_labels = [
|
|
||||||
self._create_label(label, eid) for (label, eid) in label_id_pairs
|
|
||||||
]
|
|
||||||
# remove the patterns from self.phrase_patterns
|
|
||||||
self.phrase_patterns = defaultdict(
|
|
||||||
list,
|
|
||||||
{
|
|
||||||
label: val
|
|
||||||
for (label, val) in self.phrase_patterns.items()
|
|
||||||
if label not in created_labels
|
|
||||||
},
|
|
||||||
)
|
|
||||||
# remove the patterns from self.token_pattern
|
|
||||||
self.token_patterns = defaultdict(
|
|
||||||
list,
|
|
||||||
{
|
|
||||||
label: val
|
|
||||||
for (label, val) in self.token_patterns.items()
|
|
||||||
if label not in created_labels
|
|
||||||
},
|
|
||||||
)
|
|
||||||
# remove the patterns from self.token_pattern
|
|
||||||
for label in created_labels:
|
|
||||||
if label in self.phrase_matcher:
|
|
||||||
self.phrase_matcher.remove(label)
|
|
||||||
else:
|
|
||||||
self.matcher.remove(label)
|
|
||||||
|
|
||||||
def _require_patterns(self) -> None:
|
|
||||||
"""Raise a warning if this component has no patterns defined."""
|
|
||||||
if len(self) == 0:
|
|
||||||
warnings.warn(Warnings.W036.format(name=self.name))
|
|
||||||
|
|
||||||
def _split_label(self, label: str) -> Tuple[str, Optional[str]]:
|
|
||||||
"""Split Entity label into ent_label and ent_id if it contains self.ent_id_sep
|
|
||||||
|
|
||||||
label (str): The value of label in a pattern entry
|
|
||||||
RETURNS (tuple): ent_label, ent_id
|
|
||||||
"""
|
|
||||||
if self.ent_id_sep in label:
|
|
||||||
ent_label, ent_id = label.rsplit(self.ent_id_sep, 1)
|
|
||||||
else:
|
|
||||||
ent_label = label
|
|
||||||
ent_id = None # type: ignore
|
|
||||||
return ent_label, ent_id
|
|
||||||
|
|
||||||
def _create_label(self, label: Any, ent_id: Any) -> str:
|
|
||||||
"""Join Entity label with ent_id if the pattern has an `id` attribute
|
|
||||||
If ent_id is not a string, the label is returned as is.
|
|
||||||
|
|
||||||
label (str): The label to set for ent.label_
|
|
||||||
ent_id (str): The label
|
|
||||||
RETURNS (str): The ent_label joined with configured `ent_id_sep`
|
|
||||||
"""
|
|
||||||
if isinstance(ent_id, str):
|
|
||||||
label = f"{label}{self.ent_id_sep}{ent_id}"
|
|
||||||
return label
|
|
||||||
|
|
||||||
def from_bytes(
|
|
||||||
self, patterns_bytes: bytes, *, exclude: Iterable[str] = SimpleFrozenList()
|
|
||||||
) -> "EntityRuler":
|
|
||||||
"""Load the entity ruler from a bytestring.
|
|
||||||
|
|
||||||
patterns_bytes (bytes): The bytestring to load.
|
|
||||||
RETURNS (EntityRuler): The loaded entity ruler.
|
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entityruler#from_bytes
|
|
||||||
"""
|
|
||||||
cfg = srsly.msgpack_loads(patterns_bytes)
|
|
||||||
self.clear()
|
|
||||||
if isinstance(cfg, dict):
|
|
||||||
self.add_patterns(cfg.get("patterns", cfg))
|
|
||||||
self.overwrite = cfg.get("overwrite", False)
|
|
||||||
self.phrase_matcher_attr = cfg.get("phrase_matcher_attr", None)
|
|
||||||
self.phrase_matcher = PhraseMatcher(
|
|
||||||
self.nlp.vocab, attr=self.phrase_matcher_attr
|
|
||||||
)
|
|
||||||
self.ent_id_sep = cfg.get("ent_id_sep", DEFAULT_ENT_ID_SEP)
|
|
||||||
else:
|
|
||||||
self.add_patterns(cfg)
|
|
||||||
return self
|
|
||||||
|
|
||||||
def to_bytes(self, *, exclude: Iterable[str] = SimpleFrozenList()) -> bytes:
|
|
||||||
"""Serialize the entity ruler patterns to a bytestring.
|
|
||||||
|
|
||||||
RETURNS (bytes): The serialized patterns.
|
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entityruler#to_bytes
|
|
||||||
"""
|
|
||||||
serial = {
|
|
||||||
"overwrite": self.overwrite,
|
|
||||||
"ent_id_sep": self.ent_id_sep,
|
|
||||||
"phrase_matcher_attr": self.phrase_matcher_attr,
|
|
||||||
"patterns": self.patterns,
|
|
||||||
}
|
|
||||||
return srsly.msgpack_dumps(serial)
|
|
||||||
|
|
||||||
def from_disk(
|
|
||||||
self, path: Union[str, Path], *, exclude: Iterable[str] = SimpleFrozenList()
|
|
||||||
) -> "EntityRuler":
|
|
||||||
"""Load the entity ruler from a file. Expects a file containing
|
|
||||||
newline-delimited JSON (JSONL) with one entry per line.
|
|
||||||
|
|
||||||
path (str / Path): The JSONL file to load.
|
|
||||||
RETURNS (EntityRuler): The loaded entity ruler.
|
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entityruler#from_disk
|
|
||||||
"""
|
|
||||||
path = ensure_path(path)
|
|
||||||
self.clear()
|
|
||||||
depr_patterns_path = path.with_suffix(".jsonl")
|
|
||||||
if path.suffix == ".jsonl": # user provides a jsonl
|
|
||||||
if path.is_file:
|
|
||||||
patterns = srsly.read_jsonl(path)
|
|
||||||
self.add_patterns(patterns)
|
|
||||||
else:
|
|
||||||
raise ValueError(Errors.E1023.format(path=path))
|
|
||||||
elif depr_patterns_path.is_file():
|
|
||||||
patterns = srsly.read_jsonl(depr_patterns_path)
|
|
||||||
self.add_patterns(patterns)
|
|
||||||
elif path.is_dir(): # path is a valid directory
|
|
||||||
cfg = {}
|
|
||||||
deserializers_patterns = {
|
|
||||||
"patterns": lambda p: self.add_patterns(
|
|
||||||
srsly.read_jsonl(p.with_suffix(".jsonl"))
|
|
||||||
)
|
|
||||||
}
|
|
||||||
deserializers_cfg = {"cfg": lambda p: cfg.update(srsly.read_json(p))}
|
|
||||||
from_disk(path, deserializers_cfg, {})
|
|
||||||
self.overwrite = cfg.get("overwrite", False)
|
|
||||||
self.phrase_matcher_attr = cfg.get("phrase_matcher_attr")
|
|
||||||
self.ent_id_sep = cfg.get("ent_id_sep", DEFAULT_ENT_ID_SEP)
|
|
||||||
|
|
||||||
self.phrase_matcher = PhraseMatcher(
|
|
||||||
self.nlp.vocab, attr=self.phrase_matcher_attr
|
|
||||||
)
|
|
||||||
from_disk(path, deserializers_patterns, {})
|
|
||||||
else: # path is not a valid directory or file
|
|
||||||
raise ValueError(Errors.E146.format(path=path))
|
|
||||||
return self
|
|
||||||
|
|
||||||
def to_disk(
|
|
||||||
self, path: Union[str, Path], *, exclude: Iterable[str] = SimpleFrozenList()
|
|
||||||
) -> None:
|
|
||||||
"""Save the entity ruler patterns to a directory. The patterns will be
|
|
||||||
saved as newline-delimited JSON (JSONL).
|
|
||||||
|
|
||||||
path (str / Path): The JSONL file to save.
|
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/entityruler#to_disk
|
|
||||||
"""
|
|
||||||
path = ensure_path(path)
|
|
||||||
cfg = {
|
|
||||||
"overwrite": self.overwrite,
|
|
||||||
"phrase_matcher_attr": self.phrase_matcher_attr,
|
|
||||||
"ent_id_sep": self.ent_id_sep,
|
|
||||||
}
|
|
||||||
serializers = {
|
|
||||||
"patterns": lambda p: srsly.write_jsonl(
|
|
||||||
p.with_suffix(".jsonl"), self.patterns
|
|
||||||
),
|
|
||||||
"cfg": lambda p: srsly.write_json(p, cfg),
|
|
||||||
}
|
|
||||||
if path.suffix == ".jsonl": # user wants to save only JSONL
|
|
||||||
srsly.write_jsonl(path, self.patterns)
|
|
||||||
else:
|
|
||||||
to_disk(path, serializers, {})
|
|
|
@ -68,8 +68,7 @@ class EntityLinker_v1(TrainablePipe):
|
||||||
entity_vector_length (int): Size of encoding vectors in the KB.
|
entity_vector_length (int): Size of encoding vectors in the KB.
|
||||||
get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that
|
get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that
|
||||||
produces a list of candidates, given a certain knowledge base and a textual mention.
|
produces a list of candidates, given a certain knowledge base and a textual mention.
|
||||||
scorer (Optional[Callable]): The scoring method. Defaults to
|
scorer (Optional[Callable]): The scoring method. Defaults to Scorer.score_links.
|
||||||
Scorer.score_links.
|
|
||||||
DOCS: https://spacy.io/api/entitylinker#init
|
DOCS: https://spacy.io/api/entitylinker#init
|
||||||
"""
|
"""
|
||||||
self.vocab = vocab
|
self.vocab = vocab
|
||||||
|
@ -115,7 +114,7 @@ class EntityLinker_v1(TrainablePipe):
|
||||||
get_examples (Callable[[], Iterable[Example]]): Function that
|
get_examples (Callable[[], Iterable[Example]]): Function that
|
||||||
returns a representative sample of gold-standard Example objects.
|
returns a representative sample of gold-standard Example objects.
|
||||||
nlp (Language): The current nlp object the component is part of.
|
nlp (Language): The current nlp object the component is part of.
|
||||||
kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates a KnowledgeBase from a Vocab instance.
|
kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates an InMemoryLookupKB from a Vocab instance.
|
||||||
Note that providing this argument, will overwrite all data accumulated in the current KB.
|
Note that providing this argument, will overwrite all data accumulated in the current KB.
|
||||||
Use this only when loading a KB as-such from file.
|
Use this only when loading a KB as-such from file.
|
||||||
|
|
||||||
|
|
|
@ -1,7 +1,8 @@
|
||||||
# cython: infer_types=True, profile=True, binding=True
|
# cython: infer_types=True, profile=True, binding=True
|
||||||
from typing import Optional, Union, Dict, Callable
|
from typing import Callable, Dict, Iterable, List, Optional, Union
|
||||||
import srsly
|
import srsly
|
||||||
from thinc.api import SequenceCategoricalCrossentropy, Model, Config
|
from thinc.api import SequenceCategoricalCrossentropy, Model, Config
|
||||||
|
from thinc.types import Floats2d, Ints1d
|
||||||
from itertools import islice
|
from itertools import islice
|
||||||
|
|
||||||
from ..tokens.doc cimport Doc
|
from ..tokens.doc cimport Doc
|
||||||
|
@ -13,7 +14,7 @@ from ..symbols import POS
|
||||||
from ..language import Language
|
from ..language import Language
|
||||||
from ..errors import Errors
|
from ..errors import Errors
|
||||||
from .pipe import deserialize_config
|
from .pipe import deserialize_config
|
||||||
from .tagger import Tagger
|
from .tagger import ActivationsT, Tagger
|
||||||
from .. import util
|
from .. import util
|
||||||
from ..scorer import Scorer
|
from ..scorer import Scorer
|
||||||
from ..training import validate_examples, validate_get_examples
|
from ..training import validate_examples, validate_get_examples
|
||||||
|
@ -52,7 +53,13 @@ DEFAULT_MORPH_MODEL = Config().from_str(default_model_config)["model"]
|
||||||
@Language.factory(
|
@Language.factory(
|
||||||
"morphologizer",
|
"morphologizer",
|
||||||
assigns=["token.morph", "token.pos"],
|
assigns=["token.morph", "token.pos"],
|
||||||
default_config={"model": DEFAULT_MORPH_MODEL, "overwrite": True, "extend": False, "scorer": {"@scorers": "spacy.morphologizer_scorer.v1"}},
|
default_config={
|
||||||
|
"model": DEFAULT_MORPH_MODEL,
|
||||||
|
"overwrite": True,
|
||||||
|
"extend": False,
|
||||||
|
"scorer": {"@scorers": "spacy.morphologizer_scorer.v1"},
|
||||||
|
"save_activations": False,
|
||||||
|
},
|
||||||
default_score_weights={"pos_acc": 0.5, "morph_acc": 0.5, "morph_per_feat": None},
|
default_score_weights={"pos_acc": 0.5, "morph_acc": 0.5, "morph_per_feat": None},
|
||||||
)
|
)
|
||||||
def make_morphologizer(
|
def make_morphologizer(
|
||||||
|
@ -62,8 +69,10 @@ def make_morphologizer(
|
||||||
overwrite: bool,
|
overwrite: bool,
|
||||||
extend: bool,
|
extend: bool,
|
||||||
scorer: Optional[Callable],
|
scorer: Optional[Callable],
|
||||||
|
save_activations: bool,
|
||||||
):
|
):
|
||||||
return Morphologizer(nlp.vocab, model, name, overwrite=overwrite, extend=extend, scorer=scorer)
|
return Morphologizer(nlp.vocab, model, name, overwrite=overwrite, extend=extend, scorer=scorer,
|
||||||
|
save_activations=save_activations)
|
||||||
|
|
||||||
|
|
||||||
def morphologizer_score(examples, **kwargs):
|
def morphologizer_score(examples, **kwargs):
|
||||||
|
@ -95,6 +104,7 @@ class Morphologizer(Tagger):
|
||||||
overwrite: bool = BACKWARD_OVERWRITE,
|
overwrite: bool = BACKWARD_OVERWRITE,
|
||||||
extend: bool = BACKWARD_EXTEND,
|
extend: bool = BACKWARD_EXTEND,
|
||||||
scorer: Optional[Callable] = morphologizer_score,
|
scorer: Optional[Callable] = morphologizer_score,
|
||||||
|
save_activations: bool = False,
|
||||||
):
|
):
|
||||||
"""Initialize a morphologizer.
|
"""Initialize a morphologizer.
|
||||||
|
|
||||||
|
@ -105,6 +115,7 @@ class Morphologizer(Tagger):
|
||||||
scorer (Optional[Callable]): The scoring method. Defaults to
|
scorer (Optional[Callable]): The scoring method. Defaults to
|
||||||
Scorer.score_token_attr for the attributes "pos" and "morph" and
|
Scorer.score_token_attr for the attributes "pos" and "morph" and
|
||||||
Scorer.score_token_attr_per_feat for the attribute "morph".
|
Scorer.score_token_attr_per_feat for the attribute "morph".
|
||||||
|
save_activations (bool): save model activations in Doc when annotating.
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/morphologizer#init
|
DOCS: https://spacy.io/api/morphologizer#init
|
||||||
"""
|
"""
|
||||||
|
@ -124,6 +135,7 @@ class Morphologizer(Tagger):
|
||||||
}
|
}
|
||||||
self.cfg = dict(sorted(cfg.items()))
|
self.cfg = dict(sorted(cfg.items()))
|
||||||
self.scorer = scorer
|
self.scorer = scorer
|
||||||
|
self.save_activations = save_activations
|
||||||
|
|
||||||
@property
|
@property
|
||||||
def labels(self):
|
def labels(self):
|
||||||
|
@ -217,14 +229,15 @@ class Morphologizer(Tagger):
|
||||||
assert len(label_sample) > 0, Errors.E923.format(name=self.name)
|
assert len(label_sample) > 0, Errors.E923.format(name=self.name)
|
||||||
self.model.initialize(X=doc_sample, Y=label_sample)
|
self.model.initialize(X=doc_sample, Y=label_sample)
|
||||||
|
|
||||||
def set_annotations(self, docs, batch_tag_ids):
|
def set_annotations(self, docs: Iterable[Doc], activations: ActivationsT):
|
||||||
"""Modify a batch of documents, using pre-computed scores.
|
"""Modify a batch of documents, using pre-computed scores.
|
||||||
|
|
||||||
docs (Iterable[Doc]): The documents to modify.
|
docs (Iterable[Doc]): The documents to modify.
|
||||||
batch_tag_ids: The IDs to set, produced by Morphologizer.predict.
|
activations (ActivationsT): The activations used for setting annotations, produced by Morphologizer.predict.
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/morphologizer#set_annotations
|
DOCS: https://spacy.io/api/morphologizer#set_annotations
|
||||||
"""
|
"""
|
||||||
|
batch_tag_ids = activations["label_ids"]
|
||||||
if isinstance(docs, Doc):
|
if isinstance(docs, Doc):
|
||||||
docs = [docs]
|
docs = [docs]
|
||||||
cdef Doc doc
|
cdef Doc doc
|
||||||
|
@ -236,6 +249,10 @@ class Morphologizer(Tagger):
|
||||||
# to allocate a compatible container out of the iterable.
|
# to allocate a compatible container out of the iterable.
|
||||||
labels = tuple(self.labels)
|
labels = tuple(self.labels)
|
||||||
for i, doc in enumerate(docs):
|
for i, doc in enumerate(docs):
|
||||||
|
if self.save_activations:
|
||||||
|
doc.activations[self.name] = {}
|
||||||
|
for act_name, acts in activations.items():
|
||||||
|
doc.activations[self.name][act_name] = acts[i]
|
||||||
doc_tag_ids = batch_tag_ids[i]
|
doc_tag_ids = batch_tag_ids[i]
|
||||||
if hasattr(doc_tag_ids, "get"):
|
if hasattr(doc_tag_ids, "get"):
|
||||||
doc_tag_ids = doc_tag_ids.get()
|
doc_tag_ids = doc_tag_ids.get()
|
||||||
|
|
|
@ -1,4 +1,4 @@
|
||||||
# cython: infer_types=True, profile=True
|
# cython: infer_types=True, profile=True, binding=True
|
||||||
from typing import Optional, Tuple, Iterable, Iterator, Callable, Union, Dict
|
from typing import Optional, Tuple, Iterable, Iterator, Callable, Union, Dict
|
||||||
import srsly
|
import srsly
|
||||||
import warnings
|
import warnings
|
||||||
|
|
|
@ -1,13 +1,14 @@
|
||||||
# cython: infer_types=True, profile=True, binding=True
|
# cython: infer_types=True, profile=True, binding=True
|
||||||
from typing import Optional, Callable
|
from typing import Dict, Iterable, Optional, Callable, List, Union
|
||||||
from itertools import islice
|
from itertools import islice
|
||||||
|
|
||||||
import srsly
|
import srsly
|
||||||
from thinc.api import Model, SequenceCategoricalCrossentropy, Config
|
from thinc.api import Model, SequenceCategoricalCrossentropy, Config
|
||||||
|
from thinc.types import Floats2d, Ints1d
|
||||||
|
|
||||||
from ..tokens.doc cimport Doc
|
from ..tokens.doc cimport Doc
|
||||||
|
|
||||||
from .tagger import Tagger
|
from .tagger import ActivationsT, Tagger
|
||||||
from ..language import Language
|
from ..language import Language
|
||||||
from ..errors import Errors
|
from ..errors import Errors
|
||||||
from ..scorer import Scorer
|
from ..scorer import Scorer
|
||||||
|
@ -38,11 +39,21 @@ DEFAULT_SENTER_MODEL = Config().from_str(default_model_config)["model"]
|
||||||
@Language.factory(
|
@Language.factory(
|
||||||
"senter",
|
"senter",
|
||||||
assigns=["token.is_sent_start"],
|
assigns=["token.is_sent_start"],
|
||||||
default_config={"model": DEFAULT_SENTER_MODEL, "overwrite": False, "scorer": {"@scorers": "spacy.senter_scorer.v1"}},
|
default_config={
|
||||||
|
"model": DEFAULT_SENTER_MODEL,
|
||||||
|
"overwrite": False,
|
||||||
|
"scorer": {"@scorers": "spacy.senter_scorer.v1"},
|
||||||
|
"save_activations": False,
|
||||||
|
},
|
||||||
default_score_weights={"sents_f": 1.0, "sents_p": 0.0, "sents_r": 0.0},
|
default_score_weights={"sents_f": 1.0, "sents_p": 0.0, "sents_r": 0.0},
|
||||||
)
|
)
|
||||||
def make_senter(nlp: Language, name: str, model: Model, overwrite: bool, scorer: Optional[Callable]):
|
def make_senter(nlp: Language,
|
||||||
return SentenceRecognizer(nlp.vocab, model, name, overwrite=overwrite, scorer=scorer)
|
name: str,
|
||||||
|
model: Model,
|
||||||
|
overwrite: bool,
|
||||||
|
scorer: Optional[Callable],
|
||||||
|
save_activations: bool):
|
||||||
|
return SentenceRecognizer(nlp.vocab, model, name, overwrite=overwrite, scorer=scorer, save_activations=save_activations)
|
||||||
|
|
||||||
|
|
||||||
def senter_score(examples, **kwargs):
|
def senter_score(examples, **kwargs):
|
||||||
|
@ -72,6 +83,7 @@ class SentenceRecognizer(Tagger):
|
||||||
*,
|
*,
|
||||||
overwrite=BACKWARD_OVERWRITE,
|
overwrite=BACKWARD_OVERWRITE,
|
||||||
scorer=senter_score,
|
scorer=senter_score,
|
||||||
|
save_activations: bool = False,
|
||||||
):
|
):
|
||||||
"""Initialize a sentence recognizer.
|
"""Initialize a sentence recognizer.
|
||||||
|
|
||||||
|
@ -81,6 +93,7 @@ class SentenceRecognizer(Tagger):
|
||||||
losses during training.
|
losses during training.
|
||||||
scorer (Optional[Callable]): The scoring method. Defaults to
|
scorer (Optional[Callable]): The scoring method. Defaults to
|
||||||
Scorer.score_spans for the attribute "sents".
|
Scorer.score_spans for the attribute "sents".
|
||||||
|
save_activations (bool): save model activations in Doc when annotating.
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/sentencerecognizer#init
|
DOCS: https://spacy.io/api/sentencerecognizer#init
|
||||||
"""
|
"""
|
||||||
|
@ -90,6 +103,7 @@ class SentenceRecognizer(Tagger):
|
||||||
self._rehearsal_model = None
|
self._rehearsal_model = None
|
||||||
self.cfg = {"overwrite": overwrite}
|
self.cfg = {"overwrite": overwrite}
|
||||||
self.scorer = scorer
|
self.scorer = scorer
|
||||||
|
self.save_activations = save_activations
|
||||||
|
|
||||||
@property
|
@property
|
||||||
def labels(self):
|
def labels(self):
|
||||||
|
@ -107,19 +121,24 @@ class SentenceRecognizer(Tagger):
|
||||||
def label_data(self):
|
def label_data(self):
|
||||||
return None
|
return None
|
||||||
|
|
||||||
def set_annotations(self, docs, batch_tag_ids):
|
def set_annotations(self, docs: Iterable[Doc], activations: ActivationsT):
|
||||||
"""Modify a batch of documents, using pre-computed scores.
|
"""Modify a batch of documents, using pre-computed scores.
|
||||||
|
|
||||||
docs (Iterable[Doc]): The documents to modify.
|
docs (Iterable[Doc]): The documents to modify.
|
||||||
batch_tag_ids: The IDs to set, produced by SentenceRecognizer.predict.
|
activations (ActivationsT): The activations used for setting annotations, produced by SentenceRecognizer.predict.
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/sentencerecognizer#set_annotations
|
DOCS: https://spacy.io/api/sentencerecognizer#set_annotations
|
||||||
"""
|
"""
|
||||||
|
batch_tag_ids = activations["label_ids"]
|
||||||
if isinstance(docs, Doc):
|
if isinstance(docs, Doc):
|
||||||
docs = [docs]
|
docs = [docs]
|
||||||
cdef Doc doc
|
cdef Doc doc
|
||||||
cdef bint overwrite = self.cfg["overwrite"]
|
cdef bint overwrite = self.cfg["overwrite"]
|
||||||
for i, doc in enumerate(docs):
|
for i, doc in enumerate(docs):
|
||||||
|
if self.save_activations:
|
||||||
|
doc.activations[self.name] = {}
|
||||||
|
for act_name, acts in activations.items():
|
||||||
|
doc.activations[self.name][act_name] = acts[i]
|
||||||
doc_tag_ids = batch_tag_ids[i]
|
doc_tag_ids = batch_tag_ids[i]
|
||||||
if hasattr(doc_tag_ids, "get"):
|
if hasattr(doc_tag_ids, "get"):
|
||||||
doc_tag_ids = doc_tag_ids.get()
|
doc_tag_ids = doc_tag_ids.get()
|
||||||
|
|
|
@ -11,7 +11,7 @@ from ..language import Language
|
||||||
from ..errors import Errors, Warnings
|
from ..errors import Errors, Warnings
|
||||||
from ..util import ensure_path, SimpleFrozenList, registry
|
from ..util import ensure_path, SimpleFrozenList, registry
|
||||||
from ..tokens import Doc, Span
|
from ..tokens import Doc, Span
|
||||||
from ..scorer import Scorer
|
from ..scorer import Scorer, get_ner_prf
|
||||||
from ..matcher import Matcher, PhraseMatcher
|
from ..matcher import Matcher, PhraseMatcher
|
||||||
from .. import util
|
from .. import util
|
||||||
|
|
||||||
|
@ -20,7 +20,7 @@ DEFAULT_SPANS_KEY = "ruler"
|
||||||
|
|
||||||
|
|
||||||
@Language.factory(
|
@Language.factory(
|
||||||
"future_entity_ruler",
|
"entity_ruler",
|
||||||
assigns=["doc.ents"],
|
assigns=["doc.ents"],
|
||||||
default_config={
|
default_config={
|
||||||
"phrase_matcher_attr": None,
|
"phrase_matcher_attr": None,
|
||||||
|
@ -63,6 +63,15 @@ def make_entity_ruler(
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|
||||||
|
def entity_ruler_score(examples, **kwargs):
|
||||||
|
return get_ner_prf(examples)
|
||||||
|
|
||||||
|
|
||||||
|
@registry.scorers("spacy.entity_ruler_scorer.v1")
|
||||||
|
def make_entity_ruler_scorer():
|
||||||
|
return entity_ruler_score
|
||||||
|
|
||||||
|
|
||||||
@Language.factory(
|
@Language.factory(
|
||||||
"span_ruler",
|
"span_ruler",
|
||||||
assigns=["doc.spans"],
|
assigns=["doc.spans"],
|
||||||
|
@ -117,7 +126,7 @@ def prioritize_new_ents_filter(
|
||||||
) -> List[Span]:
|
) -> List[Span]:
|
||||||
"""Merge entities and spans into one list without overlaps by allowing
|
"""Merge entities and spans into one list without overlaps by allowing
|
||||||
spans to overwrite any entities that they overlap with. Intended to
|
spans to overwrite any entities that they overlap with. Intended to
|
||||||
replicate the overwrite_ents=True behavior from the EntityRuler.
|
replicate the overwrite_ents=True behavior from the v3 EntityRuler.
|
||||||
|
|
||||||
entities (Iterable[Span]): The entities, already filtered for overlaps.
|
entities (Iterable[Span]): The entities, already filtered for overlaps.
|
||||||
spans (Iterable[Span]): The spans to merge, may contain overlaps.
|
spans (Iterable[Span]): The spans to merge, may contain overlaps.
|
||||||
|
@ -148,7 +157,7 @@ def prioritize_existing_ents_filter(
|
||||||
) -> List[Span]:
|
) -> List[Span]:
|
||||||
"""Merge entities and spans into one list without overlaps by prioritizing
|
"""Merge entities and spans into one list without overlaps by prioritizing
|
||||||
existing entities. Intended to replicate the overwrite_ents=False behavior
|
existing entities. Intended to replicate the overwrite_ents=False behavior
|
||||||
from the EntityRuler.
|
from the v3 EntityRuler.
|
||||||
|
|
||||||
entities (Iterable[Span]): The entities, already filtered for overlaps.
|
entities (Iterable[Span]): The entities, already filtered for overlaps.
|
||||||
spans (Iterable[Span]): The spans to merge, may contain overlaps.
|
spans (Iterable[Span]): The spans to merge, may contain overlaps.
