From c09d2fa25bae47f0c70a3dde6bc2bc43c044b231 Mon Sep 17 00:00:00 2001 From: Tobius Saul <30893923+tobiusaolo@users.noreply.github.com> Date: Tue, 23 Aug 2022 14:09:36 +0300 Subject: [PATCH 01/34] luganda language extension (#10847) * luganda language extension * __init__.py changes * New enhancements * Lexical attribute changed * punctuaction and sentence additions * Remove comment header * Fix typos, reformat * reformated version * Add tokenizer test * Remove contractions from stop words * Format * Add Luganda to website Co-authored-by: Adriane Boyd --- spacy/lang/lg/__init__.py | 18 +++++ spacy/lang/lg/examples.py | 17 +++++ spacy/lang/lg/lex_attrs.py | 95 +++++++++++++++++++++++++++ spacy/lang/lg/punctuation.py | 19 ++++++ spacy/lang/lg/stop_words.py | 19 ++++++ spacy/tests/conftest.py | 5 ++ spacy/tests/lang/lg/__init__.py | 0 spacy/tests/lang/lg/test_tokenizer.py | 15 +++++ website/meta/languages.json | 5 ++ 9 files changed, 193 insertions(+) create mode 100644 spacy/lang/lg/__init__.py create mode 100644 spacy/lang/lg/examples.py create mode 100644 spacy/lang/lg/lex_attrs.py create mode 100644 spacy/lang/lg/punctuation.py create mode 100644 spacy/lang/lg/stop_words.py create mode 100644 spacy/tests/lang/lg/__init__.py create mode 100644 spacy/tests/lang/lg/test_tokenizer.py diff --git a/spacy/lang/lg/__init__.py b/spacy/lang/lg/__init__.py new file mode 100644 index 000000000..6f7153fce --- /dev/null +++ b/spacy/lang/lg/__init__.py @@ -0,0 +1,18 @@ +from .stop_words import STOP_WORDS +from .lex_attrs import LEX_ATTRS +from .punctuation import TOKENIZER_INFIXES +from ...language import Language, BaseDefaults + + +class LugandaDefaults(BaseDefaults): + lex_attr_getters = LEX_ATTRS + infixes = TOKENIZER_INFIXES + stop_words = STOP_WORDS + + +class Luganda(Language): + lang = "lg" + Defaults = LugandaDefaults + + +__all__ = ["Luganda"] diff --git a/spacy/lang/lg/examples.py b/spacy/lang/lg/examples.py new file mode 100644 index 000000000..5450c5520 --- /dev/null +++ b/spacy/lang/lg/examples.py @@ -0,0 +1,17 @@ +""" +Example sentences to test spaCy and its language models. + +>>> from spacy.lang.lg.examples import sentences +>>> docs = nlp.pipe(sentences) +""" + +sentences = [ + "Mpa ebyafaayo ku byalo Nakatu ne Nkajja", + "Okuyita Ttembo kitegeeza kugwa ddalu", + "Ekifumu kino kyali kya mulimu ki?", + "Ekkovu we liyise wayitibwa mukululo", + "Akola mulimu ki oguvaamu ssente?", + "Emisumaali egikomerera embaawo giyitibwa nninga", + "Abooluganda ab’emmamba ababiri", + "Ekisaawe ky'ebyenjigiriza kya mugaso nnyo", +] diff --git a/spacy/lang/lg/lex_attrs.py b/spacy/lang/lg/lex_attrs.py new file mode 100644 index 000000000..3c60e3d0e --- /dev/null +++ b/spacy/lang/lg/lex_attrs.py @@ -0,0 +1,95 @@ +from ...attrs import LIKE_NUM + +_num_words = [ + "nnooti", # Zero + "zeero", # zero + "emu", # one + "bbiri", # two + "ssatu", # three + "nnya", # four + "ttaano", # five + "mukaaga", # six + "musanvu", # seven + "munaana", # eight + "mwenda", # nine + "kkumi", # ten + "kkumi n'emu", # eleven + "kkumi na bbiri", # twelve + "kkumi na ssatu", # thirteen + "kkumi na nnya", # forteen + "kkumi na ttaano", # fifteen + "kkumi na mukaaga", # sixteen + "kkumi na musanvu", # seventeen + "kkumi na munaana", # eighteen + "kkumi na mwenda", # nineteen + "amakumi abiri", # twenty + "amakumi asatu", # thirty + "amakumi ana", # forty + "amakumi ataano", # fifty + "nkaaga", # sixty + "nsanvu", # seventy + "kinaana", # eighty + "kyenda", # ninety + "kikumi", # hundred + "lukumi", # thousand + "kakadde", # million + "kawumbi", # billion + "kase", # trillion + "katabalika", # quadrillion + "keesedde", # gajillion + "kafukunya", # bazillion + "ekisooka", # first + "ekyokubiri", # second + "ekyokusatu", # third + "ekyokuna", # fourth + "ekyokutaano", # fifith + "ekyomukaaga", # sixth + "ekyomusanvu", # seventh + "eky'omunaana", # eighth + "ekyomwenda", # nineth + "ekyekkumi", # tenth + "ekyekkumi n'ekimu", # eleventh + "ekyekkumi n'ebibiri", # twelveth + "ekyekkumi n'ebisatu", # thirteenth + "ekyekkumi n'ebina", # fourteenth + "ekyekkumi n'ebitaano", # fifteenth + "ekyekkumi n'omukaaga", # sixteenth + "ekyekkumi n'omusanvu", # seventeenth + "ekyekkumi n'omunaana", # eigteenth + "ekyekkumi n'omwenda", # nineteenth + "ekyamakumi abiri", # twentieth + "ekyamakumi asatu", # thirtieth + "ekyamakumi ana", # fortieth + "ekyamakumi ataano", # fiftieth + "ekyenkaaga", # sixtieth + "ekyensanvu", # seventieth + "ekyekinaana", # eightieth + "ekyekyenda", # ninetieth + "ekyekikumi", # hundredth + "ekyolukumi", # thousandth + "ekyakakadde", # millionth + "ekyakawumbi", # billionth + "ekyakase", # trillionth + "ekyakatabalika", # quadrillionth + "ekyakeesedde", # gajillionth + "ekyakafukunya", # bazillionth +] + + +def like_num(text): + if text.startswith(("+", "-", "±", "~")): + text = text[1:] + text = text.replace(",", "").replace(".", "") + if text.isdigit(): + return True + if text.count("/") == 1: + num, denom = text.split("/") + if num.isdigit() and denom.isdigit(): + return True + text_lower = text.lower() + if text_lower in _num_words: + return True + return False + + +LEX_ATTRS = {LIKE_NUM: like_num} diff --git a/spacy/lang/lg/punctuation.py b/spacy/lang/lg/punctuation.py new file mode 100644 index 000000000..5d3eb792e --- /dev/null +++ b/spacy/lang/lg/punctuation.py @@ -0,0 +1,19 @@ +from ..char_classes import LIST_ELLIPSES, LIST_ICONS, HYPHENS +from ..char_classes import CONCAT_QUOTES, ALPHA_LOWER, ALPHA_UPPER, ALPHA + +_infixes = ( + LIST_ELLIPSES + + LIST_ICONS + + [ + r"(?<=[0-9])[+\-\*^](?=[0-9-])", + r"(?<=[{al}{q}])\.(?=[{au}{q}])".format( + al=ALPHA_LOWER, au=ALPHA_UPPER, q=CONCAT_QUOTES + ), + r"(?<=[{a}]),(?=[{a}])".format(a=ALPHA), + r"(?<=[{a}0-9])(?:{h})(?=[{a}])".format(a=ALPHA, h=HYPHENS), + r"(?<=[{a}0-9])[:<>=/](?=[{a}])".format(a=ALPHA), + ] +) + + +TOKENIZER_INFIXES = _infixes diff --git a/spacy/lang/lg/stop_words.py b/spacy/lang/lg/stop_words.py new file mode 100644 index 000000000..7bad59344 --- /dev/null +++ b/spacy/lang/lg/stop_words.py @@ -0,0 +1,19 @@ +STOP_WORDS = set( + """ +abadde abalala abamu abangi abava ajja ali alina ani anti ateekeddwa atewamu +atya awamu aweebwa ayinza ba baali babadde babalina bajja +bajjanewankubade bali balina bandi bangi bano bateekeddwa baweebwa bayina bebombi beera bibye +bimu bingi bino bo bokka bonna buli bulijjo bulungi bwabwe bwaffe bwayo bwe bwonna bya byabwe +byaffe byebimu byonna ddaa ddala ddi e ebimu ebiri ebweruobulungi ebyo edda ejja ekirala ekyo +endala engeri ennyo era erimu erina ffe ffenna ga gujja gumu gunno guno gwa gwe kaseera kati +kennyini ki kiki kikino kikye kikyo kino kirungi kki ku kubangabyombi kubangaolwokuba kudda +kuva kuwa kwegamba kyaffe kye kyekimuoyo kyekyo kyonna leero liryo lwa lwaki lyabwezaabwe +lyaffe lyange mbadde mingi mpozzi mu mulinaoyina munda mwegyabwe nolwekyo nabadde nabo nandiyagadde +nandiye nanti naye ne nedda neera nga nnyingi nnyini nnyinza nnyo nti nyinza nze oba ojja okudda +okugenda okuggyako okutuusa okuva okuwa oli olina oluvannyuma olwekyobuva omuli ono osobola otya +oyina oyo seetaaga si sinakindi singa talina tayina tebaali tebaalina tebayina terina tetulina +tetuteekeddwa tewali teyalina teyayina tolina tu tuyina tulina tuyina twafuna twetaaga wa wabula +wabweru wadde waggulunnina wakati waliwobangi waliyo wandi wange wano wansi weebwa yabadde yaffe +ye yenna yennyini yina yonna ziba zijja zonna +""".split() +) diff --git a/spacy/tests/conftest.py b/spacy/tests/conftest.py index eb643ec2f..5193bd301 100644 --- a/spacy/tests/conftest.py +++ b/spacy/tests/conftest.py @@ -261,6 +261,11 @@ def lb_tokenizer(): return get_lang_class("lb")().tokenizer +@pytest.fixture(scope="session") +def lg_tokenizer(): + return get_lang_class("lg")().tokenizer + + @pytest.fixture(scope="session") def lt_tokenizer(): return get_lang_class("lt")().tokenizer diff --git a/spacy/tests/lang/lg/__init__.py b/spacy/tests/lang/lg/__init__.py new file mode 100644 index 000000000..e69de29bb diff --git a/spacy/tests/lang/lg/test_tokenizer.py b/spacy/tests/lang/lg/test_tokenizer.py new file mode 100644 index 000000000..958385a77 --- /dev/null +++ b/spacy/tests/lang/lg/test_tokenizer.py @@ -0,0 +1,15 @@ +import pytest + +LG_BASIC_TOKENIZATION_TESTS = [ + ( + "Abooluganda ab’emmamba