|
||||||
|
|
|
@ -1,4 +1,5 @@
|
||||||
from typing import List, Dict, Callable, Tuple, Optional, Iterable, Any, cast
|
from typing import List, Dict, Callable, Tuple, Optional, Iterable, Any, cast
|
||||||
|
from typing import Union
|
||||||
from thinc.api import Config, Model, get_current_ops, set_dropout_rate, Ops
|
from thinc.api import Config, Model, get_current_ops, set_dropout_rate, Ops
|
||||||
from thinc.api import Optimizer
|
from thinc.api import Optimizer
|
||||||
from thinc.types import Ragged, Ints2d, Floats2d, Ints1d
|
from thinc.types import Ragged, Ints2d, Floats2d, Ints1d
|
||||||
|
@ -16,6 +17,9 @@ from ..errors import Errors
|
||||||
from ..util import registry
|
from ..util import registry
|
||||||
|
|
||||||
|
|
||||||
|
ActivationsT = Dict[str, Union[Floats2d, Ragged]]
|
||||||
|
|
||||||
|
|
||||||
spancat_default_config = """
|
spancat_default_config = """
|
||||||
[model]
|
[model]
|
||||||
@architectures = "spacy.SpanCategorizer.v1"
|
@architectures = "spacy.SpanCategorizer.v1"
|
||||||
|
@ -26,17 +30,17 @@ scorer = {"@layers": "spacy.LinearLogistic.v1"}
|
||||||
hidden_size = 128
|
hidden_size = 128
|
||||||
|
|
||||||
[model.tok2vec]
|
[model.tok2vec]
|
||||||
@architectures = "spacy.Tok2Vec.v1"
|
@architectures = "spacy.Tok2Vec.v2"
|
||||||
|
|
||||||
[model.tok2vec.embed]
|
[model.tok2vec.embed]
|
||||||
@architectures = "spacy.MultiHashEmbed.v1"
|
@architectures = "spacy.MultiHashEmbed.v2"
|
||||||
width = 96
|
width = 96
|
||||||
rows = [5000, 2000, 1000, 1000]
|
rows = [5000, 2000, 1000, 1000]
|
||||||
attrs = ["ORTH", "PREFIX", "SUFFIX", "SHAPE"]
|
attrs = ["ORTH", "PREFIX", "SUFFIX", "SHAPE"]
|
||||||
include_static_vectors = false
|
include_static_vectors = false
|
||||||
|
|
||||||
[model.tok2vec.encode]
|
[model.tok2vec.encode]
|
||||||
@architectures = "spacy.MaxoutWindowEncoder.v1"
|
@architectures = "spacy.MaxoutWindowEncoder.v2"
|
||||||
width = ${model.tok2vec.embed.width}
|
width = ${model.tok2vec.embed.width}
|
||||||
window_size = 1
|
window_size = 1
|
||||||
maxout_pieces = 3
|
maxout_pieces = 3
|
||||||
|
@ -106,6 +110,7 @@ def build_ngram_range_suggester(min_size: int, max_size: int) -> Suggester:
|
||||||
"model": DEFAULT_SPANCAT_MODEL,
|
"model": DEFAULT_SPANCAT_MODEL,
|
||||||
"suggester": {"@misc": "spacy.ngram_suggester.v1", "sizes": [1, 2, 3]},
|
"suggester": {"@misc": "spacy.ngram_suggester.v1", "sizes": [1, 2, 3]},
|
||||||
"scorer": {"@scorers": "spacy.spancat_scorer.v1"},
|
"scorer": {"@scorers": "spacy.spancat_scorer.v1"},
|
||||||
|
"save_activations": False,
|
||||||
},
|
},
|
||||||
default_score_weights={"spans_sc_f": 1.0, "spans_sc_p": 0.0, "spans_sc_r": 0.0},
|
default_score_weights={"spans_sc_f": 1.0, "spans_sc_p": 0.0, "spans_sc_r": 0.0},
|
||||||
)
|
)
|
||||||
|
@ -118,6 +123,7 @@ def make_spancat(
|
||||||
scorer: Optional[Callable],
|
scorer: Optional[Callable],
|
||||||
threshold: float,
|
threshold: float,
|
||||||
max_positive: Optional[int],
|
max_positive: Optional[int],
|
||||||
|
save_activations: bool,
|
||||||
) -> "SpanCategorizer":
|
) -> "SpanCategorizer":
|
||||||
"""Create a SpanCategorizer component. The span categorizer consists of two
|
"""Create a SpanCategorizer component. The span categorizer consists of two
|
||||||
parts: a suggester function that proposes candidate spans, and a labeller
|
parts: a suggester function that proposes candidate spans, and a labeller
|
||||||
|
@ -133,11 +139,15 @@ def make_spancat(
|
||||||
spans_key (str): Key of the doc.spans dict to save the spans under. During
|
spans_key (str): Key of the doc.spans dict to save the spans under. During
|
||||||
initialization and training, the component will look for spans on the
|
initialization and training, the component will look for spans on the
|
||||||
reference document under the same key.
|
reference document under the same key.
|
||||||
|
scorer (Optional[Callable]): The scoring method. Defaults to
|
||||||
|
Scorer.score_spans for the Doc.spans[spans_key] with overlapping
|
||||||
|
spans allowed.
|
||||||
threshold (float): Minimum probability to consider a prediction positive.
|
threshold (float): Minimum probability to consider a prediction positive.
|
||||||
Spans with a positive prediction will be saved on the Doc. Defaults to
|
Spans with a positive prediction will be saved on the Doc. Defaults to
|
||||||
0.5.
|
0.5.
|
||||||
max_positive (Optional[int]): Maximum number of labels to consider positive
|
max_positive (Optional[int]): Maximum number of labels to consider positive
|
||||||
per span. Defaults to None, indicating no limit.
|
per span. Defaults to None, indicating no limit.
|
||||||
|
save_activations (bool): save model activations in Doc when annotating.
|
||||||
"""
|
"""
|
||||||
return SpanCategorizer(
|
return SpanCategorizer(
|
||||||
nlp.vocab,
|
nlp.vocab,
|
||||||
|
@ -148,6 +158,7 @@ def make_spancat(
|
||||||
max_positive=max_positive,
|
max_positive=max_positive,
|
||||||
name=name,
|
name=name,
|
||||||
scorer=scorer,
|
scorer=scorer,
|
||||||
|
save_activations=save_activations,
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|
||||||
|
@ -186,6 +197,7 @@ class SpanCategorizer(TrainablePipe):
|
||||||
threshold: float = 0.5,
|
threshold: float = 0.5,
|
||||||
max_positive: Optional[int] = None,
|
max_positive: Optional[int] = None,
|
||||||
scorer: Optional[Callable] = spancat_score,
|
scorer: Optional[Callable] = spancat_score,
|
||||||
|
save_activations: bool = False,
|
||||||
) -> None:
|
) -> None:
|
||||||
"""Initialize the span categorizer.
|
"""Initialize the span categorizer.
|
||||||
vocab (Vocab): The shared vocabulary.
|
vocab (Vocab): The shared vocabulary.
|
||||||
|
@ -218,6 +230,7 @@ class SpanCategorizer(TrainablePipe):
|
||||||
self.model = model
|
self.model = model
|
||||||
self.name = name
|
self.name = name
|
||||||
self.scorer = scorer
|
self.scorer = scorer
|
||||||
|
self.save_activations = save_activations
|
||||||
|
|
||||||
@property
|
@property
|
||||||
def key(self) -> str:
|
def key(self) -> str:
|
||||||
|
@ -260,7 +273,7 @@ class SpanCategorizer(TrainablePipe):
|
||||||
"""
|
"""
|
||||||
return list(self.labels)
|
return list(self.labels)
|
||||||
|
|
||||||
def predict(self, docs: Iterable[Doc]):
|
def predict(self, docs: Iterable[Doc]) -> ActivationsT:
|
||||||
"""Apply the pipeline's model to a batch of docs, without modifying them.
|
"""Apply the pipeline's model to a batch of docs, without modifying them.
|
||||||
|
|
||||||
docs (Iterable[Doc]): The documents to predict.
|
docs (Iterable[Doc]): The documents to predict.
|
||||||
|
@ -270,7 +283,7 @@ class SpanCategorizer(TrainablePipe):
|
||||||
"""
|
"""
|
||||||
indices = self.suggester(docs, ops=self.model.ops)
|
indices = self.suggester(docs, ops=self.model.ops)
|
||||||
scores = self.model.predict((docs, indices)) # type: ignore
|
scores = self.model.predict((docs, indices)) # type: ignore
|
||||||
return indices, scores
|
return {"indices": indices, "scores": scores}
|
||||||
|
|
||||||
def set_candidates(
|
def set_candidates(
|
||||||
self, docs: Iterable[Doc], *, candidates_key: str = "candidates"
|
self, docs: Iterable[Doc], *, candidates_key: str = "candidates"
|
||||||
|
@ -290,19 +303,29 @@ class SpanCategorizer(TrainablePipe):
|
||||||
for index in candidates.dataXd:
|
for index in candidates.dataXd:
|
||||||
doc.spans[candidates_key].append(doc[index[0] : index[1]])
|
doc.spans[candidates_key].append(doc[index[0] : index[1]])
|
||||||
|
|
||||||
def set_annotations(self, docs: Iterable[Doc], indices_scores) -> None:
|
def set_annotations(self, docs: Iterable[Doc], activations: ActivationsT) -> None:
|
||||||
"""Modify a batch of Doc objects, using pre-computed scores.
|
"""Modify a batch of Doc objects, using pre-computed scores.
|
||||||
|
|
||||||
docs (Iterable[Doc]): The documents to modify.
|
docs (Iterable[Doc]): The documents to modify.
|
||||||
scores: The scores to set, produced by SpanCategorizer.predict.
|
activations: ActivationsT: The activations, produced by SpanCategorizer.predict.
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/spancategorizer#set_annotations
|
DOCS: https://spacy.io/api/spancategorizer#set_annotations
|
||||||
"""
|
"""
|
||||||
labels = self.labels
|
labels = self.labels
|
||||||
indices, scores = indices_scores
|
|
||||||
|
indices = activations["indices"]
|
||||||
|
assert isinstance(indices, Ragged)
|
||||||
|
scores = cast(Floats2d, activations["scores"])
|
||||||
|
|
||||||
offset = 0
|
offset = 0
|
||||||
for i, doc in enumerate(docs):
|
for i, doc in enumerate(docs):
|
||||||
indices_i = indices[i].dataXd
|
indices_i = indices[i].dataXd
|
||||||
|
if self.save_activations:
|
||||||
|
doc.activations[self.name] = {}
|
||||||
|
doc.activations[self.name]["indices"] = indices_i
|
||||||
|
doc.activations[self.name]["scores"] = scores[
|
||||||
|
offset : offset + indices.lengths[i]
|
||||||
|
]
|
||||||
doc.spans[self.key] = self._make_span_group(
|
doc.spans[self.key] = self._make_span_group(
|
||||||
doc, indices_i, scores[offset : offset + indices.lengths[i]], labels # type: ignore[arg-type]
|
doc, indices_i, scores[offset : offset + indices.lengths[i]], labels # type: ignore[arg-type]
|
||||||
)
|
)
|
||||||
|
|
|
@ -1,9 +1,9 @@
|
||||||
# cython: infer_types=True, profile=True, binding=True
|
# cython: infer_types=True, profile=True, binding=True
|
||||||
from typing import Callable, Optional
|
from typing import Callable, Dict, Iterable, List, Optional, Union
|
||||||
import numpy
|
import numpy
|
||||||
import srsly
|
import srsly
|
||||||
from thinc.api import Model, set_dropout_rate, SequenceCategoricalCrossentropy, Config
|
from thinc.api import Model, set_dropout_rate, SequenceCategoricalCrossentropy, Config
|
||||||
from thinc.types import Floats2d
|
from thinc.types import Floats2d, Ints1d
|
||||||
import warnings
|
import warnings
|
||||||
from itertools import islice
|
from itertools import islice
|
||||||
|
|
||||||
|
@ -22,6 +22,9 @@ from ..training import validate_examples, validate_get_examples
|
||||||
from ..util import registry
|
from ..util import registry
|
||||||
from .. import util
|
from .. import util
|
||||||
|
|
||||||
|
|
||||||
|
ActivationsT = Dict[str, Union[List[Floats2d], List[Ints1d]]]
|
||||||
|
|
||||||
# See #9050
|
# See #9050
|
||||||
BACKWARD_OVERWRITE = False
|
BACKWARD_OVERWRITE = False
|
||||||
|
|
||||||
|
@ -45,7 +48,13 @@ DEFAULT_TAGGER_MODEL = Config().from_str(default_model_config)["model"]
|
||||||
@Language.factory(
|
@Language.factory(
|
||||||
"tagger",
|
"tagger",
|
||||||
assigns=["token.tag"],
|
assigns=["token.tag"],
|
||||||
default_config={"model": DEFAULT_TAGGER_MODEL, "overwrite": False, "scorer": {"@scorers": "spacy.tagger_scorer.v1"}, "neg_prefix": "!"},
|
default_config={
|
||||||
|
"model": DEFAULT_TAGGER_MODEL,
|
||||||
|
"overwrite": False,
|
||||||
|
"scorer": {"@scorers": "spacy.tagger_scorer.v1"},
|
||||||
|
"neg_prefix": "!",
|
||||||
|
"save_activations": False,
|
||||||
|
},
|
||||||
default_score_weights={"tag_acc": 1.0},
|
default_score_weights={"tag_acc": 1.0},
|
||||||
)
|
)
|
||||||
def make_tagger(
|
def make_tagger(
|
||||||
|
@ -55,6 +64,7 @@ def make_tagger(
|
||||||
overwrite: bool,
|
overwrite: bool,
|
||||||
scorer: Optional[Callable],
|
scorer: Optional[Callable],
|
||||||
neg_prefix: str,
|
neg_prefix: str,
|
||||||
|
save_activations: bool,
|
||||||
):
|
):
|
||||||
"""Construct a part-of-speech tagger component.
|
"""Construct a part-of-speech tagger component.
|
||||||
|
|
||||||
|
@ -63,7 +73,8 @@ def make_tagger(
|
||||||
in size, and be normalized as probabilities (all scores between 0 and 1,
|
in size, and be normalized as probabilities (all scores between 0 and 1,
|
||||||
with the rows summing to 1).
|
with the rows summing to 1).
|
||||||
"""
|
"""
|
||||||
return Tagger(nlp.vocab, model, name, overwrite=overwrite, scorer=scorer, neg_prefix=neg_prefix)
|
return Tagger(nlp.vocab, model, name, overwrite=overwrite, scorer=scorer, neg_prefix=neg_prefix,
|
||||||
|
save_activations=save_activations)
|
||||||
|
|
||||||
|
|
||||||
def tagger_score(examples, **kwargs):
|
def tagger_score(examples, **kwargs):
|
||||||
|
@ -89,6 +100,7 @@ class Tagger(TrainablePipe):
|
||||||
overwrite=BACKWARD_OVERWRITE,
|
overwrite=BACKWARD_OVERWRITE,
|
||||||
scorer=tagger_score,
|
scorer=tagger_score,
|
||||||
neg_prefix="!",
|
neg_prefix="!",
|
||||||
|
save_activations: bool = False,
|
||||||
):
|
):
|
||||||
"""Initialize a part-of-speech tagger.
|
"""Initialize a part-of-speech tagger.
|
||||||
|
|
||||||
|
@ -98,6 +110,7 @@ class Tagger(TrainablePipe):
|
||||||
losses during training.
|
losses during training.
|
||||||
scorer (Optional[Callable]): The scoring method. Defaults to
|
scorer (Optional[Callable]): The scoring method. Defaults to
|
||||||
Scorer.score_token_attr for the attribute "tag".
|
Scorer.score_token_attr for the attribute "tag".
|
||||||
|
save_activations (bool): save model activations in Doc when annotating.
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/tagger#init
|
DOCS: https://spacy.io/api/tagger#init
|
||||||
"""
|
"""
|
||||||
|
@ -108,6 +121,7 @@ class Tagger(TrainablePipe):
|
||||||
cfg = {"labels": [], "overwrite": overwrite, "neg_prefix": neg_prefix}
|
cfg = {"labels": [], "overwrite": overwrite, "neg_prefix": neg_prefix}
|
||||||
self.cfg = dict(sorted(cfg.items()))
|
self.cfg = dict(sorted(cfg.items()))
|
||||||
self.scorer = scorer
|
self.scorer = scorer
|
||||||
|
self.save_activations = save_activations
|
||||||
|
|
||||||
@property
|
@property
|
||||||
def labels(self):
|
def labels(self):
|
||||||
|
@ -126,7 +140,7 @@ class Tagger(TrainablePipe):
|
||||||
"""Data about the labels currently added to the component."""
|
"""Data about the labels currently added to the component."""
|
||||||
return tuple(self.cfg["labels"])
|
return tuple(self.cfg["labels"])
|
||||||
|
|
||||||
def predict(self, docs):
|
def predict(self, docs) -> ActivationsT:
|
||||||
"""Apply the pipeline's model to a batch of docs, without modifying them.
|
"""Apply the pipeline's model to a batch of docs, without modifying them.
|
||||||
|
|
||||||
docs (Iterable[Doc]): The documents to predict.
|
docs (Iterable[Doc]): The documents to predict.
|
||||||
|
@ -139,12 +153,12 @@ class Tagger(TrainablePipe):
|
||||||
n_labels = len(self.labels)
|
n_labels = len(self.labels)
|
||||||
guesses = [self.model.ops.alloc((0, n_labels)) for doc in docs]
|
guesses = [self.model.ops.alloc((0, n_labels)) for doc in docs]
|
||||||
assert len(guesses) == len(docs)
|
assert len(guesses) == len(docs)
|
||||||
return guesses
|
return {"probabilities": guesses, "label_ids": guesses}
|
||||||
scores = self.model.predict(docs)
|
scores = self.model.predict(docs)
|
||||||
assert len(scores) == len(docs), (len(scores), len(docs))
|
assert len(scores) == len(docs), (len(scores), len(docs))
|
||||||
guesses = self._scores2guesses(scores)
|
guesses = self._scores2guesses(scores)
|
||||||
assert len(guesses) == len(docs)
|
assert len(guesses) == len(docs)
|
||||||
return guesses
|
return {"probabilities": scores, "label_ids": guesses}
|
||||||
|
|
||||||
def _scores2guesses(self, scores):
|
def _scores2guesses(self, scores):
|
||||||
guesses = []
|
guesses = []
|
||||||
|
@ -155,14 +169,15 @@ class Tagger(TrainablePipe):
|
||||||
guesses.append(doc_guesses)
|
guesses.append(doc_guesses)
|
||||||
return guesses
|
return guesses
|
||||||
|
|
||||||
def set_annotations(self, docs, batch_tag_ids):
|
def set_annotations(self, docs: Iterable[Doc], activations: ActivationsT):
|
||||||
"""Modify a batch of documents, using pre-computed scores.
|
"""Modify a batch of documents, using pre-computed scores.
|
||||||
|
|
||||||
docs (Iterable[Doc]): The documents to modify.
|
docs (Iterable[Doc]): The documents to modify.
|
||||||
batch_tag_ids: The IDs to set, produced by Tagger.predict.
|
activations (ActivationsT): The activations used for setting annotations, produced by Tagger.predict.
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/tagger#set_annotations
|
DOCS: https://spacy.io/api/tagger#set_annotations
|
||||||
"""
|
"""
|
||||||
|
batch_tag_ids = activations["label_ids"]
|
||||||
if isinstance(docs, Doc):
|
if isinstance(docs, Doc):
|
||||||
docs = [docs]
|
docs = [docs]
|
||||||
cdef Doc doc
|
cdef Doc doc
|
||||||
|
@ -170,6 +185,10 @@ class Tagger(TrainablePipe):
|
||||||
cdef bint overwrite = self.cfg["overwrite"]
|
cdef bint overwrite = self.cfg["overwrite"]
|
||||||
labels = self.labels
|
labels = self.labels
|
||||||
for i, doc in enumerate(docs):
|
for i, doc in enumerate(docs):
|
||||||
|
if self.save_activations:
|
||||||
|
doc.activations[self.name] = {}
|
||||||
|
for act_name, acts in activations.items():
|
||||||
|
doc.activations[self.name][act_name] = acts[i]
|
||||||
doc_tag_ids = batch_tag_ids[i]
|
doc_tag_ids = batch_tag_ids[i]
|
||||||
if hasattr(doc_tag_ids, "get"):
|
if hasattr(doc_tag_ids, "get"):
|
||||||
doc_tag_ids = doc_tag_ids.get()
|
doc_tag_ids = doc_tag_ids.get()
|
||||||
|
|
|
@ -1,4 +1,4 @@
|
||||||
from typing import Iterable, Tuple, Optional, Dict, List, Callable, Any
|
from typing import Iterable, Tuple, Optional, Dict, List, Callable, Any, Union
|
||||||
from thinc.api import get_array_module, Model, Optimizer, set_dropout_rate, Config
|
from thinc.api import get_array_module, Model, Optimizer, set_dropout_rate, Config
|
||||||
from thinc.types import Floats2d
|
from thinc.types import Floats2d
|
||||||
import numpy
|
import numpy
|
||||||
|
@ -14,6 +14,9 @@ from ..util import registry
|
||||||
from ..vocab import Vocab
|
from ..vocab import Vocab
|
||||||
|
|
||||||
|
|
||||||
|
ActivationsT = Dict[str, Floats2d]
|
||||||
|
|
||||||
|
|
||||||
single_label_default_config = """
|
single_label_default_config = """
|
||||||
[model]
|
[model]
|
||||||
@architectures = "spacy.TextCatEnsemble.v2"
|
@architectures = "spacy.TextCatEnsemble.v2"
|
||||||
|
@ -24,8 +27,8 @@ single_label_default_config = """
|
||||||
[model.tok2vec.embed]
|
[model.tok2vec.embed]
|
||||||
@architectures = "spacy.MultiHashEmbed.v2"
|
@architectures = "spacy.MultiHashEmbed.v2"
|
||||||
width = 64
|
width = 64
|
||||||
rows = [2000, 2000, 1000, 1000, 1000, 1000]
|
rows = [2000, 2000, 500, 1000, 500]
|
||||||
attrs = ["ORTH", "LOWER", "PREFIX", "SUFFIX", "SHAPE", "ID"]
|
attrs = ["NORM", "LOWER", "PREFIX", "SUFFIX", "SHAPE"]
|
||||||
include_static_vectors = false
|
include_static_vectors = false
|
||||||
|
|
||||||
[model.tok2vec.encode]
|
[model.tok2vec.encode]
|
||||||
|
@ -72,9 +75,10 @@ subword_features = true
|
||||||
"textcat",
|
"textcat",
|
||||||
assigns=["doc.cats"],
|
assigns=["doc.cats"],
|
||||||
default_config={
|
default_config={
|
||||||
"threshold": 0.5,
|
"threshold": 0.0,
|
||||||
"model": DEFAULT_SINGLE_TEXTCAT_MODEL,
|
"model": DEFAULT_SINGLE_TEXTCAT_MODEL,
|
||||||
"scorer": {"@scorers": "spacy.textcat_scorer.v1"},
|
"scorer": {"@scorers": "spacy.textcat_scorer.v1"},
|
||||||
|
"save_activations": False,
|
||||||
},
|
},
|
||||||
default_score_weights={
|
default_score_weights={
|
||||||
"cats_score": 1.0,
|
"cats_score": 1.0,
|
||||||
|
@ -96,6 +100,7 @@ def make_textcat(
|
||||||
model: Model[List[Doc], List[Floats2d]],
|
model: Model[List[Doc], List[Floats2d]],
|
||||||
threshold: float,
|
threshold: float,
|
||||||
scorer: Optional[Callable],
|
scorer: Optional[Callable],
|
||||||
|
save_activations: bool,
|
||||||
) -> "TextCategorizer":
|
) -> "TextCategorizer":
|
||||||
"""Create a TextCategorizer component. The text categorizer predicts categories
|
"""Create a TextCategorizer component. The text categorizer predicts categories
|
||||||
over a whole document. It can learn one or more labels, and the labels are considered
|
over a whole document. It can learn one or more labels, and the labels are considered
|
||||||
|
@ -105,8 +110,16 @@ def make_textcat(
|
||||||
scores for each category.
|
scores for each category.
|
||||||
threshold (float): Cutoff to consider a prediction "positive".
|
threshold (float): Cutoff to consider a prediction "positive".
|
||||||
scorer (Optional[Callable]): The scoring method.
|
scorer (Optional[Callable]): The scoring method.
|
||||||
|
save_activations (bool): save model activations in Doc when annotating.
|
||||||
"""
|
"""
|
||||||
return TextCategorizer(nlp.vocab, model, name, threshold=threshold, scorer=scorer)
|
return TextCategorizer(
|
||||||
|
nlp.vocab,
|
||||||
|
model,
|
||||||
|
name,
|
||||||
|
threshold=threshold,
|
||||||
|
scorer=scorer,
|
||||||
|
save_activations=save_activations,
|
||||||
|
)
|
||||||
|
|
||||||
|
|
||||||
def textcat_score(examples: Iterable[Example], **kwargs) -> Dict[str, Any]:
|
def textcat_score(examples: Iterable[Example], **kwargs) -> Dict[str, Any]:
|
||||||
|
@ -137,6 +150,7 @@ class TextCategorizer(TrainablePipe):
|
||||||
*,
|
*,
|
||||||
threshold: float,
|
threshold: float,
|
||||||
scorer: Optional[Callable] = textcat_score,
|
scorer: Optional[Callable] = textcat_score,
|
||||||
|
save_activations: bool = False,
|
||||||
) -> None:
|
) -> None:
|
||||||
"""Initialize a text categorizer for single-label classification.
|
"""Initialize a text categorizer for single-label classification.
|
||||||
|
|
||||||
|
@ -144,7 +158,8 @@ class TextCategorizer(TrainablePipe):
|
||||||
model (thinc.api.Model): The Thinc Model powering the pipeline component.
|
model (thinc.api.Model): The Thinc Model powering the pipeline component.
|
||||||
name (str): The component instance name, used to add entries to the
|
name (str): The component instance name, used to add entries to the
|
||||||
losses during training.
|
losses during training.
|
||||||
threshold (float): Cutoff to consider a prediction "positive".
|
threshold (float): Unused, not needed for single-label (exclusive
|
||||||
|
classes) classification.
|
||||||
scorer (Optional[Callable]): The scoring method. Defaults to
|
scorer (Optional[Callable]): The scoring method. Defaults to
|
||||||
Scorer.score_cats for the attribute "cats".
|
Scorer.score_cats for the attribute "cats".
|
||||||
|
|
||||||
|
@ -154,9 +169,10 @@ class TextCategorizer(TrainablePipe):
|
||||||
self.model = model
|
self.model = model
|
||||||
self.name = name
|
self.name = name
|
||||||
self._rehearsal_model = None
|
self._rehearsal_model = None
|
||||||
cfg = {"labels": [], "threshold": threshold, "positive_label": None}
|
cfg: Dict[str, Any] = {"labels": [], "threshold": threshold, "positive_label": None}
|
||||||
self.cfg = dict(cfg)
|
self.cfg = dict(cfg)
|
||||||
self.scorer = scorer
|
self.scorer = scorer
|
||||||
|
self.save_activations = save_activations
|
||||||
|
|
||||||
@property
|
@property
|
||||||
def support_missing_values(self):
|
def support_missing_values(self):
|
||||||
|
@ -181,7 +197,7 @@ class TextCategorizer(TrainablePipe):
|
||||||
"""
|
"""
|
||||||
return self.labels # type: ignore[return-value]
|
return self.labels # type: ignore[return-value]
|
||||||
|
|
||||||
def predict(self, docs: Iterable[Doc]):
|
def predict(self, docs: Iterable[Doc]) -> ActivationsT:
|
||||||
"""Apply the pipeline's model to a batch of docs, without modifying them.
|
"""Apply the pipeline's model to a batch of docs, without modifying them.
|
||||||
|
|
||||||
docs (Iterable[Doc]): The documents to predict.
|
docs (Iterable[Doc]): The documents to predict.
|
||||||
|
@ -194,12 +210,12 @@ class TextCategorizer(TrainablePipe):
|
||||||
tensors = [doc.tensor for doc in docs]
|
tensors = [doc.tensor for doc in docs]
|
||||||
xp = self.model.ops.xp
|
xp = self.model.ops.xp
|
||||||
scores = xp.zeros((len(list(docs)), len(self.labels)))
|
scores = xp.zeros((len(list(docs)), len(self.labels)))
|
||||||
return scores
|
return {"probabilities": scores}
|
||||||
scores = self.model.predict(docs)
|
scores = self.model.predict(docs)
|
||||||
scores = self.model.ops.asarray(scores)
|
scores = self.model.ops.asarray(scores)
|
||||||
return scores
|
return {"probabilities": scores}
|
||||||
|
|
||||||
def set_annotations(self, docs: Iterable[Doc], scores) -> None:
|
def set_annotations(self, docs: Iterable[Doc], activations: ActivationsT) -> None:
|
||||||
"""Modify a batch of Doc objects, using pre-computed scores.
|
"""Modify a batch of Doc objects, using pre-computed scores.
|
||||||
|
|
||||||
docs (Iterable[Doc]): The documents to modify.
|
docs (Iterable[Doc]): The documents to modify.
|
||||||
|
@ -207,9 +223,13 @@ class TextCategorizer(TrainablePipe):
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/textcategorizer#set_annotations
|
DOCS: https://spacy.io/api/textcategorizer#set_annotations
|
||||||
"""
|
"""
|
||||||
|
probs = activations["probabilities"]
|
||||||
for i, doc in enumerate(docs):
|
for i, doc in enumerate(docs):
|
||||||
|
if self.save_activations:
|
||||||
|
doc.activations[self.name] = {}
|
||||||
|
doc.activations[self.name]["probabilities"] = probs[i]
|
||||||
for j, label in enumerate(self.labels):
|
for j, label in enumerate(self.labels):
|
||||||
doc.cats[label] = float(scores[i, j])
|
doc.cats[label] = float(probs[i, j])
|
||||||
|
|
||||||
def update(
|
def update(
|
||||||
self,
|
self,
|
||||||
|
|
|
@ -1,4 +1,4 @@
|
||||||
from typing import Iterable, Optional, Dict, List, Callable, Any
|
from typing import Iterable, Optional, Dict, List, Callable, Any, Union
|
||||||
from thinc.types import Floats2d
|
from thinc.types import Floats2d
|
||||||
from thinc.api import Model, Config
|
from thinc.api import Model, Config
|
||||||
|
|
||||||
|
@ -19,17 +19,17 @@ multi_label_default_config = """
|
||||||
@architectures = "spacy.TextCatEnsemble.v2"
|
@architectures = "spacy.TextCatEnsemble.v2"
|
||||||
|
|
||||||
[model.tok2vec]
|
[model.tok2vec]
|
||||||
@architectures = "spacy.Tok2Vec.v1"
|
@architectures = "spacy.Tok2Vec.v2"
|
||||||
|
|
||||||
[model.tok2vec.embed]
|
[model.tok2vec.embed]
|
||||||
@architectures = "spacy.MultiHashEmbed.v2"
|
@architectures = "spacy.MultiHashEmbed.v2"
|
||||||
width = 64
|
width = 64
|
||||||
rows = [2000, 2000, 1000, 1000, 1000, 1000]
|
rows = [2000, 2000, 500, 1000, 500]
|
||||||
attrs = ["ORTH", "LOWER", "PREFIX", "SUFFIX", "SHAPE", "ID"]
|
attrs = ["NORM", "LOWER", "PREFIX", "SUFFIX", "SHAPE"]
|
||||||
include_static_vectors = false
|
include_static_vectors = false
|
||||||
|
|
||||||
[model.tok2vec.encode]
|
[model.tok2vec.encode]
|
||||||
@architectures = "spacy.MaxoutWindowEncoder.v1"
|
@architectures = "spacy.MaxoutWindowEncoder.v2"
|
||||||
width = ${model.tok2vec.embed.width}
|
width = ${model.tok2vec.embed.width}
|
||||||
window_size = 1
|
window_size = 1
|
||||||
maxout_pieces = 3
|
maxout_pieces = 3
|
||||||
|
@ -75,6 +75,7 @@ subword_features = true
|
||||||
"threshold": 0.5,
|
"threshold": 0.5,
|
||||||
"model": DEFAULT_MULTI_TEXTCAT_MODEL,
|
"model": DEFAULT_MULTI_TEXTCAT_MODEL,
|
||||||
"scorer": {"@scorers": "spacy.textcat_multilabel_scorer.v1"},
|
"scorer": {"@scorers": "spacy.textcat_multilabel_scorer.v1"},
|
||||||
|
"save_activations": False,
|
||||||
},
|
},
|
||||||
default_score_weights={
|
default_score_weights={
|
||||||
"cats_score": 1.0,
|
"cats_score": 1.0,
|
||||||
|
@ -96,7 +97,8 @@ def make_multilabel_textcat(
|
||||||
model: Model[List[Doc], List[Floats2d]],
|
model: Model[List[Doc], List[Floats2d]],
|
||||||
threshold: float,
|
threshold: float,
|
||||||
scorer: Optional[Callable],
|
scorer: Optional[Callable],
|
||||||
) -> "TextCategorizer":
|
save_activations: bool,
|
||||||
|
) -> "MultiLabel_TextCategorizer":
|
||||||
"""Create a TextCategorizer component. The text categorizer predicts categories
|
"""Create a TextCategorizer component. The text categorizer predicts categories
|
||||||
over a whole document. It can learn one or more labels, and the labels are considered
|
over a whole document. It can learn one or more labels, and the labels are considered
|
||||||
to be non-mutually exclusive, which means that there can be zero or more labels
|
to be non-mutually exclusive, which means that there can be zero or more labels
|
||||||
|
@ -105,9 +107,15 @@ def make_multilabel_textcat(
|
||||||
model (Model[List[Doc], List[Floats2d]]): A model instance that predicts
|
model (Model[List[Doc], List[Floats2d]]): A model instance that predicts
|
||||||
scores for each category.
|
scores for each category.
|
||||||
threshold (float): Cutoff to consider a prediction "positive".
|
threshold (float): Cutoff to consider a prediction "positive".
|
||||||
|
scorer (Optional[Callable]): The scoring method.
|
||||||
"""
|
"""
|
||||||
return MultiLabel_TextCategorizer(
|
return MultiLabel_TextCategorizer(
|
||||||
nlp.vocab, model, name, threshold=threshold, scorer=scorer
|
nlp.vocab,
|
||||||
|
model,
|
||||||
|
name,
|
||||||
|
threshold=threshold,
|
||||||
|
scorer=scorer,
|
||||||
|
save_activations=save_activations,
|
||||||
)
|
)
|
||||||
|
|
||||||
|
|
||||||
|
@ -139,6 +147,7 @@ class MultiLabel_TextCategorizer(TextCategorizer):
|
||||||
*,
|
*,
|
||||||
threshold: float,
|
threshold: float,
|
||||||
scorer: Optional[Callable] = textcat_multilabel_score,
|
scorer: Optional[Callable] = textcat_multilabel_score,
|
||||||
|
save_activations: bool = False,
|
||||||
) -> None:
|
) -> None:
|
||||||
"""Initialize a text categorizer for multi-label classification.
|
"""Initialize a text categorizer for multi-label classification.
|
||||||
|
|
||||||
|
@ -147,6 +156,11 @@ class MultiLabel_TextCategorizer(TextCategorizer):
|
||||||
name (str): The component instance name, used to add entries to the
|
name (str): The component instance name, used to add entries to the
|
||||||
losses during training.
|
losses during training.
|
||||||
threshold (float): Cutoff to consider a prediction "positive".
|
threshold (float): Cutoff to consider a prediction "positive".
|
||||||
|
<<<<<<< HEAD
|
||||||
|
save_activations (bool): save model activations in Doc when annotating.
|
||||||
|
=======
|
||||||
|
scorer (Optional[Callable]): The scoring method.
|
||||||
|
>>>>>>> upstream/master
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/textcategorizer#init
|
DOCS: https://spacy.io/api/textcategorizer#init
|
||||||
"""
|
"""
|
||||||
|
@ -157,6 +171,7 @@ class MultiLabel_TextCategorizer(TextCategorizer):
|
||||||
cfg = {"labels": [], "threshold": threshold}
|
cfg = {"labels": [], "threshold": threshold}
|
||||||
self.cfg = dict(cfg)
|
self.cfg = dict(cfg)
|
||||||
self.scorer = scorer
|
self.scorer = scorer
|
||||||
|
self.save_activations = save_activations
|
||||||
|
|
||||||
@property
|
@property
|
||||||
def support_missing_values(self):
|
def support_missing_values(self):
|
||||||
|
|
|
@ -123,9 +123,6 @@ class Tok2Vec(TrainablePipe):
|
||||||
width = self.model.get_dim("nO")
|
width = self.model.get_dim("nO")
|
||||||
return [self.model.ops.alloc((0, width)) for doc in docs]
|
return [self.model.ops.alloc((0, width)) for doc in docs]
|
||||||
tokvecs = self.model.predict(docs)
|
tokvecs = self.model.predict(docs)
|
||||||
batch_id = Tok2VecListener.get_batch_id(docs)
|
|
||||||
for listener in self.listeners:
|
|
||||||
listener.receive(batch_id, tokvecs, _empty_backprop)
|
|
||||||
return tokvecs
|
return tokvecs
|
||||||
|
|
||||||
def set_annotations(self, docs: Sequence[Doc], tokvecses) -> None:
|
def set_annotations(self, docs: Sequence[Doc], tokvecses) -> None:
|
||||||
|
@ -286,8 +283,19 @@ class Tok2VecListener(Model):
|
||||||
def forward(model: Tok2VecListener, inputs, is_train: bool):
|
def forward(model: Tok2VecListener, inputs, is_train: bool):
|
||||||
"""Supply the outputs from the upstream Tok2Vec component."""
|
"""Supply the outputs from the upstream Tok2Vec component."""
|
||||||
if is_train:
|
if is_train:
|
||||||
model.verify_inputs(inputs)
|
# This might occur during training when the tok2vec layer is frozen / hasn't been updated.
|
||||||
return model._outputs, model._backprop
|
# In that case, it should be set to "annotating" so we can retrieve the embeddings from the doc.
|
||||||
|
if model._batch_id is None:
|
||||||
|
outputs = []
|
||||||
|
for doc in inputs:
|
||||||
|
if doc.tensor.size == 0:
|
||||||
|
raise ValueError(Errors.E203.format(name="tok2vec"))
|
||||||
|
else:
|
||||||
|
outputs.append(doc.tensor)
|
||||||
|
return outputs, _empty_backprop
|
||||||
|
else:
|
||||||
|
model.verify_inputs(inputs)
|
||||||
|
return model._outputs, model._backprop
|
||||||
else:
|
else:
|
||||||
# This is pretty grim, but it's hard to do better :(.
|
# This is pretty grim, but it's hard to do better :(.
|
||||||
# It's hard to avoid relying on the doc.tensor attribute, because the
|
# It's hard to avoid relying on the doc.tensor attribute, because the
|
||||||
|
@ -306,7 +314,7 @@ def forward(model: Tok2VecListener, inputs, is_train: bool):
|
||||||
outputs.append(model.ops.alloc2f(len(doc), width))
|
outputs.append(model.ops.alloc2f(len(doc), width))
|
||||||
else:
|
else:
|
||||||
outputs.append(doc.tensor)
|
outputs.append(doc.tensor)
|
||||||
return outputs, lambda dX: []
|
return outputs, _empty_backprop
|
||||||
|
|
||||||
|
|
||||||
def _empty_backprop(dX): # for pickling
|
def _empty_backprop(dX): # for pickling
|
||||||
|
|
|
@ -6,3 +6,4 @@ cdef class TrainablePipe(Pipe):
|
||||||
cdef public object model
|
cdef public object model
|
||||||
cdef public object cfg
|
cdef public object cfg
|
||||||
cdef public object scorer
|
cdef public object scorer
|
||||||
|
cdef bint _save_activations
|
||||||
|
|
|
@ -1,12 +1,13 @@
|
||||||
# cython: infer_types=True, profile=True
|
# cython: infer_types=True, profile=True, binding=True
|
||||||
from typing import Iterable, Iterator, Optional, Dict, Tuple, Callable
|
from typing import Iterable, Iterator, Optional, Dict, Tuple, Callable
|
||||||
import srsly
|
import srsly
|
||||||
from thinc.api import set_dropout_rate, Model, Optimizer
|
from thinc.api import set_dropout_rate, Model, Optimizer
|
||||||
|
import warnings
|
||||||
|
|
||||||
from ..tokens.doc cimport Doc
|
from ..tokens.doc cimport Doc
|
||||||
|
|
||||||
from ..training import validate_examples
|
from ..training import validate_examples
|
||||||
from ..errors import Errors
|
from ..errors import Errors, Warnings
|
||||||
from .pipe import Pipe, deserialize_config
|
from .pipe import Pipe, deserialize_config
|
||||||
from .. import util
|
from .. import util
|
||||||
from ..vocab import Vocab
|
from ..vocab import Vocab
|
||||||
|
@ -342,3 +343,11 @@ cdef class TrainablePipe(Pipe):
|
||||||
deserialize["model"] = load_model
|
deserialize["model"] = load_model
|
||||||
util.from_disk(path, deserialize, exclude)
|
util.from_disk(path, deserialize, exclude)
|
||||||
return self
|
return self
|
||||||
|
|
||||||
|
@property
|
||||||
|
def save_activations(self):
|
||||||
|
return self._save_activations
|
||||||
|
|
||||||
|
@save_activations.setter
|
||||||
|
def save_activations(self, save_activations: bool):
|
||||||
|
self._save_activations = save_activations
|
||||||
|
|
|
@ -144,7 +144,7 @@ def validate_init_settings(
|
||||||
|
|
||||||
def validate_token_pattern(obj: list) -> List[str]:
|
def validate_token_pattern(obj: list) -> List[str]:
|
||||||
# Try to convert non-string keys (e.g. {ORTH: "foo"} -> {"ORTH": "foo"})
|
# Try to convert non-string keys (e.g. {ORTH: "foo"} -> {"ORTH": "foo"})
|
||||||
get_key = lambda k: NAMES[k] if isinstance(k, int) and k < len(NAMES) else k
|
get_key = lambda k: NAMES[k] if isinstance(k, int) and k in NAMES else k
|
||||||
if isinstance(obj, list):
|
if isinstance(obj, list):
|
||||||
converted = []
|
converted = []
|
||||||
for pattern in obj:
|
for pattern in obj:
|
||||||
|
@ -181,12 +181,12 @@ class TokenPatternNumber(BaseModel):
|
||||||
IS_SUBSET: Optional[List[StrictInt]] = Field(None, alias="is_subset")
|
IS_SUBSET: Optional[List[StrictInt]] = Field(None, alias="is_subset")
|
||||||
IS_SUPERSET: Optional[List[StrictInt]] = Field(None, alias="is_superset")
|
IS_SUPERSET: Optional[List[StrictInt]] = Field(None, alias="is_superset")
|
||||||
INTERSECTS: Optional[List[StrictInt]] = Field(None, alias="intersects")
|
INTERSECTS: Optional[List[StrictInt]] = Field(None, alias="intersects")
|
||||||
EQ: Union[StrictInt, StrictFloat] = Field(None, alias="==")
|
EQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="==")
|
||||||
NEQ: Union[StrictInt, StrictFloat] = Field(None, alias="!=")
|
NEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="!=")
|
||||||
GEQ: Union[StrictInt, StrictFloat] = Field(None, alias=">=")
|
GEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias=">=")
|
||||||
LEQ: Union[StrictInt, StrictFloat] = Field(None, alias="<=")
|
LEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="<=")
|
||||||
GT: Union[StrictInt, StrictFloat] = Field(None, alias=">")
|
GT: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias=">")
|
||||||
LT: Union[StrictInt, StrictFloat] = Field(None, alias="<")
|
LT: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="<")
|
||||||
|
|
||||||
class Config:
|
class Config:
|
||||||
extra = "forbid"
|
extra = "forbid"
|
||||||
|
@ -430,7 +430,7 @@ class ProjectConfigAssetURL(BaseModel):
|
||||||
# fmt: off
|
# fmt: off
|
||||||
dest: StrictStr = Field(..., title="Destination of downloaded asset")
|
dest: StrictStr = Field(..., title="Destination of downloaded asset")
|
||||||
url: Optional[StrictStr] = Field(None, title="URL of asset")
|
url: Optional[StrictStr] = Field(None, title="URL of asset")
|
||||||
checksum: str = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
|
checksum: Optional[str] = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
|
||||||
description: StrictStr = Field("", title="Description of asset")
|
description: StrictStr = Field("", title="Description of asset")
|
||||||
# fmt: on
|
# fmt: on
|
||||||
|
|
||||||
|
@ -438,7 +438,7 @@ class ProjectConfigAssetURL(BaseModel):
|
||||||
class ProjectConfigAssetGit(BaseModel):
|
class ProjectConfigAssetGit(BaseModel):
|
||||||
# fmt: off
|
# fmt: off
|
||||||
git: ProjectConfigAssetGitItem = Field(..., title="Git repo information")
|
git: ProjectConfigAssetGitItem = Field(..., title="Git repo information")
|
||||||
checksum: str = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
|
checksum: Optional[str] = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
|
||||||
description: Optional[StrictStr] = Field(None, title="Description of asset")
|
description: Optional[StrictStr] = Field(None, title="Description of asset")
|
||||||
# fmt: on
|
# fmt: on
|
||||||
|
|
||||||
|
@ -508,9 +508,9 @@ class DocJSONSchema(BaseModel):
|
||||||
None, title="Indices of sentences' start and end indices"
|
None, title="Indices of sentences' start and end indices"
|
||||||
)
|
)
|
||||||
text: StrictStr = Field(..., title="Document text")
|
text: StrictStr = Field(..., title="Document text")
|
||||||
spans: Dict[StrictStr, List[Dict[StrictStr, Union[StrictStr, StrictInt]]]] = Field(
|
spans: Optional[
|
||||||
None, title="Span information - end/start indices, label, KB ID"
|
Dict[StrictStr, List[Dict[StrictStr, Union[StrictStr, StrictInt]]]]
|
||||||
)
|
] = Field(None, title="Span information - end/start indices, label, KB ID")
|
||||||
tokens: List[Dict[StrictStr, Union[StrictStr, StrictInt]]] = Field(
|
tokens: List[Dict[StrictStr, Union[StrictStr, StrictInt]]] = Field(
|
||||||
..., title="Token information - ID, start, annotations"
|
..., title="Token information - ID, start, annotations"
|
||||||
)
|
)
|
||||||
|
@ -519,9 +519,9 @@ class DocJSONSchema(BaseModel):
|
||||||
title="Any custom data stored in the document's _ attribute",
|
title="Any custom data stored in the document's _ attribute",
|
||||||
alias="_",
|
alias="_",
|
||||||
)
|
)
|
||||||
underscore_token: Optional[Dict[StrictStr, Dict[StrictStr, Any]]] = Field(
|
underscore_token: Optional[Dict[StrictStr, List[Dict[StrictStr, Any]]]] = Field(
|
||||||
None, title="Any custom data stored in the token's _ attribute"
|
None, title="Any custom data stored in the token's _ attribute"
|
||||||
)
|
)
|
||||||
underscore_span: Optional[Dict[StrictStr, Dict[StrictStr, Any]]] = Field(
|
underscore_span: Optional[Dict[StrictStr, List[Dict[StrictStr, Any]]]] = Field(
|
||||||
None, title="Any custom data stored in the span's _ attribute"
|
None, title="Any custom data stored in the span's _ attribute"
|
||||||
)
|
)
|
||||||
|
|
|
@ -446,7 +446,7 @@ class Scorer:
|
||||||
labels (Iterable[str]): The set of possible labels. Defaults to [].
|
labels (Iterable[str]): The set of possible labels. Defaults to [].
|
||||||
multi_label (bool): Whether the attribute allows multiple labels.
|
multi_label (bool): Whether the attribute allows multiple labels.
|
||||||
Defaults to True. When set to False (exclusive labels), missing
|
Defaults to True. When set to False (exclusive labels), missing
|
||||||
gold labels are interpreted as 0.0.
|
gold labels are interpreted as 0.0 and the threshold is set to 0.0.
|
||||||
positive_label (str): The positive label for a binary task with
|
positive_label (str): The positive label for a binary task with
|
||||||
exclusive classes. Defaults to None.
|
exclusive classes. Defaults to None.
|
||||||
threshold (float): Cutoff to consider a prediction "positive". Defaults
|
threshold (float): Cutoff to consider a prediction "positive". Defaults
|
||||||
|
@ -471,6 +471,8 @@ class Scorer:
|
||||||
"""
|
"""
|
||||||
if threshold is None:
|
if threshold is None:
|
||||||
threshold = 0.5 if multi_label else 0.0
|
threshold = 0.5 if multi_label else 0.0
|
||||||
|
if not multi_label:
|
||||||
|
threshold = 0.0
|
||||||
f_per_type = {label: PRFScore() for label in labels}
|
f_per_type = {label: PRFScore() for label in labels}
|
||||||
auc_per_type = {label: ROCAUCScore() for label in labels}
|
auc_per_type = {label: ROCAUCScore() for label in labels}
|
||||||
labels = set(labels)
|
labels = set(labels)
|
||||||
|
@ -505,20 +507,18 @@ class Scorer:
|
||||||
# Get the highest-scoring for each.
|
# Get the highest-scoring for each.
|
||||||
pred_label, pred_score = max(pred_cats.items(), key=lambda it: it[1])
|
pred_label, pred_score = max(pred_cats.items(), key=lambda it: it[1])
|
||||||
gold_label, gold_score = max(gold_cats.items(), key=lambda it: it[1])
|
gold_label, gold_score = max(gold_cats.items(), key=lambda it: it[1])
|
||||||
if pred_label == gold_label and pred_score >= threshold:
|
if pred_label == gold_label:
|
||||||
f_per_type[pred_label].tp += 1
|
f_per_type[pred_label].tp += 1
|
||||||
else:
|
else:
|
||||||
f_per_type[gold_label].fn += 1
|
f_per_type[gold_label].fn += 1
|
||||||
if pred_score >= threshold:
|
f_per_type[pred_label].fp += 1
|
||||||
f_per_type[pred_label].fp += 1
|
|
||||||
elif gold_cats:
|
elif gold_cats:
|
||||||
gold_label, gold_score = max(gold_cats, key=lambda it: it[1])
|
gold_label, gold_score = max(gold_cats, key=lambda it: it[1])
|
||||||
if gold_score > 0:
|
if gold_score > 0:
|
||||||
f_per_type[gold_label].fn += 1
|
f_per_type[gold_label].fn += 1
|
||||||
elif pred_cats:
|
elif pred_cats:
|
||||||
pred_label, pred_score = max(pred_cats.items(), key=lambda it: it[1])
|
pred_label, pred_score = max(pred_cats.items(), key=lambda it: it[1])
|
||||||
if pred_score >= threshold:
|
f_per_type[pred_label].fp += 1
|
||||||
f_per_type[pred_label].fp += 1
|
|
||||||
micro_prf = PRFScore()
|
micro_prf = PRFScore()
|
||||||
for label_prf in f_per_type.values():
|
for label_prf in f_per_type.values():
|
||||||
micro_prf.tp += label_prf.tp
|
micro_prf.tp += label_prf.tp
|
||||||
|
|
|
@ -1,4 +1,4 @@
|
||||||
from libc.stdint cimport int64_t
|
from libc.stdint cimport int64_t, uint32_t
|
||||||
from libcpp.vector cimport vector
|
from libcpp.vector cimport vector
|
||||||
from libcpp.set cimport set
|
from libcpp.set cimport set
|
||||||
from cymem.cymem cimport Pool
|
from cymem.cymem cimport Pool
|
||||||
|
@ -7,13 +7,6 @@ from murmurhash.mrmr cimport hash64
|
||||||
|
|
||||||
from .typedefs cimport attr_t, hash_t
|
from .typedefs cimport attr_t, hash_t
|
||||||
|
|
||||||
|
|
||||||
cpdef hash_t hash_string(str string) except 0
|
|
||||||
cdef hash_t hash_utf8(char* utf8_string, int length) nogil
|
|
||||||
|
|
||||||
cdef str decode_Utf8Str(const Utf8Str* string)
|
|
||||||
|
|
||||||
|
|
||||||
ctypedef union Utf8Str:
|
ctypedef union Utf8Str:
|
||||||
unsigned char[8] s
|
unsigned char[8] s
|
||||||
unsigned char* p
|
unsigned char* p
|
||||||
|
@ -21,9 +14,13 @@ ctypedef union Utf8Str:
|
||||||
|
|
||||||
cdef class StringStore:
|
cdef class StringStore:
|
||||||
cdef Pool mem
|
cdef Pool mem
|
||||||
|
cdef vector[hash_t] _keys
|
||||||
|
cdef PreshMap _map
|
||||||
|
|
||||||
cdef vector[hash_t] keys
|
cdef hash_t _intern_str(self, str string)
|
||||||
cdef public PreshMap _map
|
cdef Utf8Str* _allocate_str_repr(self, const unsigned char* chars, uint32_t length) except *
|
||||||
|
cdef str _decode_str_repr(self, const Utf8Str* string)
|
||||||
|
|
||||||
cdef const Utf8Str* intern_unicode(self, str py_string)
|
|
||||||
cdef const Utf8Str* _intern_utf8(self, char* utf8_string, int length, hash_t* precalculated_hash)
|
cpdef hash_t hash_string(object string) except -1
|
||||||
|
cpdef hash_t get_string_id(object string_or_hash) except -1
|
||||||
|
|
|
@ -1,21 +1,20 @@
|
||||||
from typing import Optional, Iterable, Iterator, Union, Any, overload
|
from typing import List, Optional, Iterable, Iterator, Union, Any, Tuple, overload
|
||||||
from pathlib import Path
|
from pathlib import Path
|
||||||
|
|
||||||
def get_string_id(key: Union[str, int]) -> int: ...
|
|
||||||
|
|
||||||
class StringStore:
|
class StringStore:
|
||||||
def __init__(
|
def __init__(self, strings: Optional[Iterable[str]]) -> None: ...
|
||||||
self, strings: Optional[Iterable[str]] = ..., freeze: bool = ...
|
|
||||||
) -> None: ...
|
|
||||||
@overload
|
@overload
|
||||||
def __getitem__(self, string_or_id: Union[bytes, str]) -> int: ...
|
def __getitem__(self, string_or_hash: str) -> int: ...
|
||||||
@overload
|
@overload
|
||||||
def __getitem__(self, string_or_id: int) -> str: ...
|
def __getitem__(self, string_or_hash: int) -> str: ...
|
||||||
def as_int(self, key: Union[bytes, str, int]) -> int: ...
|
def as_int(self, string_or_hash: Union[str, int]) -> int: ...
|
||||||
def as_string(self, key: Union[bytes, str, int]) -> str: ...
|
def as_string(self, string_or_hash: Union[str, int]) -> str: ...
|
||||||
def add(self, string: str) -> int: ...
|
def add(self, string: str) -> int: ...
|
||||||
|
def items(self) -> List[Tuple[str, int]]: ...
|
||||||
|
def keys(self) -> List[str]: ...
|
||||||
|
def values(self) -> List[int]: ...
|
||||||
def __len__(self) -> int: ...
|
def __len__(self) -> int: ...
|
||||||
def __contains__(self, string: str) -> bool: ...
|
def __contains__(self, string_or_hash: Union[str, int]) -> bool: ...
|
||||||
def __iter__(self) -> Iterator[str]: ...
|
def __iter__(self) -> Iterator[str]: ...
|
||||||
def __reduce__(self) -> Any: ...
|
def __reduce__(self) -> Any: ...
|
||||||
def to_disk(self, path: Union[str, Path]) -> None: ...
|
def to_disk(self, path: Union[str, Path]) -> None: ...
|
||||||
|
@ -23,3 +22,5 @@ class StringStore:
|
||||||
def to_bytes(self, **kwargs: Any) -> bytes: ...
|
def to_bytes(self, **kwargs: Any) -> bytes: ...
|
||||||
def from_bytes(self, bytes_data: bytes, **kwargs: Any) -> StringStore: ...
|
def from_bytes(self, bytes_data: bytes, **kwargs: Any) -> StringStore: ...
|
||||||
def _reset_and_load(self, strings: Iterable[str]) -> None: ...
|
def _reset_and_load(self, strings: Iterable[str]) -> None: ...
|
||||||
|
|
||||||
|
def get_string_id(string_or_hash: Union[str, int]) -> int: ...
|
||||||
|
|
|
@ -1,9 +1,10 @@
|
||||||
# cython: infer_types=True
|
# cython: infer_types=True
|
||||||
|
from typing import Optional, Union, Iterable, Tuple, Callable, Any, List, Iterator
|
||||||
cimport cython
|
cimport cython
|
||||||
from libc.string cimport memcpy
|
from libc.string cimport memcpy
|
||||||
from libcpp.set cimport set
|
from libcpp.set cimport set
|
||||||
from libc.stdint cimport uint32_t
|
from libc.stdint cimport uint32_t
|
||||||
from murmurhash.mrmr cimport hash64, hash32
|
from murmurhash.mrmr cimport hash64
|
||||||
|
|
||||||
import srsly
|
import srsly
|
||||||
|
|
||||||
|
@ -14,105 +15,13 @@ from .symbols import NAMES as SYMBOLS_BY_INT
|
||||||
from .errors import Errors
|
from .errors import Errors
|
||||||
from . import util
|
from . import util
|
||||||
|
|
||||||
# Not particularly elegant, but this is faster than `isinstance(key, numbers.Integral)`
|
|
||||||
cdef inline bint _try_coerce_to_hash(object key, hash_t* out_hash):
|
|
||||||
try:
|
|
||||||
out_hash[0] = key
|
|
||||||
return True
|
|
||||||
except:
|
|
||||||
return False
|
|
||||||
|
|
||||||
def get_string_id(key):
|
|
||||||
"""Get a string ID, handling the reserved symbols correctly. If the key is
|
|
||||||
already an ID, return it.