ababiri", + ["Abooluganda", "ab’emmamba", "ababiri"], + ), +] + + +@pytest.mark.parametrize("text,expected_tokens", LG_BASIC_TOKENIZATION_TESTS) +def test_lg_tokenizer_basic(lg_tokenizer, text, expected_tokens): + tokens = lg_tokenizer(text) + token_list = [token.text for token in tokens if not token.is_space] + assert expected_tokens == token_list diff --git a/website/meta/languages.json b/website/meta/languages.json index 87c91f791..79e1fc5d5 100644 --- a/website/meta/languages.json +++ b/website/meta/languages.json @@ -265,6 +265,11 @@ "name": "Luxembourgish", "has_examples": true }, + { + "code": "lg", + "name": "Luganda", + "has_examples": true + }, { "code": "lij", "name": "Ligurian", From 7a2c58864cfb24b78c28643e22ce8c9686e1f1bf Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Fri, 26 Aug 2022 17:23:10 +0900 Subject: [PATCH 02/34] Move deps outside explosion to "third-party" (#11381) --- setup.cfg | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/setup.cfg b/setup.cfg index 708300b04..bf4890a68 100644 --- a/setup.cfg +++ b/setup.cfg @@ -50,9 +50,9 @@ install_requires = wasabi>=0.9.1,<1.1.0 srsly>=2.4.3,<3.0.0 catalogue>=2.0.6,<2.1.0 + # Third-party dependencies typer>=0.3.0,<0.5.0 pathy>=0.3.5 - # Third-party dependencies tqdm>=4.38.0,<5.0.0 numpy>=1.15.0 requests>=2.13.0,<3.0.0 From ba3320097948cd5056fc068cfc1a9cc1b2d89cf2 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Fri, 26 Aug 2022 16:07:16 +0200 Subject: [PATCH 03/34] Remove pathy from pyproject.toml (#11383) --- pyproject.toml | 1 - 1 file changed, 1 deletion(-) diff --git a/pyproject.toml b/pyproject.toml index 317c5fdbe..7abd7a96f 100644 --- a/pyproject.toml +++ b/pyproject.toml @@ -6,7 +6,6 @@ requires = [ "preshed>=3.0.2,<3.1.0", "murmurhash>=0.28.0,<1.1.0", "thinc>=8.1.0,<8.2.0", - "pathy", "numpy>=1.15.0", ] build-backend = "setuptools.build_meta" From 6723d76f24a55f24ef1632ac8be46567a984d0ef Mon Sep 17 00:00:00 2001 From: Edward <43848523+thomashacker@users.noreply.github.com> Date: Mon, 29 Aug 2022 10:23:05 +0200 Subject: [PATCH 04/34] Add ConsoleLogger.v2 (#11214) * Init * Change logger to ConsoleLogger.v2 * adjust naming * More naming adjustments * Fix output_file reference error * ignore type * Add basic test for logger * Hopefully fix mypy issue * mypy ignore line * Update mypy line Co-authored-by: Adriane Boyd * Update test method name Co-authored-by: Adriane Boyd * Change file saving logic * Fix finalize method * increase spacy-legacy version in requirements * Update docs * small adjustments Co-authored-by: Adriane Boyd --- requirements.txt | 2 +- setup.cfg | 2 +- spacy/tests/training/test_logger.py | 30 ++++++++ spacy/training/loggers.py | 102 +++++++++++++++++++++------- website/docs/api/legacy.md | 53 +++++++++++++++ website/docs/api/top-level.md | 57 +++++++++------- 6 files changed, 198 insertions(+), 48 deletions(-) create mode 100644 spacy/tests/training/test_logger.py diff --git a/requirements.txt b/requirements.txt index 437dd415a..3b8d66e0e 100644 --- a/requirements.txt +++ b/requirements.txt @@ -1,5 +1,5 @@ # Our libraries -spacy-legacy>=3.0.9,<3.1.0 +spacy-legacy>=3.0.10,<3.1.0 spacy-loggers>=1.0.0,<2.0.0 cymem>=2.0.2,<2.1.0 preshed>=3.0.2,<3.1.0 diff --git a/setup.cfg b/setup.cfg index bf4890a68..5fd820a96 100644 --- a/setup.cfg +++ b/setup.cfg @@ -41,7 +41,7 @@ setup_requires = thinc>=8.1.0,<8.2.0 install_requires = # Our libraries - spacy-legacy>=3.0.9,<3.1.0 + spacy-legacy>=3.0.10,<3.1.0 spacy-loggers>=1.0.0,<2.0.0 murmurhash>=0.28.0,<1.1.0 cymem>=2.0.2,<2.1.0 diff --git a/spacy/tests/training/test_logger.py b/spacy/tests/training/test_logger.py new file mode 100644 index 000000000..0dfd0cbf4 --- /dev/null +++ b/spacy/tests/training/test_logger.py @@ -0,0 +1,30 @@ +import pytest +import spacy + +from spacy.training import loggers + + +@pytest.fixture() +def nlp(): + nlp = spacy.blank("en") + nlp.add_pipe("ner") + return nlp + + +@pytest.fixture() +def info(): + return { + "losses": {"ner": 100}, + "other_scores": {"ENTS_F": 0.85, "ENTS_P": 0.90, "ENTS_R": 0.80}, + "epoch": 100, + "step": 125, + "score": 85, + } + + +def test_console_logger(nlp, info): + console_logger = loggers.console_logger( + progress_bar=True, console_output=True, output_file=None + ) + log_step, finalize = console_logger(nlp) + log_step(info) diff --git a/spacy/training/loggers.py b/spacy/training/loggers.py index edd0f1959..408ea7140 100644 --- a/spacy/training/loggers.py +++ b/spacy/training/loggers.py @@ -1,10 +1,13 @@ -from typing import TYPE_CHECKING, Dict, Any, Tuple, Callable, List, Optional, IO +from typing import TYPE_CHECKING, Dict, Any, Tuple, Callable, List, Optional, IO, Union from wasabi import Printer +from pathlib import Path import tqdm import sys +import srsly from ..util import registry from ..errors import Errors +from .. import util if TYPE_CHECKING: from ..language import Language # noqa: F401 @@ -23,13 +26,44 @@ def setup_table( return final_cols, final_widths, ["r" for _ in final_widths] -@registry.loggers("spacy.ConsoleLogger.v1") -def console_logger(progress_bar: bool = False): +@registry.loggers("spacy.ConsoleLogger.v2") +def console_logger( + progress_bar: bool = False, + console_output: bool = True, + output_file: Optional[Union[str, Path]] = None, +): + """The ConsoleLogger.v2 prints out training logs in the console and/or saves them to a jsonl file. + progress_bar (bool): Whether the logger should print the progress bar. + console_output (bool): Whether the logger should print the logs on the console. + output_file (Optional[Union[str, Path]]): The file to save the training logs to. + """ + _log_exist = False + if output_file: + output_file = util.ensure_path(output_file) # type: ignore + if output_file.exists(): # type: ignore + _log_exist = True + if not output_file.parents[0].exists(): # type: ignore + output_file.parents[0].mkdir(parents=True) # type: ignore + def setup_printer( nlp: "Language", stdout: IO = sys.stdout, stderr: IO = sys.stderr ) -> Tuple[Callable[[Optional[Dict[str, Any]]], None], Callable[[], None]]: write = lambda text: print(text, file=stdout, flush=True) msg = Printer(no_print=True) + + nonlocal output_file + output_stream = None + if _log_exist: + write( + msg.warn( + f"Saving logs is disabled because {output_file} already exists." + ) + ) + output_file = None + elif output_file: + write(msg.info(f"Saving results to {output_file}")) + output_stream = open(output_file, "w", encoding="utf-8") + # ensure that only trainable components are logged logged_pipes = [ name @@ -40,13 +74,15 @@ def console_logger(progress_bar: bool = False): score_weights = nlp.config["training"]["score_weights"] score_cols = [col for col, value in score_weights.items() if value is not None] loss_cols = [f"Loss {pipe}" for pipe in logged_pipes] - spacing = 2 - table_header, table_widths, table_aligns = setup_table( - cols=["E", "#"] + loss_cols + score_cols + ["Score"], - widths=[3, 6] + [8 for _ in loss_cols] + [6 for _ in score_cols] + [6], - ) - write(msg.row(table_header, widths=table_widths, spacing=spacing)) - write(msg.row(["-" * width for width in table_widths], spacing=spacing)) + + if console_output: + spacing = 2 + table_header, table_widths, table_aligns = setup_table( + cols=["E", "#"] + loss_cols + score_cols + ["Score"], + widths=[3, 6] + [8 for _ in loss_cols] + [6 for _ in score_cols] + [6], + ) + write(msg.row(table_header, widths=table_widths, spacing=spacing)) + write(msg.row(["-" * width for width in table_widths], spacing=spacing)) progress = None def log_step(info: Optional[Dict[str, Any]]) -> None: @@ -57,12 +93,15 @@ def console_logger(progress_bar: bool = False): if progress is not None: progress.update(1) return - losses = [ - "{0:.2f}".format(float(info["losses"][pipe_name])) - for pipe_name in logged_pipes - ] + + losses = [] + log_losses = {} + for pipe_name in logged_pipes: + losses.append("{0:.2f}".format(float(info["losses"][pipe_name]))) + log_losses[pipe_name] = float(info["losses"][pipe_name]) scores = [] + log_scores = {} for col in score_cols: score = info["other_scores"].get(col, 0.0) try: @@ -73,6 +112,7 @@ def console_logger(progress_bar: bool = False): if col != "speed": score *= 100 scores.append("{0:.2f}".format(score)) + log_scores[str(col)] = score data = ( [info["epoch"], info["step"]] @@ -80,20 +120,36 @@ def console_logger(progress_bar: bool = False): + scores + ["{0:.2f}".format(float(info["score"]))] ) + + if output_stream: + # Write to log file per log_step + log_data = { + "epoch": info["epoch"], + "step": info["step"], + "losses": log_losses, + "scores": log_scores, + "score": float(info["score"]), + } + output_stream.write(srsly.json_dumps(log_data) + "\n") + if progress is not None: progress.close() - write( - msg.row(data, widths=table_widths, aligns=table_aligns, spacing=spacing) - ) - if progress_bar: - # Set disable=None, so that it disables on non-TTY - progress = tqdm.tqdm( - total=eval_frequency, disable=None, leave=False, file=stderr + if console_output: + write( + msg.row( + data, widths=table_widths, aligns=table_aligns, spacing=spacing + ) ) - progress.set_description(f"Epoch {info['epoch']+1}") + if progress_bar: + # Set disable=None, so that it disables on non-TTY + progress = tqdm.tqdm( + total=eval_frequency, disable=None, leave=False, file=stderr + ) + progress.set_description(f"Epoch {info['epoch']+1}") def finalize() -> None: - pass + if output_stream: + output_stream.close() return log_step, finalize diff --git a/website/docs/api/legacy.md b/website/docs/api/legacy.md index 31d178b67..d9167c76f 100644 --- a/website/docs/api/legacy.md +++ b/website/docs/api/legacy.md @@ -248,6 +248,59 @@ added to an existing vectors table. See more details in ## Loggers {#loggers} +These functions are available from `@spacy.registry.loggers`. + +### spacy.ConsoleLogger.v1 {#ConsoleLogger_v1} + +> #### Example config +> +> ```ini +> [training.logger] +> @loggers = "spacy.ConsoleLogger.v1" +> progress_bar = true +> ``` + +Writes the results of a training step to the console in a tabular format. + + + +```cli +$ python -m spacy train config.cfg +``` + +``` +ℹ Using CPU +ℹ Loading config and nlp from: config.cfg +ℹ Pipeline: ['tok2vec', 'tagger'] +ℹ Start training +ℹ Training. Initial learn rate: 0.0 + +E # LOSS TOK2VEC LOSS TAGGER TAG_ACC SCORE +--- ------ ------------ ----------- ------- ------ + 0 0 0.00 86.20 0.22 0.00 + 0 200 3.08 18968.78 34.00 0.34 + 0 400 31.81 22539.06 33.64 0.34 + 0 600 92.13 22794.91 43.80 0.44 + 0 800 183.62 21541.39 56.05 0.56 + 0 1000 352.49 25461.82 65.15 0.65 + 0 1200 422.87 23708.82 71.84 0.72 + 0 1400 601.92 24994.79 76.57 0.77 + 0 1600 662.57 22268.02 80.20 0.80 + 0 1800 1101.50 28413.77 82.56 0.83 + 0 2000 1253.43 28736.36 85.00 0.85 + 0 2200 1411.02 28237.53 87.42 0.87 + 0 2400 1605.35 28439.95 88.70 0.89 +``` + +Note that the cumulative loss keeps increasing within one epoch, but should +start decreasing across epochs. + + + +| Name | Description | +| -------------- | --------------------------------------------------------- | +| `progress_bar` | Whether the logger should print the progress bar ~~bool~~ | + Logging utilities for spaCy are implemented in the [`spacy-loggers`](https://github.com/explosion/spacy-loggers) repo, and the functions are typically available from `@spacy.registry.loggers`. diff --git a/website/docs/api/top-level.md b/website/docs/api/top-level.md index 1e1925442..c3dc42f1a 100644 --- a/website/docs/api/top-level.md +++ b/website/docs/api/top-level.md @@ -275,8 +275,8 @@ Render a dependency parse tree or named entity visualization. ### displacy.parse_deps {#displacy.parse_deps tag="method" new="2"} -Generate dependency parse in `{'words': [], 'arcs': []}` format. -For use with the `manual=True` argument in `displacy.render`. +Generate dependency parse in `{'words': [], 'arcs': []}` format. For use with +the `manual=True` argument in `displacy.render`. > #### Example > @@ -297,8 +297,8 @@ For use with the `manual=True` argument in `displacy.render`. ### displacy.parse_ents {#displacy.parse_ents tag="method" new="2"} -Generate named entities in `[{start: i, end: i, label: 'label'}]` format. -For use with the `manual=True` argument in `displacy.render`. +Generate named entities in `[{start: i, end: i, label: 'label'}]` format. For +use with the `manual=True` argument in `displacy.render`. > #### Example > @@ -319,8 +319,8 @@ For use with the `manual=True` argument in `displacy.render`. ### displacy.parse_spans {#displacy.parse_spans tag="method" new="2"} -Generate spans in `[{start_token: i, end_token: i, label: 'label'}]` format. -For use with the `manual=True` argument in `displacy.render`. +Generate spans in `[{start_token: i, end_token: i, label: 'label'}]` format. For +use with the `manual=True` argument in `displacy.render`. > #### Example > @@ -505,7 +505,7 @@ finished. To log each training step, a and the accuracy scores on the development set. The built-in, default logger is the ConsoleLogger, which prints results to the -console in tabular format. The +console in tabular format and saves them to a `jsonl` file. The [spacy-loggers](https://github.com/explosion/spacy-loggers) package, included as a dependency of spaCy, enables other loggers, such as one that sends results to a [Weights & Biases](https://www.wandb.com/) dashboard. @@ -513,16 +513,20 @@ a [Weights & Biases](https://www.wandb.com/) dashboard. Instead of using one of the built-in loggers, you can [implement your own](/usage/training#custom-logging). -#### spacy.ConsoleLogger.v1 {#ConsoleLogger tag="registered function"} +#### spacy.ConsoleLogger.v2 {#ConsoleLogger tag="registered function"} > #### Example config > > ```ini > [training.logger] -> @loggers = "spacy.ConsoleLogger.v1" +> @loggers = "spacy.ConsoleLogger.v2" +> progress_bar = true +> console_output = true +> output_file = "training_log.jsonl" > ``` -Writes the results of a training step to the console in a tabular format. +Writes the results of a training step to the console in a tabular format and +saves them to a `jsonl` file. @@ -536,22 +540,23 @@ $ python -m spacy train config.cfg ℹ Pipeline: ['tok2vec', 'tagger'] ℹ Start training ℹ Training. Initial learn rate: 0.0 +ℹ Saving results to training_log.jsonl E # LOSS TOK2VEC LOSS TAGGER TAG_ACC SCORE --- ------ ------------ ----------- ------- ------ - 1 0 0.00 86.20 0.22 0.00 - 1 200 3.08 18968.78 34.00 0.34 - 1 400 31.81 22539.06 33.64 0.34 - 1 600 92.13 22794.91 43.80 0.44 - 1 800 183.62 21541.39 56.05 0.56 - 1 1000 352.49 25461.82 65.15 0.65 - 1 1200 422.87 23708.82 71.84 0.72 - 1 1400 601.92 24994.79 76.57 0.77 - 1 1600 662.57 22268.02 80.20 0.80 - 1 1800 1101.50 28413.77 82.56 0.83 - 1 2000 1253.43 28736.36 85.00 0.85 - 1 2200 1411.02 28237.53 87.42 0.87 - 1 2400 1605.35 28439.95 88.70 0.89 + 0 0 0.00 86.20 0.22 0.00 + 0 200 3.08 18968.78 34.00 0.34 + 0 400 31.81 22539.06 33.64 0.34 + 0 600 92.13 22794.91 43.80 0.44 + 0 800 183.62 21541.39 56.05 0.56 + 0 1000 352.49 25461.82 65.15 0.65 + 0 1200 422.87 23708.82 71.84 0.72 + 0 1400 601.92 24994.79 76.57 0.77 + 0 1600 662.57 22268.02 80.20 0.80 + 0 1800 1101.50 28413.77 82.56 0.83 + 0 2000 1253.43 28736.36 85.00 0.85 + 0 2200 1411.02 28237.53 87.42 0.87 + 0 2400 1605.35 28439.95 88.70 0.89 ``` Note that the cumulative loss keeps increasing within one epoch, but should @@ -559,6 +564,12 @@ start decreasing across epochs. +| Name | Description | +| ---------------- | --------------------------------------------------------------------- | +| `progress_bar` | Whether the logger should print the progress bar ~~bool~~ | +| `console_output` | Whether the logger should print the logs on the console. ~~bool~~ | +| `output_file` | The file to save the training logs to. ~~Optional[Union[str, Path]]~~ | + ## Readers {#readers} ### File readers {#file-readers source="github.com/explosion/srsly" new="3"} From 5ae63b1fbd549fdfc0f7399c0b9656d4a6681544 Mon Sep 17 00:00:00 2001 From: "Patrick J. Burns" Date: Tue, 30 Aug 2022 08:04:54 -0400 Subject: [PATCH 05/34] Add Latin language support (#11349) * Add lang folder for la (Latin) * Add Latin lang classes * Add minimal tokenizer exceptions * Add minimal stopwords * Add minimal lex_attrs * Update stopwords, tokenizer exceptions * Add la tests; register la_tokenizer in conftest.py * Update spacy/lang/la/lex_attrs.py Remove duplicate form in Latin lex_attrs Co-authored-by: Sofie Van Landeghem * Update natto-py version spec (#11222) * Update natto-py version spec * Update setup.cfg Co-authored-by: Adriane Boyd Co-authored-by: Adriane Boyd * Add scorer to textcat API docs config settings (#11263) * Update docs for