|
|
||||||
|
|
||||||
This function optimises for convenience over performance, so shouldn't be
|
|
||||||
used in tight loops.
|
|
||||||
"""
|
|
||||||
cdef hash_t str_hash
|
|
||||||
if isinstance(key, str):
|
|
||||||
if len(key) == 0:
|
|
||||||
return 0
|
|
||||||
|
|
||||||
symbol = SYMBOLS_BY_STR.get(key, None)
|
|
||||||
if symbol is not None:
|
|
||||||
return symbol
|
|
||||||
else:
|
|
||||||
chars = key.encode("utf8")
|
|
||||||
return hash_utf8(chars, len(chars))
|
|
||||||
elif _try_coerce_to_hash(key, &str_hash):
|
|
||||||
# Coerce the integral key to the expected primitive hash type.
|
|
||||||
# This ensures that custom/overloaded "primitive" data types
|
|
||||||
# such as those implemented by numpy are not inadvertently used
|
|
||||||
# downsteam (as these are internally implemented as custom PyObjects
|
|
||||||
# whose comparison operators can incur a significant overhead).
|
|
||||||
return str_hash
|
|
||||||
else:
|
|
||||||
# TODO: Raise an error instead
|
|
||||||
return key
|
|
||||||
|
|
||||||
|
|
||||||
cpdef hash_t hash_string(str string) except 0:
|
|
||||||
chars = string.encode("utf8")
|
|
||||||
return hash_utf8(chars, len(chars))
|
|
||||||
|
|
||||||
|
|
||||||
cdef hash_t hash_utf8(char* utf8_string, int length) nogil:
|
|
||||||
return hash64(utf8_string, length, 1)
|
|
||||||
|
|
||||||
|
|
||||||
cdef uint32_t hash32_utf8(char* utf8_string, int length) nogil:
|
|
||||||
return hash32(utf8_string, length, 1)
|
|
||||||
|
|
||||||
|
|
||||||
cdef str decode_Utf8Str(const Utf8Str* string):
|
|
||||||
cdef int i, length
|
|
||||||
if string.s[0] < sizeof(string.s) and string.s[0] != 0:
|
|
||||||
return string.s[1:string.s[0]+1].decode("utf8")
|
|
||||||
elif string.p[0] < 255:
|
|
||||||
return string.p[1:string.p[0]+1].decode("utf8")
|
|
||||||
else:
|
|
||||||
i = 0
|
|
||||||
length = 0
|
|
||||||
while string.p[i] == 255:
|
|
||||||
i += 1
|
|
||||||
length += 255
|
|
||||||
length += string.p[i]
|
|
||||||
i += 1
|
|
||||||
return string.p[i:length + i].decode("utf8")
|
|
||||||
|
|
||||||
|
|
||||||
cdef Utf8Str* _allocate(Pool mem, const unsigned char* chars, uint32_t length) except *:
|
|
||||||
cdef int n_length_bytes
|
|
||||||
cdef int i
|
|
||||||
cdef Utf8Str* string = <Utf8Str*>mem.alloc(1, sizeof(Utf8Str))
|
|
||||||
cdef uint32_t ulength = length
|
|
||||||
if length < sizeof(string.s):
|
|
||||||
string.s[0] = <unsigned char>length
|
|
||||||
memcpy(&string.s[1], chars, length)
|
|
||||||
return string
|
|
||||||
elif length < 255:
|
|
||||||
string.p = <unsigned char*>mem.alloc(length + 1, sizeof(unsigned char))
|
|
||||||
string.p[0] = length
|
|
||||||
memcpy(&string.p[1], chars, length)
|
|
||||||
return string
|
|
||||||
else:
|
|
||||||
i = 0
|
|
||||||
n_length_bytes = (length // 255) + 1
|
|
||||||
string.p = <unsigned char*>mem.alloc(length + n_length_bytes, sizeof(unsigned char))
|
|
||||||
for i in range(n_length_bytes-1):
|
|
||||||
string.p[i] = 255
|
|
||||||
string.p[n_length_bytes-1] = length % 255
|
|
||||||
memcpy(&string.p[n_length_bytes], chars, length)
|
|
||||||
return string
|
|
||||||
|
|
||||||
|
|
||||||
cdef class StringStore:
|
cdef class StringStore:
|
||||||
"""Look up strings by 64-bit hashes.
|
"""Look up strings by 64-bit hashes. Implicitly handles reserved symbols.
|
||||||
|
|
||||||
DOCS: https://spacy.io/api/stringstore
|
DOCS: https://spacy.io/api/stringstore
|
||||||
"""
|
"""
|
||||||
def __init__(self, strings=None, freeze=False):
|
def __init__(self, strings: Optional[Iterable[str]] = None):
|
||||||
"""Create the StringStore.
|
"""Create the StringStore.
|
||||||
|
|
||||||
strings (iterable): A sequence of unicode strings to add to the store.
|
strings (iterable): A sequence of unicode strings to add to the store.
|
||||||
|
@ -123,127 +32,126 @@ cdef class StringStore:
|
||||||
for string in strings:
|
for string in strings:
|
||||||
self.add(string)
|
self.add(string)
|
||||||
|
|
||||||
def __getitem__(self, object string_or_id):
|
def __getitem__(self, string_or_hash: Union[str, int]) -> Union[str, int]:
|
||||||
"""Retrieve a string from a given hash, or vice versa.
|
"""Retrieve a string from a given hash. If a string
|
||||||
|
is passed as the input, add it to the store and return
|
||||||
|
its hash.
|
||||||
|
|
||||||
string_or_id (bytes, str or uint64): The value to encode.
|
string_or_hash (int / str): The hash value to lookup or the string to store.
|
||||||
Returns (str / uint64): The value to be retrieved.
|
RETURNS (str / int): The stored string or the hash of the newly added string.
|
||||||
"""
|
"""
|
||||||
cdef hash_t str_hash
|
if isinstance(string_or_hash, str):
|
||||||
cdef Utf8Str* utf8str = NULL
|
return self.add(string_or_hash)
|
||||||
|
|
||||||
if isinstance(string_or_id, str):
|
|
||||||
if len(string_or_id) == 0:
|
|
||||||
return 0
|
|
||||||
|
|
||||||
# Return early if the string is found in the symbols LUT.
|
|
||||||
symbol = SYMBOLS_BY_STR.get(string_or_id, None)
|
|
||||||
if symbol is not None:
|
|
||||||
return symbol
|
|
||||||
else:
|
|
||||||
return hash_string(string_or_id)
|
|
||||||
elif isinstance(string_or_id, bytes):
|
|
||||||
return hash_utf8(string_or_id, len(string_or_id))
|
|
||||||
elif _try_coerce_to_hash(string_or_id, &str_hash):
|
|
||||||
if str_hash == 0:
|
|
||||||
return ""
|
|
||||||
elif str_hash < len(SYMBOLS_BY_INT):
|
|
||||||
return SYMBOLS_BY_INT[str_hash]
|
|
||||||
else:
|
|
||||||
utf8str = <Utf8Str*>self._map.get(str_hash)
|
|
||||||
else:
|
else:
|
||||||
# TODO: Raise an error instead
|
return self._get_interned_str(string_or_hash)
|
||||||
utf8str = <Utf8Str*>self._map.get(string_or_id)
|
|
||||||
|
|
||||||
if utf8str is NULL:
|
def __contains__(self, string_or_hash: Union[str, int]) -> bool:
|
||||||
raise KeyError(Errors.E018.format(hash_value=string_or_id))
|
"""Check whether a string or a hash is in the store.
|
||||||
|
|
||||||
|
string (str / int): The string/hash to check.
|
||||||
|
RETURNS (bool): Whether the store contains the string.
|
||||||
|
"""
|
||||||
|
cdef hash_t str_hash = get_string_id(string_or_hash)
|
||||||
|
if str_hash in SYMBOLS_BY_INT:
|
||||||
|
return True
|
||||||
else:
|
else:
|
||||||
return decode_Utf8Str(utf8str)
|
return self._map.get(str_hash) is not NULL
|
||||||
|
|
||||||
def as_int(self, key):
|
def __iter__(self) -> Iterator[str]:
|
||||||
"""If key is an int, return it; otherwise, get the int value."""
|
"""Iterate over the strings in the store in insertion order.
|
||||||
if not isinstance(key, str):
|
|
||||||
return key
|
|
||||||
else:
|
|
||||||
return self[key]
|
|
||||||
|
|
||||||
def as_string(self, key):
|
RETURNS: An iterable collection of strings.
|
||||||
"""If key is a string, return it; otherwise, get the string value."""
|
"""
|
||||||
if isinstance(key, str):
|
return iter(self.keys())
|
||||||
return key
|
|
||||||
else:
|
|
||||||
return self[key]
|
|
||||||
|
|
||||||
def add(self, string):
|
def __reduce__(self):
|
||||||
|
strings = list(self)
|
||||||
|
return (StringStore, (strings,), None, None, None)
|
||||||
|
|
||||||
|
def __len__(self) -> int:
|
||||||
|
"""The number of strings in the store.
|
||||||
|
|
||||||
|
RETURNS (int): The number of strings in the store.
|
||||||
|
"""
|
||||||
|
return self._keys.size()
|
||||||
|
|
||||||
|
def add(self, string: str) -> int:
|
||||||
"""Add a string to the StringStore.
|
"""Add a string to the StringStore.
|
||||||
|
|
||||||
string (str): The string to add.
|
string (str): The string to add.
|
||||||
RETURNS (uint64): The string's hash value.
|
RETURNS (uint64): The string's hash value.
|
||||||
"""
|
"""
|
||||||
cdef hash_t str_hash
|
if not isinstance(string, str):
|
||||||
if isinstance(string, str):
|
|
||||||
if string in SYMBOLS_BY_STR:
|
|
||||||
return SYMBOLS_BY_STR[string]
|
|
||||||
|
|
||||||
string = string.encode("utf8")
|
|
||||||
str_hash = hash_utf8(string, len(string))
|
|
||||||
self._intern_utf8(string, len(string), &str_hash)
|
|
||||||
elif isinstance(string, bytes):
|
|
||||||
if string in SYMBOLS_BY_STR:
|
|
||||||
return SYMBOLS_BY_STR[string]
|
|
||||||
str_hash = hash_utf8(string, len(string))
|
|
||||||
self._intern_utf8(string, len(string), &str_hash)
|
|
||||||
else:
|
|
||||||
raise TypeError(Errors.E017.format(value_type=type(string)))
|
raise TypeError(Errors.E017.format(value_type=type(string)))
|
||||||
return str_hash
|
|
||||||
|
|
||||||
def __len__(self):
|
if string in SYMBOLS_BY_STR:
|
||||||
"""The number of strings in the store.
|
return SYMBOLS_BY_STR[string]
|
||||||
|
|
||||||
RETURNS (int): The number of strings in the store.
|
|
||||||
"""
|
|
||||||
return self.keys.size()
|
|
||||||
|
|
||||||
def __contains__(self, string_or_id not None):
|
|
||||||
"""Check whether a string or ID is in the store.
|
|
||||||
|
|
||||||
string_or_id (str or int): The string to check.
|
|
||||||
RETURNS (bool): Whether the store contains the string.
|
|
||||||
"""
|
|
||||||
cdef hash_t str_hash
|
|
||||||
if isinstance(string_or_id, str):
|
|
||||||
if len(string_or_id) == 0:
|
|
||||||
return True
|
|
||||||
elif string_or_id in SYMBOLS_BY_STR:
|
|
||||||
return True
|
|
||||||
str_hash = hash_string(string_or_id)
|
|
||||||
elif _try_coerce_to_hash(string_or_id, &str_hash):
|
|
||||||
pass
|
|
||||||
else:
|
else:
|
||||||
# TODO: Raise an error instead
|
return self._intern_str(string)
|
||||||
return self._map.get(string_or_id) is not NULL
|
|
||||||
|
|
||||||
if str_hash < len(SYMBOLS_BY_INT):
|
def as_int(self, string_or_hash: Union[str, int]) -> str:
|
||||||
return True
|
"""If a hash value is passed as the input, return it as-is. If the input
|
||||||
|
is a string, return its corresponding hash.
|
||||||
|
|
||||||
|
string_or_hash (str / int): The string to hash or a hash value.
|
||||||
|
RETURNS (int): The hash of the string or the input hash value.
|
||||||
|
"""
|
||||||
|
if isinstance(string_or_hash, int):
|
||||||
|
return string_or_hash
|
||||||
else:
|
else:
|
||||||
return self._map.get(str_hash) is not NULL
|
return get_string_id(string_or_hash)
|
||||||
|
|
||||||
def __iter__(self):
|
def as_string(self, string_or_hash: Union[str, int]) -> str:
|
||||||
"""Iterate over the strings in the store, in order.
|
"""If a string is passed as the input, return it as-is. If the input
|
||||||
|
is a hash value, return its corresponding string.
|
||||||
|
|
||||||
YIELDS (str): A string in the store.
|
string_or_hash (str / int): The hash value to lookup or a string.
|
||||||
|
RETURNS (str): The stored string or the input string.
|
||||||
|
"""
|
||||||
|
if isinstance(string_or_hash, str):
|
||||||
|
return string_or_hash
|
||||||
|
else:
|
||||||
|
return self._get_interned_str(string_or_hash)
|
||||||
|
|
||||||
|
def items(self) -> List[Tuple[str, int]]:
|
||||||
|
"""Iterate over the stored strings and their hashes in insertion order.
|
||||||
|
|
||||||
|
RETURNS: A list of string-hash pairs.
|
||||||
|
"""
|
||||||
|
# Even though we internally store the hashes as keys and the strings as
|
||||||
|
# values, we invert the order in the public API to keep it consistent with
|
||||||
|
# the implementation of the `__iter__` method (where we wish to iterate over
|
||||||
|
# the strings in the store).
|
||||||
|
cdef int i
|
||||||
|
pairs = [None] * self._keys.size()
|
||||||
|
for i in range(self._keys.size()):
|
||||||
|
str_hash = self._keys[i]
|
||||||
|
utf8str = <Utf8Str*>self._map.get(str_hash)
|
||||||
|
pairs[i] = (self._decode_str_repr(utf8str), str_hash)
|
||||||
|
return pairs
|
||||||
|
|
||||||
|
def keys(self) -> List[str]:
|
||||||
|
"""Iterate over the stored strings in insertion order.
|
||||||
|
|
||||||
|
RETURNS: A list of strings.
|
||||||
"""
|
"""
|
||||||
cdef int i
|
cdef int i
|
||||||
cdef hash_t key
|
strings = [None] * self._keys.size()
|
||||||
for i in range(self.keys.size()):
|
for i in range(self._keys.size()):
|
||||||
key = self.keys[i]
|
utf8str = <Utf8Str*>self._map.get(self._keys[i])
|
||||||
utf8str = <Utf8Str*>self._map.get(key)
|
strings[i] = self._decode_str_repr(utf8str)
|
||||||
yield decode_Utf8Str(utf8str)
|
return strings
|
||||||
# TODO: Iterate OOV here?
|
|
||||||
|
|
||||||
def __reduce__(self):
|
def values(self) -> List[int]:
|
||||||
strings = list(self)
|
"""Iterate over the stored strings hashes in insertion order.
|
||||||
return (StringStore, (strings,), None, None, None)
|
|
||||||
|
RETURNS: A list of string hashs.
|
||||||
|
"""
|
||||||
|
cdef int i
|
||||||
|
hashes = [None] * self._keys.size()
|
||||||
|
for i in range(self._keys.size()):
|
||||||
|
hashes[i] = self._keys[i]
|
||||||
|
return hashes
|
||||||
|
|
||||||
def to_disk(self, path):
|
def to_disk(self, path):
|
||||||
"""Save the current state to a directory.
|
"""Save the current state to a directory.
|
||||||
|
@ -294,24 +202,122 @@ cdef class StringStore:
|
||||||
def _reset_and_load(self, strings):
|
def _reset_and_load(self, strings):
|
||||||
self.mem = Pool()
|
self.mem = Pool()
|
||||||
self._map = PreshMap()
|
self._map = PreshMap()
|
||||||
self.keys.clear()
|
self._keys.clear()
|
||||||
for string in strings:
|
for string in strings:
|
||||||
self.add(string)
|
self.add(string)
|
||||||
|
|
||||||
cdef const Utf8Str* intern_unicode(self, str py_string):
|
def _get_interned_str(self, hash_value: int) -> str:
|
||||||
# 0 means missing, but we don't bother offsetting the index.
|
cdef hash_t str_hash
|
||||||
cdef bytes byte_string = py_string.encode("utf8")
|
if not _try_coerce_to_hash(hash_value, &str_hash):
|
||||||
return self._intern_utf8(byte_string, len(byte_string), NULL)
|
raise TypeError(Errors.E4001.format(expected_types="'int'", received_type=type(hash_value)))
|
||||||
|
|
||||||
@cython.final
|
# Handle reserved symbols and empty strings correctly.
|
||||||
cdef const Utf8Str* _intern_utf8(self, char* utf8_string, int length, hash_t* precalculated_hash):
|
if str_hash == 0:
|
||||||
|
return ""
|
||||||
|
|
||||||
|
symbol = SYMBOLS_BY_INT.get(str_hash)
|
||||||
|
if symbol is not None:
|
||||||
|
return symbol
|
||||||
|
|
||||||
|
utf8str = <Utf8Str*>self._map.get(str_hash)
|
||||||
|
if utf8str is NULL:
|
||||||
|
raise KeyError(Errors.E018.format(hash_value=str_hash))
|
||||||
|
else:
|
||||||
|
return self._decode_str_repr(utf8str)
|
||||||
|
|
||||||
|
cdef hash_t _intern_str(self, str string):
|
||||||
# TODO: This function's API/behaviour is an unholy mess...
|
# TODO: This function's API/behaviour is an unholy mess...
|
||||||
# 0 means missing, but we don't bother offsetting the index.
|
# 0 means missing, but we don't bother offsetting the index.
|
||||||
cdef hash_t key = precalculated_hash[0] if precalculated_hash is not NULL else hash_utf8(utf8_string, length)
|
chars = string.encode('utf-8')
|
||||||
|
cdef hash_t key = hash64(<unsigned char*>chars, len(chars), 1)
|
||||||
cdef Utf8Str* value = <Utf8Str*>self._map.get(key)
|
cdef Utf8Str* value = <Utf8Str*>self._map.get(key)
|
||||||
if value is not NULL:
|
if value is not NULL:
|
||||||
return value
|
return key
|
||||||
value = _allocate(self.mem, <unsigned char*>utf8_string, length)
|
|
||||||
|
value = self._allocate_str_repr(<unsigned char*>chars, len(chars))
|
||||||
self._map.set(key, value)
|
self._map.set(key, value)
|
||||||
self.keys.push_back(key)
|
self._keys.push_back(key)
|
||||||
return value
|
return key
|
||||||
|
|
||||||
|
cdef Utf8Str* _allocate_str_repr(self, const unsigned char* chars, uint32_t length) except *:
|
||||||
|
cdef int n_length_bytes
|
||||||
|
cdef int i
|
||||||
|
cdef Utf8Str* string = <Utf8Str*>self.mem.alloc(1, sizeof(Utf8Str))
|
||||||
|
cdef uint32_t ulength = length
|
||||||
|
if length < sizeof(string.s):
|
||||||
|
string.s[0] = <unsigned char>length
|
||||||
|
memcpy(&string.s[1], chars, length)
|
||||||
|
return string
|
||||||
|
elif length < 255:
|
||||||
|
string.p = <unsigned char*>self.mem.alloc(length + 1, sizeof(unsigned char))
|
||||||
|
string.p[0] = length
|
||||||
|
memcpy(&string.p[1], chars, length)
|
||||||
|
return string
|
||||||
|
else:
|
||||||
|
i = 0
|
||||||
|
n_length_bytes = (length // 255) + 1
|
||||||
|
string.p = <unsigned char*>self.mem.alloc(length + n_length_bytes, sizeof(unsigned char))
|
||||||
|
for i in range(n_length_bytes-1):
|
||||||
|
string.p[i] = 255
|
||||||
|
string.p[n_length_bytes-1] = length % 255
|
||||||
|
memcpy(&string.p[n_length_bytes], chars, length)
|
||||||
|
return string
|
||||||
|
|
||||||
|
cdef str _decode_str_repr(self, const Utf8Str* string):
|
||||||
|
cdef int i, length
|
||||||
|
if string.s[0] < sizeof(string.s) and string.s[0] != 0:
|
||||||
|
return string.s[1:string.s[0]+1].decode('utf-8')
|
||||||
|
elif string.p[0] < 255:
|
||||||
|
return string.p[1:string.p[0]+1].decode('utf-8')
|
||||||
|
else:
|
||||||
|
i = 0
|
||||||
|
length = 0
|
||||||
|
while string.p[i] == 255:
|
||||||
|
i += 1
|
||||||
|
length += 255
|
||||||
|
length += string.p[i]
|
||||||
|
i += 1
|
||||||
|
return string.p[i:length + i].decode('utf-8')
|
||||||
|
|
||||||
|
|
||||||
|
cpdef hash_t hash_string(object string) except -1:
|
||||||
|
if not isinstance(string, str):
|
||||||
|
raise TypeError(Errors.E4001.format(expected_types="'str'", received_type=type(string)))
|
||||||
|
|
||||||
|
# Handle reserved symbols and empty strings correctly.
|
||||||
|
if len(string) == 0:
|
||||||
|
return 0
|
||||||
|
|
||||||
|
symbol = SYMBOLS_BY_STR.get(string)
|
||||||
|
if symbol is not None:
|
||||||
|
return symbol
|
||||||
|
|
||||||
|
chars = string.encode('utf-8')
|
||||||
|
return hash64(<unsigned char*>chars, len(chars), 1)
|
||||||
|
|
||||||
|
|
||||||
|
cpdef hash_t get_string_id(object string_or_hash) except -1:
|
||||||
|
cdef hash_t str_hash
|
||||||
|
|
||||||
|
try:
|
||||||
|
return hash_string(string_or_hash)
|
||||||
|
except:
|
||||||
|
if _try_coerce_to_hash(string_or_hash, &str_hash):
|
||||||
|
# Coerce the integral key to the expected primitive hash type.
|
||||||
|
# This ensures that custom/overloaded "primitive" data types
|
||||||
|
# such as those implemented by numpy are not inadvertently used
|
||||||
|
# downsteam (as these are internally implemented as custom PyObjects
|
||||||
|
# whose comparison operators can incur a significant overhead).
|
||||||
|
return str_hash
|
||||||
|
else:
|
||||||
|
raise TypeError(Errors.E4001.format(expected_types="'str','int'", received_type=type(string_or_hash)))
|
||||||
|
|
||||||
|
|
||||||
|
# Not particularly elegant, but this is faster than `isinstance(key, numbers.Integral)`
|
||||||
|
cdef inline bint _try_coerce_to_hash(object key, hash_t* out_hash):
|
||||||
|
try:
|
||||||
|
out_hash[0] = key
|
||||||
|
return True
|
||||||
|
except:
|
||||||
|
return False
|
||||||
|
|
||||||
|
|
|
@ -1,5 +1,6 @@
|
||||||
|
# DO NOT EDIT! The symbols are frozen as of spaCy v3.0.0.
|
||||||
cdef enum symbol_t:
|
cdef enum symbol_t:
|
||||||
NIL
|
NIL = 0
|
||||||
IS_ALPHA
|
IS_ALPHA
|
||||||
IS_ASCII
|
IS_ASCII
|
||||||
IS_DIGIT
|
IS_DIGIT
|
||||||
|
@ -65,7 +66,7 @@ cdef enum symbol_t:
|
||||||
FLAG62
|
FLAG62
|
||||||
FLAG63
|
FLAG63
|
||||||
|
|
||||||
ID
|
ID = 64
|
||||||
ORTH
|
ORTH
|
||||||
LOWER
|
LOWER
|
||||||
NORM
|
NORM
|
||||||
|
@ -385,7 +386,7 @@ cdef enum symbol_t:
|
||||||
DEPRECATED275
|
DEPRECATED275
|
||||||
DEPRECATED276
|
DEPRECATED276
|
||||||
|
|
||||||
PERSON
|
PERSON = 380
|
||||||
NORP
|
NORP
|
||||||
FACILITY
|
FACILITY
|
||||||
ORG
|
ORG
|
||||||
|
@ -405,7 +406,7 @@ cdef enum symbol_t:
|
||||||
ORDINAL
|
ORDINAL
|
||||||
CARDINAL
|
CARDINAL
|
||||||
|
|
||||||
acomp
|
acomp = 398
|
||||||
advcl
|
advcl
|
||||||
advmod
|
advmod
|
||||||
agent
|
agent
|
||||||
|
@ -458,12 +459,12 @@ cdef enum symbol_t:
|
||||||
rcmod
|
rcmod
|
||||||
root
|
root
|
||||||
xcomp
|
xcomp
|
||||||
|
|
||||||
acl
|
acl
|
||||||
|
|
||||||
ENT_KB_ID
|
ENT_KB_ID = 452
|
||||||
MORPH
|
MORPH
|
||||||
ENT_ID
|
ENT_ID
|
||||||
|
|
||||||
IDX
|
IDX
|
||||||
_
|
_ = 456
|
||||||
|
# DO NOT ADD ANY NEW SYMBOLS!
|
||||||
|
|
|
@ -469,11 +469,7 @@ IDS = {
|
||||||
}
|
}
|
||||||
|
|
||||||
|
|
||||||
def sort_nums(x):
|
NAMES = {v: k for k, v in IDS.items()}
|
||||||
return x[1]
|
|
||||||
|
|
||||||
|
|
||||||
NAMES = [it[0] for it in sorted(IDS.items(), key=sort_nums)]
|
|
||||||
# Unfortunate hack here, to work around problem with long cpdef enum
|
# Unfortunate hack here, to work around problem with long cpdef enum
|
||||||
# (which is generating an enormous amount of C++ in Cython 0.24+)
|
# (which is generating an enormous amount of C++ in Cython 0.24+)
|
||||||
# We keep the enum cdef, and just make sure the names are available to Python
|
# We keep the enum cdef, and just make sure the names are available to Python
|
||||||
|
|
|
@ -256,6 +256,11 @@ def ko_tokenizer_tokenizer():
|
||||||
return nlp.tokenizer
|
return nlp.tokenizer
|
||||||
|
|
||||||
|
|
||||||
|
@pytest.fixture(scope="module")
|
||||||
|
def la_tokenizer():
|
||||||
|
return get_lang_class("la")().tokenizer
|
||||||
|
|
||||||
|
|
||||||
@pytest.fixture(scope="session")
|
@pytest.fixture(scope="session")
|
||||||
def ko_tokenizer_natto():
|
def ko_tokenizer_natto():
|
||||||
pytest.importorskip("natto")
|
pytest.importorskip("natto")
|
||||||
|
@ -352,6 +357,14 @@ def ru_lemmatizer():
|
||||||
return get_lang_class("ru")().add_pipe("lemmatizer")
|
return get_lang_class("ru")().add_pipe("lemmatizer")
|
||||||
|
|
||||||
|
|
||||||
|
@pytest.fixture
|
||||||
|
def ru_lookup_lemmatizer():
|
||||||
|
pytest.importorskip("pymorphy2")
|
||||||
|
return get_lang_class("ru")().add_pipe(
|
||||||
|
"lemmatizer", config={"mode": "pymorphy2_lookup"}
|
||||||
|
)
|
||||||
|
|
||||||
|
|
||||||
@pytest.fixture(scope="session")
|
@pytest.fixture(scope="session")
|
||||||
def sa_tokenizer():
|
def sa_tokenizer():
|
||||||
return get_lang_class("sa")().tokenizer
|
return get_lang_class("sa")().tokenizer
|
||||||
|
@ -431,6 +444,15 @@ def uk_lemmatizer():
|
||||||
return get_lang_class("uk")().add_pipe("lemmatizer")
|
return get_lang_class("uk")().add_pipe("lemmatizer")
|
||||||
|
|
||||||
|
|
||||||
|
@pytest.fixture
|
||||||
|
def uk_lookup_lemmatizer():
|
||||||
|
pytest.importorskip("pymorphy2")
|
||||||
|
pytest.importorskip("pymorphy2_dicts_uk")
|
||||||
|
return get_lang_class("uk")().add_pipe(
|
||||||
|
"lemmatizer", config={"mode": "pymorphy2_lookup"}
|
||||||
|
)
|
||||||
|
|
||||||
|
|
||||||
@pytest.fixture(scope="session")
|
@pytest.fixture(scope="session")
|
||||||
def ur_tokenizer():
|
def ur_tokenizer():
|
||||||
return get_lang_class("ur")().tokenizer
|
return get_lang_class("ur")().tokenizer
|
||||||
|
|
|
@ -82,6 +82,21 @@ def test_issue2396(en_vocab):
|
||||||
assert (span.get_lca_matrix() == matrix).all()
|
assert (span.get_lca_matrix() == matrix).all()
|
||||||
|
|
||||||
|
|
||||||
|
@pytest.mark.issue(11499)
|
||||||
|
def test_init_args_unmodified(en_vocab):
|
||||||
|
words = ["A", "sentence"]
|
||||||
|
ents = ["B-TYPE1", ""]
|
||||||
|
sent_starts = [True, False]
|
||||||
|
Doc(
|
||||||
|
vocab=en_vocab,
|
||||||
|
words=words,
|
||||||
|
ents=ents,
|
||||||
|
sent_starts=sent_starts,
|
||||||
|
)
|
||||||
|
assert ents == ["B-TYPE1", ""]
|
||||||
|
assert sent_starts == [True, False]
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("text", ["-0.23", "+123,456", "±1"])
|
@pytest.mark.parametrize("text", ["-0.23", "+123,456", "±1"])
|
||||||
@pytest.mark.parametrize("lang_cls", [English, MultiLanguage])
|
@pytest.mark.parametrize("lang_cls", [English, MultiLanguage])
|
||||||
@pytest.mark.issue(2782)
|
@pytest.mark.issue(2782)
|
||||||
|
|
|
@ -128,7 +128,9 @@ def test_doc_to_json_with_token_span_attributes(doc):
|
||||||
doc._.json_test1 = "hello world"
|
doc._.json_test1 = "hello world"
|
||||||
doc._.json_test2 = [1, 2, 3]
|
doc._.json_test2 = [1, 2, 3]
|
||||||
doc[0:1]._.span_test = "span_attribute"
|
doc[0:1]._.span_test = "span_attribute"
|
||||||
|
doc[0:2]._.span_test = "span_attribute_2"
|
||||||
doc[0]._.token_test = 117
|
doc[0]._.token_test = 117
|
||||||
|
doc[1]._.token_test = 118
|
||||||
doc.spans["span_group"] = [doc[0:1]]
|
doc.spans["span_group"] = [doc[0:1]]
|
||||||
json_doc = doc.to_json(
|
json_doc = doc.to_json(
|
||||||
underscore=["json_test1", "json_test2", "token_test", "span_test"]
|
underscore=["json_test1", "json_test2", "token_test", "span_test"]
|
||||||
|
@ -139,8 +141,10 @@ def test_doc_to_json_with_token_span_attributes(doc):
|
||||||
assert json_doc["_"]["json_test2"] == [1, 2, 3]
|
assert json_doc["_"]["json_test2"] == [1, 2, 3]
|
||||||
assert "underscore_token" in json_doc
|
assert "underscore_token" in json_doc
|
||||||
assert "underscore_span" in json_doc
|
assert "underscore_span" in json_doc
|
||||||
assert json_doc["underscore_token"]["token_test"]["value"] == 117
|
assert json_doc["underscore_token"]["token_test"][0]["value"] == 117
|
||||||
assert json_doc["underscore_span"]["span_test"]["value"] == "span_attribute"
|
assert json_doc["underscore_token"]["token_test"][1]["value"] == 118
|
||||||
|
assert json_doc["underscore_span"]["span_test"][0]["value"] == "span_attribute"
|
||||||
|
assert json_doc["underscore_span"]["span_test"][1]["value"] == "span_attribute_2"
|
||||||
assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
|
assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
|
||||||
assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc
|
assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc
|
||||||
|
|
||||||
|
@ -161,8 +165,8 @@ def test_doc_to_json_with_custom_user_data(doc):
|
||||||
assert json_doc["_"]["json_test"] == "hello world"
|
assert json_doc["_"]["json_test"] == "hello world"
|
||||||
assert "underscore_token" in json_doc
|
assert "underscore_token" in json_doc
|
||||||
assert "underscore_span" in json_doc
|
assert "underscore_span" in json_doc
|
||||||
assert json_doc["underscore_token"]["token_test"]["value"] == 117
|
assert json_doc["underscore_token"]["token_test"][0]["value"] == 117
|
||||||
assert json_doc["underscore_span"]["span_test"]["value"] == "span_attribute"
|
assert json_doc["underscore_span"]["span_test"][0]["value"] == "span_attribute"
|
||||||
assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
|
assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
|
||||||
assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc
|
assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc
|
||||||
|
|
||||||
|
@ -181,8 +185,8 @@ def test_doc_to_json_with_token_span_same_identifier(doc):
|
||||||
assert json_doc["_"]["my_ext"] == "hello world"
|
assert json_doc["_"]["my_ext"] == "hello world"
|
||||||
assert "underscore_token" in json_doc
|
assert "underscore_token" in json_doc
|
||||||
assert "underscore_span" in json_doc
|
assert "underscore_span" in json_doc
|
||||||
assert json_doc["underscore_token"]["my_ext"]["value"] == 117
|
assert json_doc["underscore_token"]["my_ext"][0]["value"] == 117
|
||||||
assert json_doc["underscore_span"]["my_ext"]["value"] == "span_attribute"
|
assert json_doc["underscore_span"]["my_ext"][0]["value"] == "span_attribute"
|
||||||
assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
|
assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
|
||||||
assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc
|
assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc
|
||||||
|
|
||||||
|
@ -195,10 +199,9 @@ def test_doc_to_json_with_token_attributes_missing(doc):
|
||||||
doc[0]._.token_test = 117
|
doc[0]._.token_test = 117
|
||||||
json_doc = doc.to_json(underscore=["span_test"])
|
json_doc = doc.to_json(underscore=["span_test"])
|
||||||
|
|
||||||
assert "underscore_token" in json_doc
|
|
||||||
assert "underscore_span" in json_doc
|
assert "underscore_span" in json_doc
|
||||||
assert json_doc["underscore_span"]["span_test"]["value"] == "span_attribute"
|
assert json_doc["underscore_span"]["span_test"][0]["value"] == "span_attribute"
|
||||||
assert "token_test" not in json_doc["underscore_token"]
|
assert "underscore_token" not in json_doc
|
||||||
assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
|
assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
|
||||||
|
|
||||||
|
|
||||||
|
@ -283,7 +286,9 @@ def test_json_to_doc_with_token_span_attributes(doc):
|
||||||
doc._.json_test1 = "hello world"
|
doc._.json_test1 = "hello world"
|
||||||
doc._.json_test2 = [1, 2, 3]
|
doc._.json_test2 = [1, 2, 3]
|
||||||
doc[0:1]._.span_test = "span_attribute"
|
doc[0:1]._.span_test = "span_attribute"
|
||||||
|
doc[0:2]._.span_test = "span_attribute_2"
|
||||||
doc[0]._.token_test = 117
|
doc[0]._.token_test = 117
|
||||||
|
doc[1]._.token_test = 118
|
||||||
|
|
||||||
json_doc = doc.to_json(
|
json_doc = doc.to_json(
|
||||||
underscore=["json_test1", "json_test2", "token_test", "span_test"]
|
underscore=["json_test1", "json_test2", "token_test", "span_test"]
|
||||||
|
@ -295,7 +300,9 @@ def test_json_to_doc_with_token_span_attributes(doc):
|
||||||
assert new_doc._.json_test1 == "hello world"
|
assert new_doc._.json_test1 == "hello world"
|
||||||
assert new_doc._.json_test2 == [1, 2, 3]
|
assert new_doc._.json_test2 == [1, 2, 3]
|
||||||
assert new_doc[0]._.token_test == 117
|
assert new_doc[0]._.token_test == 117
|
||||||
|
assert new_doc[1]._.token_test == 118
|
||||||
assert new_doc[0:1]._.span_test == "span_attribute"
|
assert new_doc[0:1]._.span_test == "span_attribute"
|
||||||
|
assert new_doc[0:2]._.span_test == "span_attribute_2"
|
||||||
assert new_doc.user_data == doc.user_data
|
assert new_doc.user_data == doc.user_data
|
||||||
assert new_doc.to_bytes(exclude=["user_data"]) == doc.to_bytes(
|
assert new_doc.to_bytes(exclude=["user_data"]) == doc.to_bytes(
|
||||||
exclude=["user_data"]
|
exclude=["user_data"]
|
||||||
|
|
18
spacy/tests/lang/grc/test_tokenizer.py
Normal file
18
spacy/tests/lang/grc/test_tokenizer.py
Normal file
|
@ -0,0 +1,18 @@
|
||||||
|
import pytest
|
||||||
|
|
||||||
|
|
||||||
|
# fmt: off
|
||||||
|
GRC_TOKEN_EXCEPTION_TESTS = [
|
||||||
|
("τὸ 〈τῆς〉 φιλοσοφίας ἔργον ἔνιοί φασιν ἀπὸ ⟦βαρβάρων⟧ ἄρξαι.", ["τὸ", "〈", "τῆς", "〉", "φιλοσοφίας", "ἔργον", "ἔνιοί", "φασιν", "ἀπὸ", "⟦", "βαρβάρων", "⟧", "ἄρξαι", "."]),
|
||||||
|
("τὴν δὲ τῶν Αἰγυπτίων φιλοσοφίαν εἶναι τοιαύτην περί τε †θεῶν† καὶ ὑπὲρ δικαιοσύνης.", ["τὴν", "δὲ", "τῶν", "Αἰγυπτίων", "φιλοσοφίαν", "εἶναι", "τοιαύτην", "περί", "τε", "†", "θεῶν", "†", "καὶ", "ὑπὲρ", "δικαιοσύνης", "."]),
|
||||||
|
("⸏πόσις δ' Ἐρεχθεύς ἐστί μοι σεσωσμένος⸏", ["⸏", "πόσις", "δ'", "Ἐρεχθεύς", "ἐστί", "μοι", "σεσωσμένος", "⸏"]),
|
||||||
|
("⸏ὔπνον ἴδωμεν⸎", ["⸏", "ὔπνον", "ἴδωμεν", "⸎"]),
|
||||||
|
]
|
||||||
|
# fmt: on
|
||||||
|
|
||||||
|
|
||||||
|
@pytest.mark.parametrize("text,expected_tokens", GRC_TOKEN_EXCEPTION_TESTS)
|
||||||
|
def test_grc_tokenizer(grc_tokenizer, text, expected_tokens):
|
||||||
|
tokens = grc_tokenizer(text)
|
||||||
|
token_list = [token.text for token in tokens if not token.is_space]
|
||||||
|
assert expected_tokens == token_list
|
0
spacy/tests/lang/la/__init__.py
Normal file
0
spacy/tests/lang/la/__init__.py
Normal file
8
spacy/tests/lang/la/test_exception.py
Normal file
8
spacy/tests/lang/la/test_exception.py
Normal file
|
@ -0,0 +1,8 @@
|
||||||
|
import pytest
|
||||||
|
|
||||||
|
|
||||||
|
def test_la_tokenizer_handles_exc_in_text(la_tokenizer):
|
||||||
|
text = "scio te omnia facturum, ut nobiscum quam primum sis"
|
||||||
|
tokens = la_tokenizer(text)
|
||||||
|
assert len(tokens) == 11
|
||||||
|
assert tokens[6].text == "nobis"
|
35
spacy/tests/lang/la/test_text.py
Normal file
35
spacy/tests/lang/la/test_text.py
Normal file
|
@ -0,0 +1,35 @@
|
||||||
|
import pytest
|
||||||
|
from spacy.lang.la.lex_attrs import like_num
|
||||||
|
|
||||||
|
|
||||||
|
@pytest.mark.parametrize(
|
||||||
|
"text,match",
|
||||||
|
[
|
||||||
|
("IIII", True),
|
||||||
|
("VI", True),
|
||||||
|
("vi", True),
|
||||||
|
("IV", True),
|
||||||
|
("iv", True),
|
||||||
|
("IX", True),
|
||||||
|
("ix", True),
|
||||||
|
("MMXXII", True),
|
||||||
|
("0", True),
|
||||||
|
("1", True),
|
||||||
|
("quattuor", True),
|
||||||
|
("decem", True),
|
||||||
|
("tertius", True),
|
||||||
|
("canis", False),
|
||||||
|
("MMXX11", False),
|
||||||
|
(",", False),
|
||||||
|
],
|
||||||
|
)
|
||||||
|
def test_lex_attrs_like_number(la_tokenizer, text, match):
|
||||||
|
tokens = la_tokenizer(text)
|
||||||
|
assert len(tokens) == 1
|
||||||
|
assert tokens[0].like_num == match
|
||||||
|
|
||||||
|
|
||||||
|
@pytest.mark.parametrize("word", ["quinque"])
|
||||||
|
def test_la_lex_attrs_capitals(word):
|
||||||
|
assert like_num(word)
|
||||||
|
assert like_num(word.upper())
|
|
@ -78,3 +78,17 @@ def test_ru_lemmatizer_punct(ru_lemmatizer):
|
||||||
assert ru_lemmatizer.pymorphy2_lemmatize(doc[0]) == ['"']
|
assert ru_lemmatizer.pymorphy2_lemmatize(doc[0]) == ['"']
|
||||||
doc = Doc(ru_lemmatizer.vocab, words=["»"], pos=["PUNCT"])
|
doc = Doc(ru_lemmatizer.vocab, words=["»"], pos=["PUNCT"])
|
||||||
assert ru_lemmatizer.pymorphy2_lemmatize(doc[0]) == ['"']
|
assert ru_lemmatizer.pymorphy2_lemmatize(doc[0]) == ['"']
|
||||||
|
|
||||||
|
|
||||||
|
def test_ru_doc_lookup_lemmatization(ru_lookup_lemmatizer):
|
||||||
|
words = ["мама", "мыла", "раму"]
|
||||||
|
pos = ["NOUN", "VERB", "NOUN"]
|
||||||
|
morphs = [
|
||||||
|
"Animacy=Anim|Case=Nom|Gender=Fem|Number=Sing",
|
||||||
|
"Aspect=Imp|Gender=Fem|Mood=Ind|Number=Sing|Tense=Past|VerbForm=Fin|Voice=Act",
|
||||||
|
"Animacy=Anim|Case=Acc|Gender=Fem|Number=Sing",
|
||||||
|
]
|
||||||
|
doc = Doc(ru_lookup_lemmatizer.vocab, words=words, pos=pos, morphs=morphs)
|
||||||
|
doc = ru_lookup_lemmatizer(doc)
|
||||||
|
lemmas = [token.lemma_ for token in doc]
|
||||||
|
assert lemmas == ["мама", "мыла", "раму"]
|
||||||
|
|
|
@ -9,3 +9,11 @@ def test_uk_lemmatizer(uk_lemmatizer):
|
||||||
"""Check that the default uk lemmatizer runs."""
|
"""Check that the default uk lemmatizer runs."""
|
||||||
doc = Doc(uk_lemmatizer.vocab, words=["a", "b", "c"])
|
doc = Doc(uk_lemmatizer.vocab, words=["a", "b", "c"])
|
||||||
uk_lemmatizer(doc)
|
uk_lemmatizer(doc)
|
||||||
|
assert [token.lemma for token in doc]
|
||||||
|
|
||||||
|
|
||||||
|
def test_uk_lookup_lemmatizer(uk_lookup_lemmatizer):
|
||||||
|
"""Check that the lookup uk lemmatizer runs."""
|
||||||
|
doc = Doc(uk_lookup_lemmatizer.vocab, words=["a", "b", "c"])
|
||||||
|
uk_lookup_lemmatizer(doc)
|
||||||
|
assert [token.lemma for token in doc]
|
||||||
|
|
44
spacy/tests/matcher/test_levenshtein.py
Normal file
44
spacy/tests/matcher/test_levenshtein.py
Normal file
|
@ -0,0 +1,44 @@
|
||||||
|
import pytest
|
||||||
|
from spacy.matcher import levenshtein
|
||||||
|
|
||||||
|
|
||||||
|
# empty string plus 10 random ASCII, 10 random unicode, and 2 random long tests
|
||||||
|
# from polyleven
|
||||||
|
@pytest.mark.parametrize(
|
||||||
|
"dist,a,b",
|
||||||
|
[
|
||||||
|
(0, "", ""),
|
||||||
|
(4, "bbcb", "caba"),
|
||||||
|
(3, "abcb", "cacc"),
|
||||||
|
(3, "aa", "ccc"),
|
||||||
|
(1, "cca", "ccac"),
|
||||||
|
(1, "aba", "aa"),
|
||||||
|
(4, "bcbb", "abac"),
|
||||||
|
(3, "acbc", "bba"),
|
||||||
|
(3, "cbba", "a"),
|
||||||
|
(2, "bcc", "ba"),
|
||||||
|
(4, "aaa", "ccbb"),
|
||||||
|
(3, "うあい", "いいうい"),
|
||||||
|
(2, "あううい", "うあい"),
|
||||||
|
(3, "いういい", "うううあ"),
|
||||||
|
(2, "うい", "あいあ"),
|
||||||
|
(2, "いあい", "いう"),
|
||||||
|
(1, "いい", "あいい"),
|
||||||
|
(3, "あうあ", "いいああ"),
|
||||||
|
(4, "いあうう", "ううああ"),
|
||||||
|
(3, "いあいい", "ういああ"),
|
||||||
|
(3, "いいああ", "ううあう"),
|
||||||
|
(
|
||||||
|
166,
|
||||||
|
"TCTGGGCACGGATTCGTCAGATTCCATGTCCATATTTGAGGCTCTTGCAGGCAAAATTTGGGCATGTGAACTCCTTATAGTCCCCGTGC",
|
||||||
|
"ATATGGATTGGGGGCATTCAAAGATACGGTTTCCCTTTCTTCAGTTTCGCGCGGCGCACGTCCGGGTGCGAGCCAGTTCGTCTTACTCACATTGTCGACTTCACGAATCGCGCATGATGTGCTTAGCCTGTACTTACGAACGAACTTTCGGTCCAAATACATTCTATCAACACCGAGGTATCCGTGCCACACGCCGAAGCTCGACCGTGTTCGTTGAGAGGTGGAAATGGTAAAAGATGAACATAGTC",
|
||||||
|
),
|
||||||
|
(
|
||||||
|
111,
|
||||||
|
"GGTTCGGCCGAATTCATAGAGCGTGGTAGTCGACGGTATCCCGCCTGGTAGGGGCCCCTTCTACCTAGCGGAAGTTTGTCAGTACTCTATAACACGAGGGCCTCTCACACCCTAGATCGTCCAGCCACTCGAAGATCGCAGCACCCTTACAGAAAGGCATTAATGTTTCTCCTAGCACTTGTGCAATGGTGAAGGAGTGATG",
|
||||||
|
"CGTAACACTTCGCGCTACTGGGCTGCAACGTCTTGGGCATACATGCAAGATTATCTAATGCAAGCTTGAGCCCCGCTTGCGGAATTTCCCTAATCGGGGTCCCTTCCTGTTACGATAAGGACGCGTGCACT",
|
||||||
|
),
|
||||||
|
],
|
||||||
|
)
|
||||||
|
def test_levenshtein(dist, a, b):
|
||||||
|
assert levenshtein(a, b) == dist
|
|
@ -368,6 +368,16 @@ def test_matcher_intersect_value_operator(en_vocab):
|
||||||
doc[0]._.ext = ["A", "B"]
|
doc[0]._.ext = ["A", "B"]
|
||||||
assert len(matcher(doc)) == 1
|
assert len(matcher(doc)) == 1
|
||||||
|
|
||||||
|
# INTERSECTS matches nothing for iterables that aren't all str or int
|
||||||
|
matcher = Matcher(en_vocab)
|
||||||
|
pattern = [{"_": {"ext": {"INTERSECTS": ["Abx", "C"]}}}]
|
||||||
|
matcher.add("M", [pattern])
|
||||||
|
doc = Doc(en_vocab, words=["a", "b", "c"])
|
||||||
|
doc[0]._.ext = [["Abx"], "B"]
|
||||||
|
assert len(matcher(doc)) == 0
|
||||||
|
doc[0]._.ext = ["Abx", "B"]
|
||||||
|
assert len(matcher(doc)) == 1
|
||||||
|
|
||||||
# INTERSECTS with an empty pattern list matches nothing
|
# INTERSECTS with an empty pattern list matches nothing
|
||||||
matcher = Matcher(en_vocab)
|
matcher = Matcher(en_vocab)
|
||||||
pattern = [{"_": {"ext": {"INTERSECTS": []}}}]
|
pattern = [{"_": {"ext": {"INTERSECTS": []}}}]
|
||||||
|
@ -476,14 +486,22 @@ def test_matcher_extension_set_membership(en_vocab):
|
||||||
assert len(matches) == 0
|
assert len(matches) == 0
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.xfail(reason="IN predicate must handle sequence values in extensions")
|
|
||||||
def test_matcher_extension_in_set_predicate(en_vocab):
|
def test_matcher_extension_in_set_predicate(en_vocab):
|
||||||
matcher = Matcher(en_vocab)
|
matcher = Matcher(en_vocab)
|
||||||
Token.set_extension("ext", default=[])
|
Token.set_extension("ext", default=[])
|
||||||
pattern = [{"_": {"ext": {"IN": ["A", "C"]}}}]
|
pattern = [{"_": {"ext": {"IN": ["A", "C"]}}}]
|
||||||
matcher.add("M", [pattern])
|
matcher.add("M", [pattern])
|
||||||
doc = Doc(en_vocab, words=["a", "b", "c"])
|
doc = Doc(en_vocab, words=["a", "b", "c"])
|
||||||
|
|
||||||
|
# The IN predicate expects an exact match between the
|
||||||
|
# extension value and one of the pattern's values.
|
||||||
doc[0]._.ext = ["A", "B"]
|
doc[0]._.ext = ["A", "B"]
|
||||||
|
assert len(matcher(doc)) == 0
|
||||||
|
|
||||||
|
doc[0]._.ext = ["A"]
|
||||||
|
assert len(matcher(doc)) == 0
|
||||||
|
|
||||||
|
doc[0]._.ext = "A"
|
||||||
assert len(matcher(doc)) == 1
|
assert len(matcher(doc)) == 1
|
||||||
|
|
||||||
|
|
||||||
|
|
|
@ -87,14 +87,15 @@ def test_issue4373():
|
||||||
|
|
||||||
@pytest.mark.issue(4651)
|
@pytest.mark.issue(4651)
|
||||||
def test_issue4651_with_phrase_matcher_attr():
|
def test_issue4651_with_phrase_matcher_attr():
|
||||||
"""Test that the EntityRuler PhraseMatcher is deserialized correctly using
|
"""Test that the entity_ruler PhraseMatcher is deserialized correctly using
|
||||||
the method from_disk when the EntityRuler argument phrase_matcher_attr is
|
the method from_disk when the entity_ruler argument phrase_matcher_attr is
|
||||||
specified.
|
specified.
|
||||||
"""
|
"""
|
||||||
text = "Spacy is a python library for nlp"
|
text = "Spacy is a python library for nlp"
|
||||||
nlp = English()
|
nlp = English()
|
||||||
patterns = [{"label": "PYTHON_LIB", "pattern": "spacy", "id": "spaCy"}]
|
patterns = [{"label": "PYTHON_LIB", "pattern": "spacy", "id": "spaCy"}]
|
||||||
ruler = nlp.add_pipe("entity_ruler", config={"phrase_matcher_attr": "LOWER"})
|
config = {"phrase_matcher_attr": "LOWER"}
|
||||||
|
ruler = nlp.add_pipe("entity_ruler", config=config)
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
doc = nlp(text)
|
doc = nlp(text)
|
||||||
res = [(ent.text, ent.label_, ent.ent_id_) for ent in doc.ents]
|
res = [(ent.text, ent.label_, ent.ent_id_) for ent in doc.ents]
|
||||||
|
@ -102,7 +103,7 @@ def test_issue4651_with_phrase_matcher_attr():
|
||||||
with make_tempdir() as d:
|
with make_tempdir() as d:
|
||||||
file_path = d / "entityruler"
|
file_path = d / "entityruler"
|
||||||
ruler.to_disk(file_path)
|
ruler.to_disk(file_path)
|
||||||
nlp_reloaded.add_pipe("entity_ruler").from_disk(file_path)
|
nlp_reloaded.add_pipe("entity_ruler", config=config).from_disk(file_path)
|
||||||
doc_reloaded = nlp_reloaded(text)
|
doc_reloaded = nlp_reloaded(text)
|
||||||
res_reloaded = [(ent.text, ent.label_, ent.ent_id_) for ent in doc_reloaded.ents]
|
res_reloaded = [(ent.text, ent.label_, ent.ent_id_) for ent in doc_reloaded.ents]
|
||||||
assert res == res_reloaded
|
assert res == res_reloaded
|
||||||
|
|
|
@ -17,6 +17,7 @@ def test_build_dependencies():
|
||||||
"types-dataclasses",
|
"types-dataclasses",
|
||||||
"types-mock",
|
"types-mock",
|
||||||
"types-requests",
|
"types-requests",
|
||||||
|
"types-setuptools",
|
||||||
]
|
]
|
||||||
# ignore language-specific packages that shouldn't be installed by all
|
# ignore language-specific packages that shouldn't be installed by all
|
||||||
libs_ignore_setup = [
|
libs_ignore_setup = [
|
||||||
|
|
|
@ -1,3 +1,4 @@
|
||||||
|
from typing import cast
|
||||||
import pickle
|
import pickle
|
||||||
import pytest
|
import pytest
|
||||||
from hypothesis import given
|
from hypothesis import given
|
||||||
|
@ -6,6 +7,7 @@ from spacy import util
|
||||||
from spacy.lang.en import English
|
from spacy.lang.en import English
|
||||||
from spacy.language import Language
|
from spacy.language import Language
|
||||||
from spacy.pipeline._edit_tree_internals.edit_trees import EditTrees
|
from spacy.pipeline._edit_tree_internals.edit_trees import EditTrees
|
||||||
|
from spacy.pipeline.trainable_pipe import TrainablePipe
|
||||||
from spacy.training import Example
|
from spacy.training import Example
|
||||||
from spacy.strings import StringStore
|
from spacy.strings import StringStore
|
||||||
from spacy.util import make_tempdir
|
from spacy.util import make_tempdir
|
||||||
|
@ -278,3 +280,26 @@ def test_empty_strings():
|
||||||
no_change = trees.add("xyz", "xyz")
|
no_change = trees.add("xyz", "xyz")
|
||||||
empty = trees.add("", "")
|
empty = trees.add("", "")
|
||||||
assert no_change == empty
|
assert no_change == empty
|
||||||
|
|
||||||
|
|
||||||
|
def test_save_activations():
|
||||||
|
nlp = English()
|
||||||
|
lemmatizer = cast(TrainablePipe, nlp.add_pipe("trainable_lemmatizer"))
|
||||||
|
lemmatizer.min_tree_freq = 1
|
||||||
|
train_examples = []
|
||||||
|
for t in TRAIN_DATA:
|
||||||
|
train_examples.append(Example.from_dict(nlp.make_doc(t[0]), t[1]))
|
||||||
|
nlp.initialize(get_examples=lambda: train_examples)
|
||||||
|
nO = lemmatizer.model.get_dim("nO")
|
||||||
|
|
||||||
|
doc = nlp("This is a test.")
|
||||||
|
assert "trainable_lemmatizer" not in doc.activations
|
||||||
|
|
||||||
|
lemmatizer.save_activations = True
|
||||||
|
doc = nlp("This is a test.")
|
||||||
|
assert list(doc.activations["trainable_lemmatizer"].keys()) == [
|
||||||
|
"probabilities",
|
||||||
|
"tree_ids",
|
||||||
|
]
|
||||||
|
assert doc.activations["trainable_lemmatizer"]["probabilities"].shape == (5, nO)
|
||||||
|
assert doc.activations["trainable_lemmatizer"]["tree_ids"].shape == (5,)
|
||||||
|
|
|
@ -1,15 +1,17 @@
|
||||||
from typing import Callable, Iterable, Dict, Any
|
from typing import Callable, Iterable, Dict, Any, cast
|
||||||
|
|
||||||
import pytest
|
import pytest
|
||||||
from numpy.testing import assert_equal
|
from numpy.testing import assert_equal
|
||||||
|
from thinc.types import Ragged
|
||||||
|
|
||||||
from spacy import registry, util
|
from spacy import registry, util
|
||||||
from spacy.attrs import ENT_KB_ID
|
from spacy.attrs import ENT_KB_ID
|
||||||
from spacy.compat import pickle
|
from spacy.compat import pickle
|
||||||
from spacy.kb import Candidate, KnowledgeBase, get_candidates
|
from spacy.kb import Candidate, InMemoryLookupKB, get_candidates, KnowledgeBase
|
||||||
from spacy.lang.en import English
|
from spacy.lang.en import English
|
||||||
from spacy.ml import load_kb
|
from spacy.ml import load_kb
|
||||||
from spacy.pipeline import EntityLinker
|
from spacy.ml.models.entity_linker import build_span_maker
|
||||||
|
from spacy.pipeline import EntityLinker, TrainablePipe
|
||||||
from spacy.pipeline.legacy import EntityLinker_v1
|
from spacy.pipeline.legacy import EntityLinker_v1
|
||||||
from spacy.pipeline.tok2vec import DEFAULT_TOK2VEC_MODEL
|
from spacy.pipeline.tok2vec import DEFAULT_TOK2VEC_MODEL
|
||||||
from spacy.scorer import Scorer
|
from spacy.scorer import Scorer
|
||||||
|
@ -34,7 +36,7 @@ def assert_almost_equal(a, b):
|
||||||
def test_issue4674():
|
def test_issue4674():
|
||||||
"""Test that setting entities with overlapping identifiers does not mess up IO"""
|
"""Test that setting entities with overlapping identifiers does not mess up IO"""
|
||||||
nlp = English()
|
nlp = English()
|
||||||
kb = KnowledgeBase(nlp.vocab, entity_vector_length=3)
|
kb = InMemoryLookupKB(nlp.vocab, entity_vector_length=3)
|
||||||
vector1 = [0.9, 1.1, 1.01]
|
vector1 = [0.9, 1.1, 1.01]
|
||||||
vector2 = [1.8, 2.25, 2.01]
|
vector2 = [1.8, 2.25, 2.01]
|
||||||
with pytest.warns(UserWarning):
|
with pytest.warns(UserWarning):
|
||||||
|
@ -51,7 +53,7 @@ def test_issue4674():
|
||||||
dir_path.mkdir()
|
dir_path.mkdir()
|
||||||
file_path = dir_path / "kb"
|
file_path = dir_path / "kb"
|
||||||
kb.to_disk(str(file_path))
|
kb.to_disk(str(file_path))
|
||||||
kb2 = KnowledgeBase(nlp.vocab, entity_vector_length=3)
|
kb2 = InMemoryLookupKB(nlp.vocab, entity_vector_length=3)
|
||||||
kb2.from_disk(str(file_path))
|
kb2.from_disk(str(file_path))
|
||||||
assert kb2.get_size_entities() == 1
|
assert kb2.get_size_entities() == 1
|
||||||
|
|
||||||
|
@ -59,9 +61,9 @@ def test_issue4674():
|
||||||
@pytest.mark.issue(6730)
|
@pytest.mark.issue(6730)
|
||||||
def test_issue6730(en_vocab):
|
def test_issue6730(en_vocab):
|
||||||
"""Ensure that the KB does not accept empty strings, but otherwise IO works fine."""
|
"""Ensure that the KB does not accept empty strings, but otherwise IO works fine."""
|
||||||
from spacy.kb import KnowledgeBase
|
from spacy.kb.kb_in_memory import InMemoryLookupKB
|
||||||
|
|
||||||
kb = KnowledgeBase(en_vocab, entity_vector_length=3)
|
kb = InMemoryLookupKB(en_vocab, entity_vector_length=3)
|
||||||
kb.add_entity(entity="1", freq=148, entity_vector=[1, 2, 3])
|
kb.add_entity(entity="1", freq=148, entity_vector=[1, 2, 3])
|
||||||
|
|
||||||
with pytest.raises(ValueError):
|
with pytest.raises(ValueError):
|
||||||
|
@ -127,7 +129,7 @@ def test_issue7065_b():
|
||||||
|
|
||||||
def create_kb(vocab):
|
def create_kb(vocab):
|
||||||
# create artificial KB
|
# create artificial KB
|
||||||
mykb = KnowledgeBase(vocab, entity_vector_length=vector_length)
|
mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length)
|
||||||
mykb.add_entity(entity="Q270853", freq=12, entity_vector=[9, 1, -7])
|
mykb.add_entity(entity="Q270853", freq=12, entity_vector=[9, 1, -7])
|
||||||
mykb.add_alias(
|
mykb.add_alias(
|
||||||
alias="No. 8",
|
alias="No. 8",
|
||||||
|
@ -190,7 +192,7 @@ def test_no_entities():
|
||||||
|
|
||||||
def create_kb(vocab):
|
def create_kb(vocab):
|
||||||
# create artificial KB
|
# create artificial KB
|
||||||
mykb = KnowledgeBase(vocab, entity_vector_length=vector_length)
|
mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length)
|
||||||
mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
||||||
mykb.add_alias("Russ Cochran", ["Q2146908"], [0.9])
|
mykb.add_alias("Russ Cochran", ["Q2146908"], [0.9])
|
||||||
return mykb
|
return mykb
|
||||||
|
@ -231,7 +233,7 @@ def test_partial_links():
|
||||||
|
|
||||||
def create_kb(vocab):
|
def create_kb(vocab):
|
||||||
# create artificial KB
|
# create artificial KB
|
||||||
mykb = KnowledgeBase(vocab, entity_vector_length=vector_length)
|
mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length)
|
||||||
mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
||||||
mykb.add_alias("Russ Cochran", ["Q2146908"], [0.9])
|
mykb.add_alias("Russ Cochran", ["Q2146908"], [0.9])
|
||||||
return mykb
|
return mykb
|
||||||
|
@ -263,7 +265,7 @@ def test_partial_links():
|
||||||
|
|
||||||
def test_kb_valid_entities(nlp):
|
def test_kb_valid_entities(nlp):
|
||||||
"""Test the valid construction of a KB with 3 entities and two aliases"""
|
"""Test the valid construction of a KB with 3 entities and two aliases"""
|
||||||
mykb = KnowledgeBase(nlp.vocab, entity_vector_length=3)
|
mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=3)
|
||||||
|
|
||||||
# adding entities
|
# adding entities
|
||||||
mykb.add_entity(entity="Q1", freq=19, entity_vector=[8, 4, 3])
|
mykb.add_entity(entity="Q1", freq=19, entity_vector=[8, 4, 3])
|
||||||
|
@ -292,7 +294,7 @@ def test_kb_valid_entities(nlp):
|
||||||
|
|
||||||
def test_kb_invalid_entities(nlp):
|
def test_kb_invalid_entities(nlp):
|
||||||
"""Test the invalid construction of a KB with an alias linked to a non-existing entity"""
|
"""Test the invalid construction of a KB with an alias linked to a non-existing entity"""
|
||||||
mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1)
|
mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1)
|
||||||
|
|
||||||
# adding entities
|
# adding entities
|
||||||
mykb.add_entity(entity="Q1", freq=19, entity_vector=[1])
|
mykb.add_entity(entity="Q1", freq=19, entity_vector=[1])
|
||||||
|
@ -308,7 +310,7 @@ def test_kb_invalid_entities(nlp):
|
||||||
|
|
||||||
def test_kb_invalid_probabilities(nlp):
|
def test_kb_invalid_probabilities(nlp):
|
||||||
"""Test the invalid construction of a KB with wrong prior probabilities"""
|
"""Test the invalid construction of a KB with wrong prior probabilities"""
|
||||||
mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1)
|
mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1)
|
||||||
|
|
||||||
# adding entities
|
# adding entities
|
||||||
mykb.add_entity(entity="Q1", freq=19, entity_vector=[1])
|
mykb.add_entity(entity="Q1", freq=19, entity_vector=[1])
|
||||||
|
@ -322,7 +324,7 @@ def test_kb_invalid_probabilities(nlp):
|
||||||
|
|
||||||
def test_kb_invalid_combination(nlp):
|
def test_kb_invalid_combination(nlp):
|
||||||
"""Test the invalid construction of a KB with non-matching entity and probability lists"""
|
"""Test the invalid construction of a KB with non-matching entity and probability lists"""
|
||||||
mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1)
|
mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1)
|
||||||
|
|
||||||
# adding entities
|
# adding entities
|
||||||
mykb.add_entity(entity="Q1", freq=19, entity_vector=[1])
|
mykb.add_entity(entity="Q1", freq=19, entity_vector=[1])
|
||||||
|
@ -338,7 +340,7 @@ def test_kb_invalid_combination(nlp):
|
||||||
|
|
||||||
def test_kb_invalid_entity_vector(nlp):
|
def test_kb_invalid_entity_vector(nlp):
|
||||||
"""Test the invalid construction of a KB with non-matching entity vector lengths"""
|
"""Test the invalid construction of a KB with non-matching entity vector lengths"""
|
||||||
mykb = KnowledgeBase(nlp.vocab, entity_vector_length=3)
|
mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=3)
|
||||||
|
|
||||||
# adding entities
|
# adding entities
|
||||||
mykb.add_entity(entity="Q1", freq=19, entity_vector=[1, 2, 3])
|
mykb.add_entity(entity="Q1", freq=19, entity_vector=[1, 2, 3])
|
||||||
|
@ -376,7 +378,7 @@ def test_kb_initialize_empty(nlp):
|
||||||
|
|
||||||
def test_kb_serialize(nlp):
|
def test_kb_serialize(nlp):
|
||||||
"""Test serialization of the KB"""
|
"""Test serialization of the KB"""
|
||||||
mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1)
|
mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1)
|
||||||
with make_tempdir() as d:
|
with make_tempdir() as d:
|
||||||
# normal read-write behaviour
|
# normal read-write behaviour
|
||||||
mykb.to_disk(d / "kb")
|
mykb.to_disk(d / "kb")
|
||||||
|
@ -393,12 +395,12 @@ def test_kb_serialize(nlp):
|
||||||
@pytest.mark.issue(9137)
|
@pytest.mark.issue(9137)
|
||||||
def test_kb_serialize_2(nlp):
|
def test_kb_serialize_2(nlp):
|
||||||
v = [5, 6, 7, 8]
|
v = [5, 6, 7, 8]
|
||||||
kb1 = KnowledgeBase(vocab=nlp.vocab, entity_vector_length=4)
|
kb1 = InMemoryLookupKB(vocab=nlp.vocab, entity_vector_length=4)
|
||||||
kb1.set_entities(["E1"], [1], [v])
|
kb1.set_entities(["E1"], [1], [v])
|
||||||
assert kb1.get_vector("E1") == v
|
assert kb1.get_vector("E1") == v
|
||||||
with make_tempdir() as d:
|
with make_tempdir() as d:
|
||||||
kb1.to_disk(d / "kb")
|
kb1.to_disk(d / "kb")
|
||||||
kb2 = KnowledgeBase(vocab=nlp.vocab, entity_vector_length=4)
|
kb2 = InMemoryLookupKB(vocab=nlp.vocab, entity_vector_length=4)
|
||||||
kb2.from_disk(d / "kb")
|
kb2.from_disk(d / "kb")
|
||||||
assert kb2.get_vector("E1") == v
|
assert kb2.get_vector("E1") == v
|
||||||
|
|
||||||
|
@ -408,7 +410,7 @@ def test_kb_set_entities(nlp):
|
||||||
v = [5, 6, 7, 8]
|
v = [5, 6, 7, 8]
|
||||||
v1 = [1, 1, 1, 0]
|
v1 = [1, 1, 1, 0]
|
||||||
v2 = [2, 2, 2, 3]
|
v2 = [2, 2, 2, 3]
|
||||||
kb1 = KnowledgeBase(vocab=nlp.vocab, entity_vector_length=4)
|
kb1 = InMemoryLookupKB(vocab=nlp.vocab, entity_vector_length=4)
|
||||||
kb1.set_entities(["E0"], [1], [v])
|
kb1.set_entities(["E0"], [1], [v])
|
||||||
assert kb1.get_entity_strings() == ["E0"]
|
assert kb1.get_entity_strings() == ["E0"]
|
||||||
kb1.set_entities(["E1", "E2"], [1, 9], [v1, v2])
|
kb1.set_entities(["E1", "E2"], [1, 9], [v1, v2])
|
||||||
|
@ -417,7 +419,7 @@ def test_kb_set_entities(nlp):
|
||||||
assert kb1.get_vector("E2") == v2
|
assert kb1.get_vector("E2") == v2
|
||||||
with make_tempdir() as d:
|
with make_tempdir() as d:
|
||||||
kb1.to_disk(d / "kb")
|
kb1.to_disk(d / "kb")
|
||||||
kb2 = KnowledgeBase(vocab=nlp.vocab, entity_vector_length=4)
|
kb2 = InMemoryLookupKB(vocab=nlp.vocab, entity_vector_length=4)
|
||||||
kb2.from_disk(d / "kb")
|
kb2.from_disk(d / "kb")
|
||||||
assert set(kb2.get_entity_strings()) == {"E1", "E2"}
|
assert set(kb2.get_entity_strings()) == {"E1", "E2"}
|
||||||
assert kb2.get_vector("E1") == v1
|
assert kb2.get_vector("E1") == v1
|
||||||
|
@ -428,7 +430,7 @@ def test_kb_serialize_vocab(nlp):
|
||||||
"""Test serialization of the KB and custom strings"""
|
"""Test serialization of the KB and custom strings"""
|
||||||
entity = "MyFunnyID"
|
entity = "MyFunnyID"
|
||||||
assert entity not in nlp.vocab.strings
|
assert entity not in nlp.vocab.strings
|
||||||
mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1)
|
mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1)
|
||||||
assert not mykb.contains_entity(entity)
|
assert not mykb.contains_entity(entity)
|
||||||
mykb.add_entity(entity, freq=342, entity_vector=[3])
|
mykb.add_entity(entity, freq=342, entity_vector=[3])
|
||||||
assert mykb.contains_entity(entity)
|
assert mykb.contains_entity(entity)
|
||||||
|
@ -436,14 +438,14 @@ def test_kb_serialize_vocab(nlp):
|
||||||
with make_tempdir() as d:
|
with make_tempdir() as d:
|
||||||
# normal read-write behaviour
|
# normal read-write behaviour
|
||||||
mykb.to_disk(d / "kb")
|
mykb.to_disk(d / "kb")
|
||||||
mykb_new = KnowledgeBase(Vocab(), entity_vector_length=1)
|
mykb_new = InMemoryLookupKB(Vocab(), entity_vector_length=1)
|
||||||
mykb_new.from_disk(d / "kb")
|
mykb_new.from_disk(d / "kb")
|
||||||
assert entity in mykb_new.vocab.strings
|
assert entity in mykb_new.vocab.strings
|
||||||
|
|
||||||
|
|
||||||
def test_candidate_generation(nlp):
|
def test_candidate_generation(nlp):
|
||||||
"""Test correct candidate generation"""
|
"""Test correct candidate generation"""
|
||||||
mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1)
|
mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1)
|
||||||
doc = nlp("douglas adam Adam shrubbery")
|
doc = nlp("douglas adam Adam shrubbery")
|
||||||
|
|
||||||
douglas_ent = doc[0:1]
|
douglas_ent = doc[0:1]
|
||||||
|
@ -481,7 +483,7 @@ def test_el_pipe_configuration(nlp):
|
||||||
ruler.add_patterns([pattern])
|
ruler.add_patterns([pattern])
|
||||||
|
|
||||||
def create_kb(vocab):
|
def create_kb(vocab):
|
||||||
kb = KnowledgeBase(vocab, entity_vector_length=1)
|
kb = InMemoryLookupKB(vocab, entity_vector_length=1)
|
||||||
kb.add_entity(entity="Q2", freq=12, entity_vector=[2])
|
kb.add_entity(entity="Q2", freq=12, entity_vector=[2])
|
||||||
kb.add_entity(entity="Q3", freq=5, entity_vector=[3])
|
kb.add_entity(entity="Q3", freq=5, entity_vector=[3])
|
||||||
kb.add_alias(alias="douglas", entities=["Q2", "Q3"], probabilities=[0.8, 0.1])
|
kb.add_alias(alias="douglas", entities=["Q2", "Q3"], probabilities=[0.8, 0.1])
|
||||||
|
@ -500,10 +502,21 @@ def test_el_pipe_configuration(nlp):
|
||||||
def get_lowercased_candidates(kb, span):
|
def get_lowercased_candidates(kb, span):
|
||||||
return kb.get_alias_candidates(span.text.lower())
|
return kb.get_alias_candidates(span.text.lower())
|
||||||
|
|
||||||
|
def get_lowercased_candidates_batch(kb, spans):
|
||||||
|
return [get_lowercased_candidates(kb, span) for span in spans]
|
||||||
|
|
||||||
@registry.misc("spacy.LowercaseCandidateGenerator.v1")
|
@registry.misc("spacy.LowercaseCandidateGenerator.v1")
|
||||||
def create_candidates() -> Callable[[KnowledgeBase, "Span"], Iterable[Candidate]]:
|
def create_candidates() -> Callable[
|
||||||
|
[InMemoryLookupKB, "Span"], Iterable[Candidate]
|
||||||
|
]:
|
||||||
return get_lowercased_candidates
|
return get_lowercased_candidates
|
||||||
|
|
||||||
|
@registry.misc("spacy.LowercaseCandidateBatchGenerator.v1")
|
||||||
|
def create_candidates_batch() -> Callable[
|
||||||
|
[InMemoryLookupKB, Iterable["Span"]], Iterable[Iterable[Candidate]]
|
||||||
|
]:
|
||||||
|
return get_lowercased_candidates_batch
|
||||||
|
|
||||||
# replace the pipe with a new one with with a different candidate generator
|
# replace the pipe with a new one with with a different candidate generator
|
||||||
entity_linker = nlp.replace_pipe(
|
entity_linker = nlp.replace_pipe(
|
||||||
"entity_linker",
|
"entity_linker",
|
||||||
|
@ -511,6 +524,9 @@ def test_el_pipe_configuration(nlp):
|
||||||
config={
|
config={
|
||||||
"incl_context": False,
|
"incl_context": False,
|
||||||
"get_candidates": {"@misc": "spacy.LowercaseCandidateGenerator.v1"},
|
"get_candidates": {"@misc": "spacy.LowercaseCandidateGenerator.v1"},
|
||||||
|
"get_candidates_batch": {
|
||||||
|
"@misc": "spacy.LowercaseCandidateBatchGenerator.v1"
|
||||||
|
},
|
||||||
},
|
},
|
||||||
)
|
)
|
||||||
entity_linker.set_kb(create_kb)
|
entity_linker.set_kb(create_kb)
|
||||||
|
@ -532,7 +548,7 @@ def test_nel_nsents(nlp):
|
||||||
|
|
||||||
def test_vocab_serialization(nlp):
|
def test_vocab_serialization(nlp):
|
||||||
"""Test that string information is retained across storage"""
|
"""Test that string information is retained across storage"""
|
||||||
mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1)
|
mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1)
|
||||||
|
|
||||||
# adding entities
|
# adding entities
|
||||||
mykb.add_entity(entity="Q1", freq=27, entity_vector=[1])
|
mykb.add_entity(entity="Q1", freq=27, entity_vector=[1])
|
||||||
|
@ -552,7 +568,7 @@ def test_vocab_serialization(nlp):
|
||||||
|
|
||||||
with make_tempdir() as d:
|
with make_tempdir() as d:
|
||||||
mykb.to_disk(d / "kb")
|
mykb.to_disk(d / "kb")
|
||||||
kb_new_vocab = KnowledgeBase(Vocab(), entity_vector_length=1)
|
kb_new_vocab = InMemoryLookupKB(Vocab(), entity_vector_length=1)
|
||||||
kb_new_vocab.from_disk(d / "kb")
|
kb_new_vocab.from_disk(d / "kb")
|
||||||
|
|
||||||
candidates = kb_new_vocab.get_alias_candidates("adam")
|
candidates = kb_new_vocab.get_alias_candidates("adam")
|
||||||
|
@ -568,7 +584,7 @@ def test_vocab_serialization(nlp):
|
||||||
|
|
||||||
def test_append_alias(nlp):
|
def test_append_alias(nlp):
|
||||||
"""Test that we can append additional alias-entity pairs"""
|
"""Test that we can append additional alias-entity pairs"""
|
||||||
mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1)
|
mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1)
|
||||||
|
|
||||||
# adding entities
|
# adding entities
|
||||||
mykb.add_entity(entity="Q1", freq=27, entity_vector=[1])
|
mykb.add_entity(entity="Q1", freq=27, entity_vector=[1])
|
||||||
|
@ -599,7 +615,7 @@ def test_append_alias(nlp):
|
||||||
@pytest.mark.filterwarnings("ignore:\\[W036")
|
@pytest.mark.filterwarnings("ignore:\\[W036")
|
||||||
def test_append_invalid_alias(nlp):
|
def test_append_invalid_alias(nlp):
|
||||||
"""Test that append an alias will throw an error if prior probs are exceeding 1"""
|
"""Test that append an alias will throw an error if prior probs are exceeding 1"""
|
||||||
mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1)
|
mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1)
|
||||||
|
|
||||||
# adding entities
|
# adding entities
|
||||||
mykb.add_entity(entity="Q1", freq=27, entity_vector=[1])
|
mykb.add_entity(entity="Q1", freq=27, entity_vector=[1])
|
||||||
|
@ -621,7 +637,7 @@ def test_preserving_links_asdoc(nlp):
|
||||||
vector_length = 1
|
vector_length = 1
|
||||||
|
|
||||||
def create_kb(vocab):
|
def create_kb(vocab):
|
||||||
mykb = KnowledgeBase(vocab, entity_vector_length=vector_length)
|
mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length)
|
||||||
# adding entities
|
# adding entities
|
||||||
mykb.add_entity(entity="Q1", freq=19, entity_vector=[1])
|
mykb.add_entity(entity="Q1", freq=19, entity_vector=[1])
|
||||||
mykb.add_entity(entity="Q2", freq=8, entity_vector=[1])
|
mykb.add_entity(entity="Q2", freq=8, entity_vector=[1])
|
||||||
|
@ -701,7 +717,11 @@ TRAIN_DATA = [
|
||||||
("Russ Cochran was a member of University of Kentucky's golf team.",
|
("Russ Cochran was a member of University of Kentucky's golf team.",
|
||||||
{"links": {(0, 12): {"Q7381115": 0.0, "Q2146908": 1.0}},
|
{"links": {(0, 12): {"Q7381115": 0.0, "Q2146908": 1.0}},
|
||||||
"entities": [(0, 12, "PERSON"), (43, 51, "LOC")],
|
"entities": [(0, 12, "PERSON"), (43, 51, "LOC")],
|
||||||
"sent_starts": [1, -1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0]})
|
"sent_starts": [1, -1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0]}),
|
||||||
|
# having a blank instance shouldn't break things
|
||||||
|
("The weather is nice today.",
|
||||||
|
{"links": {}, "entities": [],
|
||||||
|
"sent_starts": [1, -1, 0, 0, 0, 0]})
|
||||||
]
|
]
|
||||||
GOLD_entities = ["Q2146908", "Q7381115", "Q7381115", "Q2146908"]
|
GOLD_entities = ["Q2146908", "Q7381115", "Q7381115", "Q2146908"]
|
||||||
# fmt: on
|
# fmt: on
|
||||||
|
@ -723,7 +743,7 @@ def test_overfitting_IO():
|
||||||
# create artificial KB - assign same prior weight to the two russ cochran's
|
# create artificial KB - assign same prior weight to the two russ cochran's
|
||||||
# Q2146908 (Russ Cochran): American golfer
|
# Q2146908 (Russ Cochran): American golfer
|
||||||
# Q7381115 (Russ Cochran): publisher
|
# Q7381115 (Russ Cochran): publisher
|
||||||
mykb = KnowledgeBase(vocab, entity_vector_length=vector_length)
|
mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length)
|
||||||
mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
||||||
mykb.add_entity(entity="Q7381115", freq=12, entity_vector=[9, 1, -7])
|
mykb.add_entity(entity="Q7381115", freq=12, entity_vector=[9, 1, -7])
|
||||||
mykb.add_alias(
|
mykb.add_alias(
|
||||||
|
@ -805,7 +825,7 @@ def test_kb_serialization():
|
||||||
kb_dir = tmp_dir / "kb"
|
kb_dir = tmp_dir / "kb"
|
||||||
nlp1 = English()
|
nlp1 = English()
|
||||||
assert "Q2146908" not in nlp1.vocab.strings
|
assert "Q2146908" not in nlp1.vocab.strings
|
||||||
mykb = KnowledgeBase(nlp1.vocab, entity_vector_length=vector_length)
|
mykb = InMemoryLookupKB(nlp1.vocab, entity_vector_length=vector_length)
|
||||||
mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
||||||
mykb.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8])
|
mykb.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8])
|
||||||
assert "Q2146908" in nlp1.vocab.strings
|
assert "Q2146908" in nlp1.vocab.strings
|
||||||
|
@ -828,7 +848,7 @@ def test_kb_serialization():
|
||||||
def test_kb_pickle():
|
def test_kb_pickle():
|
||||||
# Test that the KB can be pickled
|
# Test that the KB can be pickled
|
||||||
nlp = English()
|
nlp = English()
|
||||||
kb_1 = KnowledgeBase(nlp.vocab, entity_vector_length=3)
|
kb_1 = InMemoryLookupKB(nlp.vocab, entity_vector_length=3)
|
||||||
kb_1.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
kb_1.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
||||||
assert not kb_1.contains_alias("Russ Cochran")
|
assert not kb_1.contains_alias("Russ Cochran")
|
||||||
kb_1.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8])
|
kb_1.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8])
|
||||||
|
@ -842,7 +862,7 @@ def test_kb_pickle():
|
||||||
def test_nel_pickle():
|
def test_nel_pickle():
|
||||||
# Test that a pipeline with an EL component can be pickled
|
# Test that a pipeline with an EL component can be pickled
|
||||||
def create_kb(vocab):
|
def create_kb(vocab):
|
||||||
kb = KnowledgeBase(vocab, entity_vector_length=3)
|
kb = InMemoryLookupKB(vocab, entity_vector_length=3)
|
||||||
kb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
kb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
||||||
kb.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8])
|
kb.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8])
|
||||||
return kb
|
return kb
|
||||||
|
@ -864,7 +884,7 @@ def test_nel_pickle():
|
||||||
def test_kb_to_bytes():
|
def test_kb_to_bytes():
|
||||||
# Test that the KB's to_bytes method works correctly
|
# Test that the KB's to_bytes method works correctly
|
||||||
nlp = English()
|
nlp = English()
|
||||||
kb_1 = KnowledgeBase(nlp.vocab, entity_vector_length=3)
|
kb_1 = InMemoryLookupKB(nlp.vocab, entity_vector_length=3)
|
||||||
kb_1.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
kb_1.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
||||||
kb_1.add_entity(entity="Q66", freq=9, entity_vector=[1, 2, 3])
|
kb_1.add_entity(entity="Q66", freq=9, entity_vector=[1, 2, 3])
|
||||||
kb_1.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8])
|
kb_1.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8])
|
||||||
|
@ -874,7 +894,7 @@ def test_kb_to_bytes():
|
||||||
)
|
)
|
||||||
assert kb_1.contains_alias("Russ Cochran")
|
assert kb_1.contains_alias("Russ Cochran")
|
||||||
kb_bytes = kb_1.to_bytes()
|
kb_bytes = kb_1.to_bytes()
|
||||||
kb_2 = KnowledgeBase(nlp.vocab, entity_vector_length=3)
|
kb_2 = InMemoryLookupKB(nlp.vocab, entity_vector_length=3)
|
||||||
assert not kb_2.contains_alias("Russ Cochran")
|
assert not kb_2.contains_alias("Russ Cochran")
|
||||||
kb_2 = kb_2.from_bytes(kb_bytes)
|
kb_2 = kb_2.from_bytes(kb_bytes)
|
||||||
# check that both KBs are exactly the same
|
# check that both KBs are exactly the same
|
||||||
|
@ -897,7 +917,7 @@ def test_kb_to_bytes():
|
||||||
def test_nel_to_bytes():
|
def test_nel_to_bytes():
|
||||||
# Test that a pipeline with an EL component can be converted to bytes
|
# Test that a pipeline with an EL component can be converted to bytes
|
||||||
def create_kb(vocab):
|
def create_kb(vocab):
|
||||||
kb = KnowledgeBase(vocab, entity_vector_length=3)
|
kb = InMemoryLookupKB(vocab, entity_vector_length=3)
|
||||||
kb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
kb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
||||||
kb.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8])
|
kb.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8])
|
||||||
return kb
|
return kb
|
||||||
|
@ -987,7 +1007,7 @@ def test_legacy_architectures(name, config):
|
||||||
train_examples.append(Example.from_dict(doc, annotation))
|
train_examples.append(Example.from_dict(doc, annotation))
|
||||||
|
|
||||||
def create_kb(vocab):
|
def create_kb(vocab):
|
||||||
mykb = KnowledgeBase(vocab, entity_vector_length=vector_length)
|
mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length)
|
||||||
mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
||||||
mykb.add_entity(entity="Q7381115", freq=12, entity_vector=[9, 1, -7])
|
mykb.add_entity(entity="Q7381115", freq=12, entity_vector=[9, 1, -7])
|
||||||
mykb.add_alias(
|
mykb.add_alias(
|
||||||
|
@ -1054,7 +1074,7 @@ def test_no_gold_ents(patterns):
|
||||||
|
|
||||||
def create_kb(vocab):
|
def create_kb(vocab):
|
||||||
# create artificial KB
|
# create artificial KB
|
||||||
mykb = KnowledgeBase(vocab, entity_vector_length=vector_length)
|
mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length)
|
||||||
mykb.add_entity(entity="Q613241", freq=12, entity_vector=[6, -4, 3])
|
mykb.add_entity(entity="Q613241", freq=12, entity_vector=[6, -4, 3])
|
||||||
mykb.add_alias("Kirby", ["Q613241"], [0.9])
|
mykb.add_alias("Kirby", ["Q613241"], [0.9])
|
||||||
# Placeholder
|
# Placeholder
|
||||||
|
@ -1104,7 +1124,7 @@ def test_tokenization_mismatch():
|
||||||
|
|
||||||
def create_kb(vocab):
|
def create_kb(vocab):
|
||||||
# create placeholder KB
|
# create placeholder KB
|
||||||
mykb = KnowledgeBase(vocab, entity_vector_length=vector_length)
|
mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length)
|
||||||
mykb.add_entity(entity="Q613241", freq=12, entity_vector=[6, -4, 3])
|
mykb.add_entity(entity="Q613241", freq=12, entity_vector=[6, -4, 3])
|
||||||
mykb.add_alias("Kirby", ["Q613241"], [0.9])
|
mykb.add_alias("Kirby", ["Q613241"], [0.9])
|
||||||
return mykb
|
return mykb
|
||||||
|
@ -1121,6 +1141,12 @@ def test_tokenization_mismatch():
|
||||||
nlp.evaluate(train_examples)
|
nlp.evaluate(train_examples)
|
||||||
|
|
||||||
|
|
||||||
|
def test_abstract_kb_instantiation():
|
||||||
|
"""Test whether instantiation of abstract KB base class fails."""
|
||||||
|
with pytest.raises(TypeError):
|
||||||
|
KnowledgeBase(None, 3)
|
||||||
|
|
||||||
|
|
||||||
# fmt: off
|
# fmt: off
|
||||||
@pytest.mark.parametrize(
|
@pytest.mark.parametrize(
|
||||||
"meet_threshold,config",
|
"meet_threshold,config",
|
||||||
|
@ -1151,7 +1177,7 @@ def test_threshold(meet_threshold: bool, config: Dict[str, Any]):
|
||||||
|
|
||||||
def create_kb(vocab):
|
def create_kb(vocab):
|
||||||
# create artificial KB
|
# create artificial KB
|
||||||
mykb = KnowledgeBase(vocab, entity_vector_length=3)
|
mykb = InMemoryLookupKB(vocab, entity_vector_length=3)
|
||||||
mykb.add_entity(entity=entity_id, freq=12, entity_vector=[6, -4, 3])
|
mykb.add_entity(entity=entity_id, freq=12, entity_vector=[6, -4, 3])
|
||||||
mykb.add_alias(
|
mykb.add_alias(
|
||||||
alias="Mahler",
|
alias="Mahler",
|
||||||
|
@ -1176,3 +1202,81 @@ def test_threshold(meet_threshold: bool, config: Dict[str, Any]):
|
||||||
|
|
||||||
assert len(doc.ents) == 1
|
assert len(doc.ents) == 1
|
||||||
assert doc.ents[0].kb_id_ == entity_id if meet_threshold else EntityLinker.NIL
|
assert doc.ents[0].kb_id_ == entity_id if meet_threshold else EntityLinker.NIL
|
||||||
|
|
||||||
|
|
||||||
|
def test_save_activations():
|
||||||
|
nlp = English()
|
||||||
|
vector_length = 3
|
||||||
|
assert "Q2146908" not in nlp.vocab.strings
|
||||||
|
|
||||||
|
# Convert the texts to docs to make sure we have doc.ents set for the training examples
|
||||||
|
train_examples = []
|
||||||
|
for text, annotation in TRAIN_DATA:
|
||||||
|
doc = nlp(text)
|
||||||
|
train_examples.append(Example.from_dict(doc, annotation))
|
||||||
|
|
||||||
|
def create_kb(vocab):
|
||||||
|
# create artificial KB - assign same prior weight to the two russ cochran's
|
||||||
|
# Q2146908 (Russ Cochran): American golfer
|
||||||
|
# Q7381115 (Russ Cochran): publisher
|
||||||
|
mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length)
|
||||||
|
mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3])
|
||||||
|
mykb.add_entity(entity="Q7381115", freq=12, entity_vector=[9, 1, -7])
|
||||||
|
mykb.add_alias(
|
||||||
|
alias="Russ Cochran",
|
||||||
|
entities=["Q2146908", "Q7381115"],
|
||||||
|
probabilities=[0.5, 0.5],
|
||||||
|
)
|
||||||
|
return mykb
|
||||||
|
|
||||||
|
# Create the Entity Linker component and add it to the pipeline
|
||||||
|
entity_linker = cast(TrainablePipe, nlp.add_pipe("entity_linker", last=True))
|
||||||
|
assert isinstance(entity_linker, EntityLinker)
|
||||||
|
entity_linker.set_kb(create_kb)
|
||||||
|
assert "Q2146908" in entity_linker.vocab.strings
|
||||||
|
assert "Q2146908" in entity_linker.kb.vocab.strings
|
||||||
|
|
||||||
|
# initialize the NEL pipe
|
||||||
|
nlp.initialize(get_examples=lambda: train_examples)
|
||||||
|
|
||||||
|
nO = entity_linker.model.get_dim("nO")
|
||||||
|
|
||||||
|
nlp.add_pipe("sentencizer", first=True)
|
||||||
|
patterns = [
|
||||||
|
{"label": "PERSON", "pattern": [{"LOWER": "russ"}, {"LOWER": "cochran"}]},
|
||||||
|
{"label": "ORG", "pattern": [{"LOWER": "ec"}, {"LOWER": "comics"}]},
|
||||||
|
]
|
||||||
|
ruler = nlp.add_pipe("entity_ruler", before="entity_linker")
|
||||||
|
ruler.add_patterns(patterns)
|
||||||
|
|
||||||
|
doc = nlp("Russ Cochran was a publisher")
|
||||||
|
assert "entity_linker" not in doc.activations
|
||||||
|
|
||||||
|
entity_linker.save_activations = True
|
||||||
|
doc = nlp("Russ Cochran was a publisher")
|
||||||
|
assert set(doc.activations["entity_linker"].keys()) == {"ents", "scores"}
|
||||||
|
ents = doc.activations["entity_linker"]["ents"]
|
||||||
|
assert isinstance(ents, Ragged)
|
||||||
|
assert ents.data.shape == (2, 1)
|
||||||
|
assert ents.data.dtype == "uint64"
|
||||||
|
assert ents.lengths.shape == (1,)
|
||||||
|
scores = doc.activations["entity_linker"]["scores"]
|
||||||
|
assert isinstance(scores, Ragged)
|
||||||
|
assert scores.data.shape == (2, 1)
|
||||||
|
assert scores.data.dtype == "float32"
|
||||||
|
assert scores.lengths.shape == (1,)
|
||||||
|
|
||||||
|
|
||||||
|
def test_span_maker_forward_with_empty():
|
||||||
|
"""The forward pass of the span maker may have a doc with no entities."""
|
||||||
|
nlp = English()
|
||||||
|
doc1 = nlp("a b c")
|
||||||
|
ent = doc1[0:1]
|
||||||
|
ent.label_ = "X"
|
||||||
|
doc1.ents = [ent]
|
||||||
|
# no entities
|
||||||
|
doc2 = nlp("x y z")
|
||||||
|
|
||||||
|
# just to get a model
|
||||||
|
span_maker = build_span_maker()
|
||||||
|
span_maker([doc1, doc2], False)
|
||||||
|
|
|
@ -4,7 +4,7 @@ from spacy import registry
|
||||||
from spacy.tokens import Doc, Span
|
from spacy.tokens import Doc, Span
|
||||||
from spacy.language import Language
|
from spacy.language import Language
|
||||||
from spacy.lang.en import English
|
from spacy.lang.en import English
|
||||||
from spacy.pipeline import EntityRuler, EntityRecognizer, merge_entities
|
from spacy.pipeline import EntityRecognizer, merge_entities
|
||||||
from spacy.pipeline import SpanRuler
|
from spacy.pipeline import SpanRuler
|
||||||
from spacy.pipeline.ner import DEFAULT_NER_MODEL
|
from spacy.pipeline.ner import DEFAULT_NER_MODEL
|
||||||
from spacy.errors import MatchPatternError
|
from spacy.errors import MatchPatternError
|
||||||
|
@ -12,8 +12,6 @@ from spacy.tests.util import make_tempdir
|
||||||
|
|
||||||
from thinc.api import NumpyOps, get_current_ops
|
from thinc.api import NumpyOps, get_current_ops
|
||||||
|
|
||||||
ENTITY_RULERS = ["entity_ruler", "future_entity_ruler"]
|
|
||||||
|
|
||||||
|
|
||||||
@pytest.fixture
|
@pytest.fixture
|
||||||
def nlp():
|
def nlp():
|
||||||
|
@ -40,13 +38,12 @@ def add_ent_component(doc):
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.issue(3345)
|
@pytest.mark.issue(3345)
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_issue3345():
|
||||||
def test_issue3345(entity_ruler_factory):
|
|
||||||
"""Test case where preset entity crosses sentence boundary."""
|
"""Test case where preset entity crosses sentence boundary."""
|
||||||
nlp = English()
|
nlp = English()
|
||||||
doc = Doc(nlp.vocab, words=["I", "live", "in", "New", "York"])
|
doc = Doc(nlp.vocab, words=["I", "live", "in", "New", "York"])
|
||||||
doc[4].is_sent_start = True
|
doc[4].is_sent_start = True
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler.add_patterns([{"label": "GPE", "pattern": "New York"}])
|
ruler.add_patterns([{"label": "GPE", "pattern": "New York"}])
|
||||||
cfg = {"model": DEFAULT_NER_MODEL}
|
cfg = {"model": DEFAULT_NER_MODEL}
|
||||||
model = registry.resolve(cfg, validate=True)["model"]
|
model = registry.resolve(cfg, validate=True)["model"]
|
||||||
|
@ -65,15 +62,14 @@ def test_issue3345(entity_ruler_factory):
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.issue(4849)
|
@pytest.mark.issue(4849)
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_issue4849():
|
||||||
def test_issue4849(entity_ruler_factory):
|
|
||||||
nlp = English()
|
nlp = English()
|
||||||
patterns = [
|
patterns = [
|
||||||
{"label": "PERSON", "pattern": "joe biden", "id": "joe-biden"},
|
{"label": "PERSON", "pattern": "joe biden", "id": "joe-biden"},
|
||||||
{"label": "PERSON", "pattern": "bernie sanders", "id": "bernie-sanders"},
|
{"label": "PERSON", "pattern": "bernie sanders", "id": "bernie-sanders"},
|
||||||
]
|
]
|
||||||
ruler = nlp.add_pipe(
|
ruler = nlp.add_pipe(
|
||||||
entity_ruler_factory,
|
"entity_ruler",
|
||||||
name="entity_ruler",
|
name="entity_ruler",
|
||||||
config={"phrase_matcher_attr": "LOWER"},
|
config={"phrase_matcher_attr": "LOWER"},
|
||||||
)
|
)
|
||||||
|
@ -96,11 +92,10 @@ def test_issue4849(entity_ruler_factory):
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.issue(5918)
|
@pytest.mark.issue(5918)
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_issue5918():
|
||||||
def test_issue5918(entity_ruler_factory):
|
|
||||||
# Test edge case when merging entities.
|
# Test edge case when merging entities.
|
||||||
nlp = English()
|
nlp = English()
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
patterns = [
|
patterns = [
|
||||||
{"label": "ORG", "pattern": "Digicon Inc"},
|
{"label": "ORG", "pattern": "Digicon Inc"},
|
||||||
{"label": "ORG", "pattern": "Rotan Mosle Inc's"},
|
{"label": "ORG", "pattern": "Rotan Mosle Inc's"},
|
||||||
|
@ -125,10 +120,9 @@ def test_issue5918(entity_ruler_factory):
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.issue(8168)
|
@pytest.mark.issue(8168)
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_issue8168():
|
||||||
def test_issue8168(entity_ruler_factory):
|
|
||||||
nlp = English()
|
nlp = English()
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
patterns = [
|
patterns = [
|
||||||
{"label": "ORG", "pattern": "Apple"},
|
{"label": "ORG", "pattern": "Apple"},
|
||||||
{
|
{
|
||||||
|
@ -148,12 +142,9 @@ def test_issue8168(entity_ruler_factory):
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.issue(8216)
|
@pytest.mark.issue(8216)
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_fix8216(nlp, patterns):
|
||||||
def test_entity_ruler_fix8216(nlp, patterns, entity_ruler_factory):
|
|
||||||
"""Test that patterns don't get added excessively."""
|
"""Test that patterns don't get added excessively."""
|
||||||
ruler = nlp.add_pipe(
|
ruler = nlp.add_pipe("entity_ruler", config={"validate": True})
|
||||||
entity_ruler_factory, name="entity_ruler", config={"validate": True}
|
|
||||||
)
|
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
pattern_count = sum(len(mm) for mm in ruler.matcher._patterns.values())
|
pattern_count = sum(len(mm) for mm in ruler.matcher._patterns.values())
|
||||||
assert pattern_count > 0
|
assert pattern_count > 0
|
||||||
|
@ -162,16 +153,15 @@ def test_entity_ruler_fix8216(nlp, patterns, entity_ruler_factory):
|
||||||
assert after_count == pattern_count
|
assert after_count == pattern_count
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_init(nlp, patterns):
|
||||||
def test_entity_ruler_init(nlp, patterns, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
assert len(ruler) == len(patterns)
|
assert len(ruler) == len(patterns)
|
||||||
assert len(ruler.labels) == 4
|
assert len(ruler.labels) == 4
|
||||||
assert "HELLO" in ruler
|
assert "HELLO" in ruler
|
||||||
assert "BYE" in ruler
|
assert "BYE" in ruler
|
||||||
nlp.remove_pipe("entity_ruler")
|
nlp.remove_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
doc = nlp("hello world bye bye")
|
doc = nlp("hello world bye bye")
|
||||||
assert len(doc.ents) == 2
|
assert len(doc.ents) == 2
|
||||||
|
@ -179,23 +169,21 @@ def test_entity_ruler_init(nlp, patterns, entity_ruler_factory):
|
||||||
assert doc.ents[1].label_ == "BYE"
|
assert doc.ents[1].label_ == "BYE"
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_no_patterns_warns(nlp):
|
||||||
def test_entity_ruler_no_patterns_warns(nlp, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
|
||||||
assert len(ruler) == 0
|
assert len(ruler) == 0
|
||||||
assert len(ruler.labels) == 0
|
assert len(ruler.labels) == 0
|
||||||
nlp.remove_pipe("entity_ruler")
|
nlp.remove_pipe("entity_ruler")
|
||||||
nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
nlp.add_pipe("entity_ruler")
|
||||||
assert nlp.pipe_names == ["entity_ruler"]
|
assert nlp.pipe_names == ["entity_ruler"]
|
||||||
with pytest.warns(UserWarning):
|
with pytest.warns(UserWarning):
|
||||||
doc = nlp("hello world bye bye")
|
doc = nlp("hello world bye bye")
|
||||||
assert len(doc.ents) == 0
|
assert len(doc.ents) == 0
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_init_patterns(nlp, patterns):
|
||||||
def test_entity_ruler_init_patterns(nlp, patterns, entity_ruler_factory):
|
|
||||||
# initialize with patterns
|
# initialize with patterns
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
assert len(ruler.labels) == 0
|
assert len(ruler.labels) == 0
|
||||||
ruler.initialize(lambda: [], patterns=patterns)
|
ruler.initialize(lambda: [], patterns=patterns)
|
||||||
assert len(ruler.labels) == 4
|
assert len(ruler.labels) == 4
|
||||||
|
@ -207,7 +195,7 @@ def test_entity_ruler_init_patterns(nlp, patterns, entity_ruler_factory):
|
||||||
nlp.config["initialize"]["components"]["entity_ruler"] = {
|
nlp.config["initialize"]["components"]["entity_ruler"] = {
|
||||||
"patterns": {"@misc": "entity_ruler_patterns"}
|
"patterns": {"@misc": "entity_ruler_patterns"}
|
||||||
}
|
}
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
assert len(ruler.labels) == 0
|
assert len(ruler.labels) == 0
|
||||||
nlp.initialize()
|
nlp.initialize()
|
||||||
assert len(ruler.labels) == 4
|
assert len(ruler.labels) == 4
|
||||||
|
@ -216,20 +204,18 @@ def test_entity_ruler_init_patterns(nlp, patterns, entity_ruler_factory):
|
||||||
assert doc.ents[1].label_ == "BYE"
|
assert doc.ents[1].label_ == "BYE"
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_init_clear(nlp, patterns):
|
||||||
def test_entity_ruler_init_clear(nlp, patterns, entity_ruler_factory):
|
|
||||||
"""Test that initialization clears patterns."""
|
"""Test that initialization clears patterns."""
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
assert len(ruler.labels) == 4
|
assert len(ruler.labels) == 4
|
||||||
ruler.initialize(lambda: [])
|
ruler.initialize(lambda: [])
|
||||||
assert len(ruler.labels) == 0
|
assert len(ruler.labels) == 0
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_clear(nlp, patterns):
|
||||||
def test_entity_ruler_clear(nlp, patterns, entity_ruler_factory):
|
|
||||||
"""Test that initialization clears patterns."""
|
"""Test that initialization clears patterns."""
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
assert len(ruler.labels) == 4
|
assert len(ruler.labels) == 4
|
||||||
doc = nlp("hello world")
|
doc = nlp("hello world")
|
||||||
|
@ -241,9 +227,8 @@ def test_entity_ruler_clear(nlp, patterns, entity_ruler_factory):
|
||||||
assert len(doc.ents) == 0
|
assert len(doc.ents) == 0
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_existing(nlp, patterns):
|
||||||
def test_entity_ruler_existing(nlp, patterns, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
nlp.add_pipe("add_ent", before="entity_ruler")
|
nlp.add_pipe("add_ent", before="entity_ruler")
|
||||||
doc = nlp("OH HELLO WORLD bye bye")
|
doc = nlp("OH HELLO WORLD bye bye")
|
||||||
|
@ -252,11 +237,8 @@ def test_entity_ruler_existing(nlp, patterns, entity_ruler_factory):
|
||||||
assert doc.ents[1].label_ == "BYE"
|
assert doc.ents[1].label_ == "BYE"
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_existing_overwrite(nlp, patterns):
|
||||||
def test_entity_ruler_existing_overwrite(nlp, patterns, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler", config={"overwrite_ents": True})
|
||||||
ruler = nlp.add_pipe(
|
|
||||||
entity_ruler_factory, name="entity_ruler", config={"overwrite_ents": True}
|
|
||||||
)
|
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
nlp.add_pipe("add_ent", before="entity_ruler")
|
nlp.add_pipe("add_ent", before="entity_ruler")
|
||||||
doc = nlp("OH HELLO WORLD bye bye")
|
doc = nlp("OH HELLO WORLD bye bye")
|
||||||
|
@ -266,11 +248,8 @@ def test_entity_ruler_existing_overwrite(nlp, patterns, entity_ruler_factory):
|
||||||
assert doc.ents[1].label_ == "BYE"
|
assert doc.ents[1].label_ == "BYE"
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_existing_complex(nlp, patterns):
|
||||||
def test_entity_ruler_existing_complex(nlp, patterns, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler", config={"overwrite_ents": True})
|
||||||
ruler = nlp.add_pipe(
|
|
||||||
entity_ruler_factory, name="entity_ruler", config={"overwrite_ents": True}
|
|
||||||
)
|
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
nlp.add_pipe("add_ent", before="entity_ruler")
|
nlp.add_pipe("add_ent", before="entity_ruler")
|
||||||
doc = nlp("foo foo bye bye")
|
doc = nlp("foo foo bye bye")
|
||||||
|
@ -281,11 +260,8 @@ def test_entity_ruler_existing_complex(nlp, patterns, entity_ruler_factory):
|
||||||
assert len(doc.ents[1]) == 2
|
assert len(doc.ents[1]) == 2
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_entity_id(nlp, patterns):
|
||||||
def test_entity_ruler_entity_id(nlp, patterns, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler", config={"overwrite_ents": True})
|
||||||
ruler = nlp.add_pipe(
|
|
||||||
entity_ruler_factory, name="entity_ruler", config={"overwrite_ents": True}
|
|
||||||
)
|
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
doc = nlp("Apple is a technology company")
|
doc = nlp("Apple is a technology company")
|
||||||
assert len(doc.ents) == 1
|
assert len(doc.ents) == 1
|
||||||
|
@ -293,26 +269,23 @@ def test_entity_ruler_entity_id(nlp, patterns, entity_ruler_factory):
|
||||||
assert doc.ents[0].ent_id_ == "a1"
|
assert doc.ents[0].ent_id_ == "a1"
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_cfg_ent_id_sep(nlp, patterns):
|
||||||
def test_entity_ruler_cfg_ent_id_sep(nlp, patterns, entity_ruler_factory):
|
|
||||||
config = {"overwrite_ents": True, "ent_id_sep": "**"}
|
config = {"overwrite_ents": True, "ent_id_sep": "**"}
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler", config=config)
|
ruler = nlp.add_pipe("entity_ruler", config=config)
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
doc = nlp("Apple is a technology company")
|
doc = nlp("Apple is a technology company")
|
||||||
if isinstance(ruler, EntityRuler):
|
|
||||||
assert "TECH_ORG**a1" in ruler.phrase_patterns
|
|
||||||
assert len(doc.ents) == 1
|
assert len(doc.ents) == 1
|
||||||
assert doc.ents[0].label_ == "TECH_ORG"
|
assert doc.ents[0].label_ == "TECH_ORG"
|
||||||
assert doc.ents[0].ent_id_ == "a1"
|
assert doc.ents[0].ent_id_ == "a1"
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_serialize_bytes(nlp, patterns):
|
||||||
def test_entity_ruler_serialize_bytes(nlp, patterns, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = EntityRuler(nlp, patterns=patterns)
|
ruler.add_patterns(patterns)
|
||||||
assert len(ruler) == len(patterns)
|
assert len(ruler) == len(patterns)
|
||||||
assert len(ruler.labels) == 4
|
assert len(ruler.labels) == 4
|
||||||
ruler_bytes = ruler.to_bytes()
|
ruler_bytes = ruler.to_bytes()
|
||||||
new_ruler = EntityRuler(nlp)
|
new_ruler = nlp.add_pipe("entity_ruler", name="new_ruler")
|
||||||
assert len(new_ruler) == 0
|
assert len(new_ruler) == 0
|
||||||
assert len(new_ruler.labels) == 0
|
assert len(new_ruler.labels) == 0
|
||||||
new_ruler = new_ruler.from_bytes(ruler_bytes)
|
new_ruler = new_ruler.from_bytes(ruler_bytes)
|
||||||
|
@ -324,28 +297,27 @@ def test_entity_ruler_serialize_bytes(nlp, patterns, entity_ruler_factory):
|
||||||
assert sorted(new_ruler.labels) == sorted(ruler.labels)
|
assert sorted(new_ruler.labels) == sorted(ruler.labels)
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_serialize_phrase_matcher_attr_bytes(nlp, patterns):
|
||||||
def test_entity_ruler_serialize_phrase_matcher_attr_bytes(
|
ruler = nlp.add_pipe("entity_ruler", config={"phrase_matcher_attr": "LOWER"})
|
||||||
nlp, patterns, entity_ruler_factory
|
ruler.add_patterns(patterns)
|
||||||
):
|
|
||||||
ruler = EntityRuler(nlp, phrase_matcher_attr="LOWER", patterns=patterns)
|
|
||||||
assert len(ruler) == len(patterns)
|
assert len(ruler) == len(patterns)
|
||||||
assert len(ruler.labels) == 4
|
assert len(ruler.labels) == 4
|
||||||
ruler_bytes = ruler.to_bytes()
|
ruler_bytes = ruler.to_bytes()
|
||||||
new_ruler = EntityRuler(nlp)
|
new_ruler = nlp.add_pipe(
|
||||||
|
"entity_ruler", name="new_ruler", config={"phrase_matcher_attr": "LOWER"}
|
||||||
|
)
|
||||||
assert len(new_ruler) == 0
|
assert len(new_ruler) == 0
|
||||||
assert len(new_ruler.labels) == 0
|
assert len(new_ruler.labels) == 0
|
||||||
assert new_ruler.phrase_matcher_attr is None
|
|
||||||
new_ruler = new_ruler.from_bytes(ruler_bytes)
|
new_ruler = new_ruler.from_bytes(ruler_bytes)
|
||||||
assert len(new_ruler) == len(patterns)
|
assert len(new_ruler) == len(patterns)
|
||||||
assert len(new_ruler.labels) == 4
|
assert len(new_ruler.labels) == 4
|
||||||
assert new_ruler.phrase_matcher_attr == "LOWER"
|
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_validate(nlp):
|
||||||
def test_entity_ruler_validate(nlp, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
validated_ruler = nlp.add_pipe(
|
||||||
validated_ruler = EntityRuler(nlp, validate=True)
|
"entity_ruler", name="validated_ruler", config={"validate": True}
|
||||||
|
)
|
||||||
|
|
||||||
valid_pattern = {"label": "HELLO", "pattern": [{"LOWER": "HELLO"}]}
|
valid_pattern = {"label": "HELLO", "pattern": [{"LOWER": "HELLO"}]}
|
||||||
invalid_pattern = {"label": "HELLO", "pattern": [{"ASDF": "HELLO"}]}
|
invalid_pattern = {"label": "HELLO", "pattern": [{"ASDF": "HELLO"}]}
|
||||||
|
@ -362,16 +334,15 @@ def test_entity_ruler_validate(nlp, entity_ruler_factory):
|
||||||
validated_ruler.add_patterns([invalid_pattern])
|
validated_ruler.add_patterns([invalid_pattern])
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_properties(nlp, patterns):
|
||||||
def test_entity_ruler_properties(nlp, patterns, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler", config={"overwrite_ents": True})
|
||||||
ruler = EntityRuler(nlp, patterns=patterns, overwrite_ents=True)
|
ruler.add_patterns(patterns)
|
||||||
assert sorted(ruler.labels) == sorted(["HELLO", "BYE", "COMPLEX", "TECH_ORG"])
|
assert sorted(ruler.labels) == sorted(["HELLO", "BYE", "COMPLEX", "TECH_ORG"])
|
||||||
assert sorted(ruler.ent_ids) == ["a1", "a2"]
|
assert sorted(ruler.ids) == ["a1", "a2"]
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_overlapping_spans(nlp):
|
||||||
def test_entity_ruler_overlapping_spans(nlp, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
|
||||||
patterns = [
|
patterns = [
|
||||||
{"label": "FOOBAR", "pattern": "foo bar"},
|
{"label": "FOOBAR", "pattern": "foo bar"},
|
||||||
{"label": "BARBAZ", "pattern": "bar baz"},
|
{"label": "BARBAZ", "pattern": "bar baz"},
|
||||||
|
@ -383,14 +354,13 @@ def test_entity_ruler_overlapping_spans(nlp, entity_ruler_factory):
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("n_process", [1, 2])
|
@pytest.mark.parametrize("n_process", [1, 2])
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_multiprocessing(nlp, n_process):
|
||||||
def test_entity_ruler_multiprocessing(nlp, n_process, entity_ruler_factory):
|
|
||||||
if isinstance(get_current_ops, NumpyOps) or n_process < 2:
|
if isinstance(get_current_ops, NumpyOps) or n_process < 2:
|
||||||
texts = ["I enjoy eating Pizza Hut pizza."]
|
texts = ["I enjoy eating Pizza Hut pizza."]
|
||||||
|
|
||||||
patterns = [{"label": "FASTFOOD", "pattern": "Pizza Hut", "id": "1234"}]
|
patterns = [{"label": "FASTFOOD", "pattern": "Pizza Hut", "id": "1234"}]
|
||||||
|
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
|
|
||||||
for doc in nlp.pipe(texts, n_process=2):
|
for doc in nlp.pipe(texts, n_process=2):
|
||||||
|
@ -398,9 +368,8 @@ def test_entity_ruler_multiprocessing(nlp, n_process, entity_ruler_factory):
|
||||||
assert ent.ent_id_ == "1234"
|
assert ent.ent_id_ == "1234"
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_serialize_jsonl(nlp, patterns):
|
||||||
def test_entity_ruler_serialize_jsonl(nlp, patterns, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
with make_tempdir() as d:
|
with make_tempdir() as d:
|
||||||
ruler.to_disk(d / "test_ruler.jsonl")
|
ruler.to_disk(d / "test_ruler.jsonl")
|
||||||
|
@ -409,9 +378,8 @@ def test_entity_ruler_serialize_jsonl(nlp, patterns, entity_ruler_factory):
|
||||||
ruler.from_disk(d / "non_existing.jsonl") # read from a bad jsonl file
|
ruler.from_disk(d / "non_existing.jsonl") # read from a bad jsonl file
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_serialize_dir(nlp, patterns):
|
||||||
def test_entity_ruler_serialize_dir(nlp, patterns, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
with make_tempdir() as d:
|
with make_tempdir() as d:
|
||||||
ruler.to_disk(d / "test_ruler")
|
ruler.to_disk(d / "test_ruler")
|
||||||
|
@ -420,9 +388,8 @@ def test_entity_ruler_serialize_dir(nlp, patterns, entity_ruler_factory):
|
||||||
ruler.from_disk(d / "non_existing_dir") # read from a bad directory
|
ruler.from_disk(d / "non_existing_dir") # read from a bad directory
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_remove_basic(nlp):
|
||||||
def test_entity_ruler_remove_basic(nlp, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
|
||||||
patterns = [
|
patterns = [
|
||||||
{"label": "PERSON", "pattern": "Dina", "id": "dina"},
|
{"label": "PERSON", "pattern": "Dina", "id": "dina"},
|
||||||
{"label": "ORG", "pattern": "ACME", "id": "acme"},
|
{"label": "ORG", "pattern": "ACME", "id": "acme"},
|
||||||
|
@ -432,24 +399,16 @@ def test_entity_ruler_remove_basic(nlp, entity_ruler_factory):
|
||||||
doc = nlp("Dina went to school")
|
doc = nlp("Dina went to school")
|
||||||
assert len(ruler.patterns) == 3
|
assert len(ruler.patterns) == 3
|
||||||
assert len(doc.ents) == 1
|
assert len(doc.ents) == 1
|
||||||
if isinstance(ruler, EntityRuler):
|
|
||||||
assert "PERSON||dina" in ruler.phrase_matcher
|
|
||||||
assert doc.ents[0].label_ == "PERSON"
|
assert doc.ents[0].label_ == "PERSON"
|
||||||
assert doc.ents[0].text == "Dina"
|
assert doc.ents[0].text == "Dina"
|
||||||
if isinstance(ruler, EntityRuler):
|
ruler.remove_by_id("dina")
|
||||||
ruler.remove("dina")
|
|
||||||
else:
|
|
||||||
ruler.remove_by_id("dina")
|
|
||||||
doc = nlp("Dina went to school")
|
doc = nlp("Dina went to school")
|
||||||
assert len(doc.ents) == 0
|
assert len(doc.ents) == 0
|
||||||
if isinstance(ruler, EntityRuler):
|
|
||||||
assert "PERSON||dina" not in ruler.phrase_matcher
|
|
||||||
assert len(ruler.patterns) == 2
|
assert len(ruler.patterns) == 2
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_remove_same_id_multiple_patterns(nlp):
|
||||||
def test_entity_ruler_remove_same_id_multiple_patterns(nlp, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
|
||||||
patterns = [
|
patterns = [
|
||||||
{"label": "PERSON", "pattern": "Dina", "id": "dina"},
|
{"label": "PERSON", "pattern": "Dina", "id": "dina"},
|
||||||
{"label": "ORG", "pattern": "DinaCorp", "id": "dina"},
|
{"label": "ORG", "pattern": "DinaCorp", "id": "dina"},
|
||||||
|
@ -458,25 +417,15 @@ def test_entity_ruler_remove_same_id_multiple_patterns(nlp, entity_ruler_factory
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
doc = nlp("Dina founded DinaCorp and ACME.")
|
doc = nlp("Dina founded DinaCorp and ACME.")
|
||||||
assert len(ruler.patterns) == 3
|
assert len(ruler.patterns) == 3
|
||||||
if isinstance(ruler, EntityRuler):
|
|
||||||
assert "PERSON||dina" in ruler.phrase_matcher
|
|
||||||
assert "ORG||dina" in ruler.phrase_matcher
|
|
||||||
assert len(doc.ents) == 3
|
assert len(doc.ents) == 3
|
||||||
if isinstance(ruler, EntityRuler):
|
ruler.remove_by_id("dina")
|
||||||
ruler.remove("dina")
|
|
||||||
else:
|
|
||||||
ruler.remove_by_id("dina")
|
|
||||||
doc = nlp("Dina founded DinaCorp and ACME.")
|
doc = nlp("Dina founded DinaCorp and ACME.")
|
||||||
assert len(ruler.patterns) == 1
|
assert len(ruler.patterns) == 1
|
||||||
if isinstance(ruler, EntityRuler):
|
|
||||||
assert "PERSON||dina" not in ruler.phrase_matcher
|
|
||||||
assert "ORG||dina" not in ruler.phrase_matcher
|
|
||||||
assert len(doc.ents) == 1
|
assert len(doc.ents) == 1
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_remove_nonexisting_pattern(nlp):
|
||||||
def test_entity_ruler_remove_nonexisting_pattern(nlp, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
|
||||||
patterns = [
|
patterns = [
|
||||||
{"label": "PERSON", "pattern": "Dina", "id": "dina"},
|
{"label": "PERSON", "pattern": "Dina", "id": "dina"},
|
||||||
{"label": "ORG", "pattern": "ACME", "id": "acme"},
|
{"label": "ORG", "pattern": "ACME", "id": "acme"},
|
||||||
|
@ -491,9 +440,8 @@ def test_entity_ruler_remove_nonexisting_pattern(nlp, entity_ruler_factory):
|
||||||
ruler.remove_by_id("nepattern")
|
ruler.remove_by_id("nepattern")
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_remove_several_patterns(nlp):
|
||||||
def test_entity_ruler_remove_several_patterns(nlp, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
|
||||||
patterns = [
|
patterns = [
|
||||||
{"label": "PERSON", "pattern": "Dina", "id": "dina"},
|
{"label": "PERSON", "pattern": "Dina", "id": "dina"},
|
||||||
{"label": "ORG", "pattern": "ACME", "id": "acme"},
|
{"label": "ORG", "pattern": "ACME", "id": "acme"},
|
||||||
|
@ -507,27 +455,20 @@ def test_entity_ruler_remove_several_patterns(nlp, entity_ruler_factory):
|
||||||
assert doc.ents[0].text == "Dina"
|
assert doc.ents[0].text == "Dina"
|
||||||
assert doc.ents[1].label_ == "ORG"
|
assert doc.ents[1].label_ == "ORG"
|
||||||
assert doc.ents[1].text == "ACME"
|
assert doc.ents[1].text == "ACME"
|
||||||
if isinstance(ruler, EntityRuler):
|
ruler.remove_by_id("dina")
|
||||||
ruler.remove("dina")
|
|
||||||
else:
|
|
||||||
ruler.remove_by_id("dina")
|
|
||||||
doc = nlp("Dina founded her company ACME")
|
doc = nlp("Dina founded her company ACME")
|
||||||
assert len(ruler.patterns) == 2
|
assert len(ruler.patterns) == 2
|
||||||
assert len(doc.ents) == 1
|
assert len(doc.ents) == 1
|
||||||
assert doc.ents[0].label_ == "ORG"
|
assert doc.ents[0].label_ == "ORG"
|
||||||
assert doc.ents[0].text == "ACME"
|
assert doc.ents[0].text == "ACME"
|
||||||
if isinstance(ruler, EntityRuler):
|
ruler.remove_by_id("acme")
|
||||||
ruler.remove("acme")
|
|
||||||
else:
|
|
||||||
ruler.remove_by_id("acme")
|
|
||||||
doc = nlp("Dina founded her company ACME")
|
doc = nlp("Dina founded her company ACME")
|
||||||
assert len(ruler.patterns) == 1
|
assert len(ruler.patterns) == 1
|
||||||
assert len(doc.ents) == 0
|
assert len(doc.ents) == 0
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_remove_patterns_in_a_row(nlp):
|
||||||
def test_entity_ruler_remove_patterns_in_a_row(nlp, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
|
||||||
patterns = [
|
patterns = [
|
||||||
{"label": "PERSON", "pattern": "Dina", "id": "dina"},
|
{"label": "PERSON", "pattern": "Dina", "id": "dina"},
|
||||||
{"label": "ORG", "pattern": "ACME", "id": "acme"},
|
{"label": "ORG", "pattern": "ACME", "id": "acme"},
|
||||||
|
@ -543,21 +484,15 @@ def test_entity_ruler_remove_patterns_in_a_row(nlp, entity_ruler_factory):
|
||||||
assert doc.ents[1].text == "ACME"
|
assert doc.ents[1].text == "ACME"
|
||||||
assert doc.ents[2].label_ == "DATE"
|
assert doc.ents[2].label_ == "DATE"
|
||||||
assert doc.ents[2].text == "her birthday"
|
assert doc.ents[2].text == "her birthday"
|
||||||
if isinstance(ruler, EntityRuler):
|
ruler.remove_by_id("dina")
|
||||||
ruler.remove("dina")
|
ruler.remove_by_id("acme")
|
||||||
ruler.remove("acme")
|
ruler.remove_by_id("bday")
|
||||||
ruler.remove("bday")
|
|
||||||
else:
|
|
||||||
ruler.remove_by_id("dina")
|
|
||||||
ruler.remove_by_id("acme")
|
|
||||||
ruler.remove_by_id("bday")
|
|
||||||
doc = nlp("Dina went to school")
|
doc = nlp("Dina went to school")
|
||||||
assert len(doc.ents) == 0
|
assert len(doc.ents) == 0
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_remove_all_patterns(nlp):
|
||||||
def test_entity_ruler_remove_all_patterns(nlp, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
|
||||||
patterns = [
|
patterns = [
|
||||||
{"label": "PERSON", "pattern": "Dina", "id": "dina"},
|
{"label": "PERSON", "pattern": "Dina", "id": "dina"},
|
||||||
{"label": "ORG", "pattern": "ACME", "id": "acme"},
|
{"label": "ORG", "pattern": "ACME", "id": "acme"},
|
||||||
|
@ -565,29 +500,19 @@ def test_entity_ruler_remove_all_patterns(nlp, entity_ruler_factory):
|
||||||
]
|
]
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
assert len(ruler.patterns) == 3
|
assert len(ruler.patterns) == 3
|
||||||
if isinstance(ruler, EntityRuler):
|
ruler.remove_by_id("dina")
|
||||||
ruler.remove("dina")
|
|
||||||
else:
|
|
||||||
ruler.remove_by_id("dina")
|
|
||||||
assert len(ruler.patterns) == 2
|
assert len(ruler.patterns) == 2
|
||||||
if isinstance(ruler, EntityRuler):
|
ruler.remove_by_id("acme")
|
||||||
ruler.remove("acme")
|
|
||||||
else:
|
|
||||||
ruler.remove_by_id("acme")
|
|
||||||
assert len(ruler.patterns) == 1
|
assert len(ruler.patterns) == 1
|
||||||
if isinstance(ruler, EntityRuler):
|
ruler.remove_by_id("bday")
|
||||||
ruler.remove("bday")
|
|
||||||
else:
|
|
||||||
ruler.remove_by_id("bday")
|
|
||||||
assert len(ruler.patterns) == 0
|
assert len(ruler.patterns) == 0
|
||||||
with pytest.warns(UserWarning):
|
with pytest.warns(UserWarning):
|
||||||
doc = nlp("Dina founded her company ACME on her birthday")
|
doc = nlp("Dina founded her company ACME on her birthday")
|
||||||
assert len(doc.ents) == 0
|
assert len(doc.ents) == 0
|
||||||
|
|
||||||
|
|
||||||
@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS)
|
def test_entity_ruler_remove_and_add(nlp):
|
||||||
def test_entity_ruler_remove_and_add(nlp, entity_ruler_factory):
|
ruler = nlp.add_pipe("entity_ruler")
|
||||||
ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler")
|
|
||||||
patterns = [{"label": "DATE", "pattern": "last time"}]
|
patterns = [{"label": "DATE", "pattern": "last time"}]
|
||||||
ruler.add_patterns(patterns)
|
ruler.add_patterns(patterns)
|
||||||
doc = ruler(
|
doc = ruler(
|
||||||
|
@ -608,10 +533,7 @@ def test_entity_ruler_remove_and_add(nlp, entity_ruler_factory):
|
||||||
assert doc.ents[0].text == "last time"
|
assert doc.ents[0].text == "last time"
|
||||||
assert doc.ents[1].label_ == "DATE"
|
assert doc.ents[1].label_ == "DATE"
|
||||||
assert doc.ents[1].text == "this time"
|
assert doc.ents[1].text == "this time"
|
||||||
if isinstance(ruler, EntityRuler):
|
ruler.remove_by_id("ttime")
|
||||||
ruler.remove("ttime")
|
|
||||||
else:
|
|
||||||
ruler.remove_by_id("ttime")
|
|
||||||
doc = ruler(
|
doc = ruler(
|
||||||
nlp.make_doc("I saw him last time we met, this time he brought some flowers")
|
nlp.make_doc("I saw him last time we met, this time he brought some flowers")
|
||||||
)
|
)
|
||||||
|
@ -634,10 +556,7 @@ def test_entity_ruler_remove_and_add(nlp, entity_ruler_factory):
|
||||||
)
|
)
|
||||||
assert len(ruler.patterns) == 3
|
assert len(ruler.patterns) == 3
|
||||||
assert len(doc.ents) == 3
|
assert len(doc.ents) == 3
|
||||||
if isinstance(ruler, EntityRuler):
|
ruler.remove_by_id("ttime")
|
||||||
ruler.remove("ttime")
|
|
||||||
else:
|
|
||||||
ruler.remove_by_id("ttime")
|
|
||||||
doc = ruler(
|
doc = ruler(
|
||||||
nlp.make_doc(
|
nlp.make_doc(
|
||||||
"I saw him last time we met, this time he brought some flowers, another time some chocolate."
|
"I saw him last time we met, this time he brought some flowers, another time some chocolate."
|
||||||
|
|
|
@ -1,3 +1,4 @@
|
||||||
|
from typing import cast
|
||||||
import pytest
|
import pytest
|
||||||
from numpy.testing import assert_equal
|
from numpy.testing import assert_equal
|
||||||
|
|
||||||
|
@ -7,6 +8,7 @@ from spacy.lang.en import English
|
||||||
from spacy.language import Language
|
from spacy.language import Language
|
||||||
from spacy.tests.util import make_tempdir
|
from spacy.tests.util import make_tempdir
|
||||||
from spacy.morphology import Morphology
|
from spacy.morphology import Morphology
|
||||||
|
from spacy.pipeline import TrainablePipe
|
||||||
from spacy.attrs import MORPH
|
from spacy.attrs import MORPH
|
||||||
from spacy.tokens import Doc
|
from spacy.tokens import Doc
|
||||||
|
|
||||||
|
@ -197,3 +199,25 @@ def test_overfitting_IO():
|
||||||
gold_pos_tags = ["NOUN", "NOUN", "NOUN", "NOUN"]
|
gold_pos_tags = ["NOUN", "NOUN", "NOUN", "NOUN"]
|
||||||
assert [str(t.morph) for t in doc] == gold_morphs
|
assert [str(t.morph) for t in doc] == gold_morphs
|
||||||
assert [t.pos_ for t in doc] == gold_pos_tags
|
assert [t.pos_ for t in doc] == gold_pos_tags
|
||||||
|
|
||||||
|
|
||||||
|
def test_save_activations():
|
||||||
|
nlp = English()
|
||||||
|
morphologizer = cast(TrainablePipe, nlp.add_pipe("morphologizer"))
|
||||||
|
train_examples = []
|
||||||
|
for inst in TRAIN_DATA:
|
||||||
|
train_examples.append(Example.from_dict(nlp.make_doc(inst[0]), inst[1]))
|
||||||
|
nlp.initialize(get_examples=lambda: train_examples)
|
||||||
|
|
||||||
|
doc = nlp("This is a test.")
|
||||||
|
assert "morphologizer" not in doc.activations
|
||||||
|
|
||||||
|
morphologizer.save_activations = True
|
||||||
|
doc = nlp("This is a test.")
|
||||||
|
assert "morphologizer" in doc.activations
|
||||||
|
assert set(doc.activations["morphologizer"].keys()) == {
|
||||||
|
"label_ids",
|
||||||
|
"probabilities",
|
||||||
|
}
|
||||||
|
assert doc.activations["morphologizer"]["probabilities"].shape == (5, 6)
|
||||||
|
assert doc.activations["morphologizer"]["label_ids"].shape == (5,)
|
||||||
|
|
|
@ -605,10 +605,35 @@ def test_update_with_annotates():
|
||||||
assert results[component] == ""
|
assert results[component] == ""
|
||||||
|
|
||||||
|
|
||||||
def test_load_disable_enable() -> None:
|
@pytest.mark.issue(11443)
|
||||||
"""
|
def test_enable_disable_conflict_with_config():
|
||||||
Tests spacy.load() with dis-/enabling components.
|
"""Test conflict between enable/disable w.r.t. `nlp.disabled` set in the config."""
|
||||||
"""
|
nlp = English()
|
||||||
|
nlp.add_pipe("tagger")
|
||||||
|
nlp.add_pipe("senter")
|
||||||
|
nlp.add_pipe("sentencizer")
|
||||||
|
|
||||||
|
with make_tempdir() as tmp_dir:
|
||||||
|
nlp.to_disk(tmp_dir)
|
||||||
|
# Expected to fail, as config and arguments conflict.
|
||||||
|
with pytest.raises(ValueError):
|
||||||
|
spacy.load(
|
||||||
|
tmp_dir, enable=["tagger"], config={"nlp": {"disabled": ["senter"]}}
|
||||||
|
)
|
||||||
|
# Expected to succeed without warning due to the lack of a conflicting config option.
|
||||||
|
spacy.load(tmp_dir, enable=["tagger"])
|
||||||
|
# Expected to succeed with a warning, as disable=[] should override the config setting.
|
||||||
|
with pytest.warns(UserWarning):
|
||||||
|
spacy.load(
|
||||||
|
tmp_dir,
|
||||||
|
enable=["tagger"],
|
||||||
|
disable=[],
|
||||||
|
config={"nlp": {"disabled": ["senter"]}},
|
||||||
|
)
|
||||||
|
|
||||||
|
|
||||||
|
def test_load_disable_enable():
|
||||||
|
"""Tests spacy.load() with dis-/enabling components."""
|
||||||
|
|
||||||
base_nlp = English()
|
base_nlp = English()
|
||||||
for pipe in ("sentencizer", "tagger", "parser"):
|
for pipe in ("sentencizer", "tagger", "parser"):
|
||||||
|
@ -618,6 +643,7 @@ def test_load_disable_enable() -> None:
|
||||||
base_nlp.to_disk(tmp_dir)
|
base_nlp.to_disk(tmp_dir)
|
||||||
to_disable = ["parser", "tagger"]
|
to_disable = ["parser", "tagger"]
|
||||||
to_enable = ["tagger", "parser"]
|
to_enable = ["tagger", "parser"]
|
||||||
|
single_str = "tagger"
|
||||||
|
|
||||||
# Setting only `disable`.
|
# Setting only `disable`.
|
||||||
nlp = spacy.load(tmp_dir, disable=to_disable)
|
nlp = spacy.load(tmp_dir, disable=to_disable)
|
||||||
|
@ -632,6 +658,16 @@ def test_load_disable_enable() -> None:
|
||||||
]
|
]
|
||||||
)
|
)
|
||||||
|
|
||||||
|
# Loading with a string representing one component
|
||||||
|
nlp = spacy.load(tmp_dir, exclude=single_str)
|
||||||
|
assert single_str not in nlp.component_names
|
||||||
|
|
||||||
|
nlp = spacy.load(tmp_dir, disable=single_str)
|
||||||
|
assert single_str in nlp.component_names
|
||||||
|
assert single_str not in nlp.pipe_names
|
||||||
|
assert nlp._disabled == {single_str}
|
||||||
|
assert nlp.disabled == [single_str]
|
||||||
|
|
||||||
# Testing consistent enable/disable combination.
|
# Testing consistent enable/disable combination.
|
||||||
nlp = spacy.load(
|
nlp = spacy.load(
|
||||||
tmp_dir,
|
tmp_dir,
|
||||||
|
|
|
@ -1,3 +1,4 @@
|
||||||
|
from typing import cast
|
||||||
import pytest
|
import pytest
|
||||||
from numpy.testing import assert_equal
|
from numpy.testing import assert_equal
|
||||||
from spacy.attrs import SENT_START
|
from spacy.attrs import SENT_START
|
||||||
|
@ -6,6 +7,7 @@ from spacy import util
|
||||||
from spacy.training import Example
|
from spacy.training import Example
|
||||||
from spacy.lang.en import English
|
from spacy.lang.en import English
|
||||||
from spacy.language import Language
|
from spacy.language import Language
|
||||||
|
from spacy.pipeline import TrainablePipe
|
||||||
from spacy.tests.util import make_tempdir
|
from spacy.tests.util import make_tempdir
|
||||||
|
|
||||||
|
|
||||||
|
@ -101,3 +103,26 @@ def test_overfitting_IO():
|
||||||
# test internal pipe labels vs. Language.pipe_labels with hidden labels
|
# test internal pipe labels vs. Language.pipe_labels with hidden labels
|
||||||
assert nlp.get_pipe("senter").labels == ("I", "S")
|
assert nlp.get_pipe("senter").labels == ("I", "S")
|
||||||
assert "senter" not in nlp.pipe_labels
|
assert "senter" not in nlp.pipe_labels
|
||||||
|
|
||||||
|
|
||||||
|
def test_save_activations():
|
||||||
|
# Test if activations are correctly added to Doc when requested.
|
||||||
|
nlp = English()
|
||||||
|
senter = cast(TrainablePipe, nlp.add_pipe("senter"))
|
||||||
|
|
||||||
|
train_examples = []
|
||||||
|
for t in TRAIN_DATA:
|
||||||
|
train_examples.append(Example.from_dict(nlp.make_doc(t[0]), t[1]))
|
||||||
|
|
||||||
|
nlp.initialize(get_examples=lambda: train_examples)
|
||||||
|
nO = senter.model.get_dim("nO")
|
||||||
|
|
||||||
|
doc = nlp("This is a test.")
|
||||||
|
assert "senter" not in doc.activations
|
||||||
|
|
||||||
|
senter.save_activations = True
|
||||||
|
doc = nlp("This is a test.")
|
||||||
|
assert "senter" in doc.activations
|
||||||
|
assert set(doc.activations["senter"].keys()) == {"label_ids", "probabilities"}
|
||||||
|
assert doc.activations["senter"]["probabilities"].shape == (5, nO)
|
||||||
|
assert doc.activations["senter"]["label_ids"].shape == (5,)
|
||||||
|
|
|
@ -1,7 +1,7 @@
|
||||||
import pytest
|
import pytest
|
||||||
import numpy
|
import numpy
|
||||||
from numpy.testing import assert_array_equal, assert_almost_equal
|
from numpy.testing import assert_array_equal, assert_almost_equal
|
||||||
from thinc.api import get_current_ops, Ragged
|
from thinc.api import get_current_ops, Ragged, fix_random_seed
|
||||||
|
|
||||||
from spacy import util
|
from spacy import util
|
||||||
from spacy.lang.en import English
|
from spacy.lang.en import English
|
||||||
|
@ -9,7 +9,7 @@ from spacy.language import Language
|
||||||
from spacy.tokens import SpanGroup
|
from spacy.tokens import SpanGroup
|
||||||
from spacy.tokens.span_groups import SpanGroups
|
from spacy.tokens.span_groups import SpanGroups
|
||||||
from spacy.training import Example
|
from spacy.training import Example
|
||||||
from spacy.util import fix_random_seed, registry, make_tempdir
|
from spacy.util import registry, make_tempdir
|
||||||
|
|
||||||
OPS = get_current_ops()
|
OPS = get_current_ops()
|
||||||
|
|
||||||
|
@ -419,3 +419,23 @@ def test_set_candidates():
|
||||||
assert len(docs[0].spans["candidates"]) == 9
|
assert len(docs[0].spans["candidates"]) == 9
|
||||||
assert docs[0].spans["candidates"][0].text == "Just"
|
assert docs[0].spans["candidates"][0].text == "Just"
|
||||||
assert docs[0].spans["candidates"][4].text == "Just a"
|
assert docs[0].spans["candidates"][4].text == "Just a"
|
||||||
|
|
||||||
|
|
||||||
|
def test_save_activations():
|
||||||
|
# Test if activations are correctly added to Doc when requested.
|
||||||
|
nlp = English()
|
||||||
|
spancat = nlp.add_pipe("spancat", config={"spans_key": SPAN_KEY})
|
||||||
|
train_examples = make_examples(nlp)
|
||||||
|
nlp.initialize(get_examples=lambda: train_examples)
|
||||||
|
nO = spancat.model.get_dim("nO")
|
||||||
|
assert nO == 2
|
||||||
|
assert set(spancat.labels) == {"LOC", "PERSON"}
|
||||||
|
|
||||||
|
doc = nlp("This is a test.")
|
||||||
|
assert "spancat" not in doc.activations
|
||||||
|
|
||||||
|
spancat.save_activations = True
|
||||||
|
doc = nlp("This is a test.")
|
||||||
|
assert set(doc.activations["spancat"].keys()) == {"indices", "scores"}
|
||||||
|
assert doc.activations["spancat"]["indices"].shape == (12, 2)
|
||||||
|
assert doc.activations["spancat"]["scores"].shape == (12, nO)
|
||||||
|
|
|
@ -1,3 +1,4 @@
|
||||||
|
from typing import cast
|
||||||
import pytest
|
import pytest
|
||||||
from numpy.testing import assert_equal
|
from numpy.testing import assert_equal
|
||||||
from spacy.attrs import TAG
|
from spacy.attrs import TAG
|
||||||
|
@ -6,6 +7,7 @@ from spacy import util
|
||||||
from spacy.training import Example
|
from spacy.training import Example
|
||||||
from spacy.lang.en import English
|
from spacy.lang.en import English
|
||||||
from spacy.language import Language
|
from spacy.language import Language
|
||||||
|
from spacy.pipeline import TrainablePipe
|
||||||
from thinc.api import compounding
|
from thinc.api import compounding
|
||||||
|
|
||||||
from ..util import make_tempdir
|
from ..util import make_tempdir
|
||||||
|
@ -211,6 +213,26 @@ def test_overfitting_IO():
|
||||||
assert doc3[0].tag_ != "N"
|
assert doc3[0].tag_ != "N"
|
||||||
|
|
||||||
|
|
||||||
|
def test_save_activations():
|
||||||
|
# Test if activations are correctly added to Doc when requested.
|
||||||
|
nlp = English()
|
||||||
|
tagger = cast(TrainablePipe, nlp.add_pipe("tagger"))
|
||||||
|
train_examples = []
|
||||||
|
for t in TRAIN_DATA:
|
||||||
|
train_examples.append(Example.from_dict(nlp.make_doc(t[0]), t[1]))
|
||||||
|
nlp.initialize(get_examples=lambda: train_examples)
|
||||||
|
|
||||||
|
doc = nlp("This is a test.")
|
||||||
|
assert "tagger" not in doc.activations
|
||||||
|
|
||||||
|
tagger.save_activations = True
|
||||||
|
doc = nlp("This is a test.")
|
||||||
|
assert "tagger" in doc.activations
|
||||||
|
assert set(doc.activations["tagger"].keys()) == {"label_ids", "probabilities"}
|
||||||
|
assert doc.activations["tagger"]["probabilities"].shape == (5, len(TAGS))
|
||||||
|
assert doc.activations["tagger"]["label_ids"].shape == (5,)
|
||||||
|
|
||||||
|
|
||||||
def test_tagger_requires_labels():
|
def test_tagger_requires_labels():
|
||||||
nlp = English()
|
nlp = English()
|
||||||
nlp.add_pipe("tagger")
|
nlp.add_pipe("tagger")
|
||||||
|
|
Some files were not shown because too many files have changed in this diff Show More
Loading…
Reference in New Issue
Block a user