pipeline initialize() methods (#11221) * Update documentation for dependency parser * Update documentation for trainable_lemmatizer * Update documentation for entity_linker * Update documentation for ner * Update documentation for morphologizer * Update documentation for senter * Update documentation for spancat * Update documentation for tagger * Update documentation for textcat * Update documentation for tok2vec * Run prettier on edited files * Apply similar changes in transformer docs * Remove need to say annotated example explicitly I removed the need to say "Must contain at least one annotated Example" because it's often a given that Examples will contain some gold-standard annotation. * Run prettier on transformer docs * chore: add 'concepCy' to spacy universe (#11255) * chore: add 'concepCy' to spacy universe * docs: add 'slogan' to concepCy * Support full prerelease versions in the compat table (#11228) * Support full prerelease versions in the compat table * Fix types * adding spans to doc_annotation in Example.to_dict (#11261) * adding spans to doc_annotation in Example.to_dict * to_dict compatible with from_dict: tuples instead of spans * use strings for label and kb_id * Simplify test * Update data formats docs Co-authored-by: Stefanie Wolf Co-authored-by: Adriane Boyd * Fix regex invalid escape sequences (#11276) * Add W605 to the errors raised by flake8 in the CI (#11283) * Clean up automated label-based issue handling (#11284) * Clean up automated label-based issue handline 1. upgrade tiangolo/issue-manager to latest 2. move needs-more-info to tiangolo 3. change needs-more-info close time to 7 days 4. delete old needs-more-info config * Use old, longer message * Fix label name * Fix Dutch noun chunks to skip overlapping spans (#11275) * Add test for overlapping noun chunks * Skip overlapping noun chunks * Update spacy/tests/lang/nl/test_noun_chunks.py Co-authored-by: Sofie Van Landeghem Co-authored-by: Sofie Van Landeghem * Docs: displaCy documentation - data types, `parse_{deps,ents,spans}`, spans example (#10950) * add in spans example and parse references * rm autoformatter * rm extra ents copy * TypedDict draft * type fixes * restore non-documentation files * docs update * fix spans example * fix hyperlinks * add parse example * example fix + argument fix * fix api arg in docs * fix bad variable replacement * fix spacing in style Co-authored-by: Sofie Van Landeghem * fix spacing on table * fix spacing on table * rm temp files Co-authored-by: Sofie Van Landeghem * include span_ruler for default warning filter (#11333) * Add uk pipelines to website (#11332) * Check for . in factory names (#11336) * Make fixes for PR #11349 * Fix roman numeral coverage in #11349 Co-authored-by: Patrick J. Burns Co-authored-by: Sofie Van Landeghem Co-authored-by: Paul O'Leary McCann Co-authored-by: Adriane Boyd Co-authored-by: Lj Miranda <12949683+ljvmiranda921@users.noreply.github.com> Co-authored-by: Jules Belveze <32683010+JulesBelveze@users.noreply.github.com> Co-authored-by: stefawolf Co-authored-by: Stefanie Wolf Co-authored-by: Peter Baumgartner <5107405+pmbaumgartner@users.noreply.github.com> --- spacy/lang/la/__init__.py | 18 +++++++++++++ spacy/lang/la/lex_attrs.py | 32 +++++++++++++++++++++++ spacy/lang/la/stop_words.py | 37 +++++++++++++++++++++++++++ spacy/lang/la/tokenizer_exceptions.py | 30 ++++++++++++++++++++++ spacy/tests/conftest.py | 5 ++++ spacy/tests/lang/la/__init__.py | 0 spacy/tests/lang/la/test_exception.py | 7 +++++ spacy/tests/lang/la/test_text.py | 33 ++++++++++++++++++++++++ website/docs/api/top-level.md | 2 +- 9 files changed, 163 insertions(+), 1 deletion(-) create mode 100644 spacy/lang/la/__init__.py create mode 100644 spacy/lang/la/lex_attrs.py create mode 100644 spacy/lang/la/stop_words.py create mode 100644 spacy/lang/la/tokenizer_exceptions.py create mode 100644 spacy/tests/lang/la/__init__.py create mode 100644 spacy/tests/lang/la/test_exception.py create mode 100644 spacy/tests/lang/la/test_text.py diff --git a/spacy/lang/la/__init__.py b/spacy/lang/la/__init__.py new file mode 100644 index 000000000..5f2cccee3 --- /dev/null +++ b/spacy/lang/la/__init__.py @@ -0,0 +1,18 @@ +from ...language import Language, BaseDefaults +from .tokenizer_exceptions import TOKENIZER_EXCEPTIONS +from .stop_words import STOP_WORDS +from .lex_attrs import LEX_ATTRS + + +class LatinDefaults(BaseDefaults): + tokenizer_exceptions = TOKENIZER_EXCEPTIONS + stop_words = STOP_WORDS + lex_attr_getters = LEX_ATTRS + + +class Latin(Language): + lang = "la" + Defaults = LatinDefaults + + +__all__ = ["Latin"] diff --git a/spacy/lang/la/lex_attrs.py b/spacy/lang/la/lex_attrs.py new file mode 100644 index 000000000..9348a811a --- /dev/null +++ b/spacy/lang/la/lex_attrs.py @@ -0,0 +1,32 @@ +from ...attrs import LIKE_NUM +import re + +# cf. Goyvaerts/Levithan 2009; case-insensitive, allow 4 +roman_numerals_compile = re.compile(r'(?i)^(?=[MDCLXVI])M*(C[MD]|D?C{0,4})(X[CL]|L?X{0,4})(I[XV]|V?I{0,4})$') + +_num_words = set( + """ +unus una unum duo duae tres tria quattuor quinque sex septem octo novem decem +""".split() +) + +_ordinal_words = set( + """ +primus prima primum secundus secunda secundum tertius tertia tertium +""".split() +) + + +def like_num(text): + if text.isdigit(): + return True + if roman_numerals_compile.match(text): + return True + if text.lower() in _num_words: + return True + if text.lower() in _ordinal_words: + return True + return False + + +LEX_ATTRS = {LIKE_NUM: like_num} diff --git a/spacy/lang/la/stop_words.py b/spacy/lang/la/stop_words.py new file mode 100644 index 000000000..8b590bb67 --- /dev/null +++ b/spacy/lang/la/stop_words.py @@ -0,0 +1,37 @@ +# Corrected Perseus list, cf. https://wiki.digitalclassicist.org/Stopwords_for_Greek_and_Latin + +STOP_WORDS = set( + """ +ab ac ad adhuc aliqui aliquis an ante apud at atque aut autem + +cum cur + +de deinde dum + +ego enim ergo es est et etiam etsi ex + +fio + +haud hic + +iam idem igitur ille in infra inter interim ipse is ita + +magis modo mox + +nam ne nec necque neque nisi non nos + +o ob + +per possum post pro + +quae quam quare qui quia quicumque quidem quilibet quis quisnam quisquam quisque quisquis quo quoniam + +sed si sic sive sub sui sum super suus + +tam tamen trans tu tum + +ubi uel uero + +vel vero +""".split() +) diff --git a/spacy/lang/la/tokenizer_exceptions.py b/spacy/lang/la/tokenizer_exceptions.py new file mode 100644 index 000000000..905304188 --- /dev/null +++ b/spacy/lang/la/tokenizer_exceptions.py @@ -0,0 +1,30 @@ +from ..tokenizer_exceptions import BASE_EXCEPTIONS +from ...symbols import ORTH +from ...util import update_exc + + +## TODO: Look into systematically handling u/v +_exc = { + "mecum": [{ORTH: "me"}, {ORTH: "cum"}], + "tecum": [{ORTH: "te"}, {ORTH: "cum"}], + "nobiscum": [{ORTH: "nobis"}, {ORTH: "cum"}], + "vobiscum": [{ORTH: "vobis"}, {ORTH: "cum"}], + "uobiscum": [{ORTH: "uobis"}, {ORTH: "cum"}], +} + +for orth in [ + + 'A.', 'Agr.', 'Ap.', 'C.', 'Cn.', 'D.', 'F.', 'K.', 'L.', "M'.", 'M.', 'Mam.', 'N.', 'Oct.', + 'Opet.', 'P.', 'Paul.', 'Post.', 'Pro.', 'Q.', 'S.', 'Ser.', 'Sert.', 'Sex.', 'St.', 'Sta.', + 'T.', 'Ti.', 'V.', 'Vol.', 'Vop.', 'U.', 'Uol.', 'Uop.', + + 'Ian.', 'Febr.', 'Mart.', 'Apr.', 'Mai.', 'Iun.', 'Iul.', 'Aug.', 'Sept.', 'Oct.', 'Nov.', 'Nou.', + 'Dec.', + + 'Non.', 'Id.', 'A.D.', + + 'Coll.', 'Cos.', 'Ord.', 'Pl.', 'S.C.', 'Suff.', 'Trib.', +]: + _exc[orth] = [{ORTH: orth}] + +TOKENIZER_EXCEPTIONS = update_exc(BASE_EXCEPTIONS, _exc) diff --git a/spacy/tests/conftest.py b/spacy/tests/conftest.py index 5193bd301..0395ba7ca 100644 --- a/spacy/tests/conftest.py +++ b/spacy/tests/conftest.py @@ -256,6 +256,11 @@ def ko_tokenizer_tokenizer(): return nlp.tokenizer +@pytest.fixture(scope="module") +def la_tokenizer(): + return get_lang_class("la")().tokenizer + + @pytest.fixture(scope="session") def lb_tokenizer(): return get_lang_class("lb")().tokenizer diff --git a/spacy/tests/lang/la/__init__.py b/spacy/tests/lang/la/__init__.py new file mode 100644 index 000000000..e69de29bb diff --git a/spacy/tests/lang/la/test_exception.py b/spacy/tests/lang/la/test_exception.py new file mode 100644 index 000000000..04bc1d489 --- /dev/null +++ b/spacy/tests/lang/la/test_exception.py @@ -0,0 +1,7 @@ +import pytest + +def test_la_tokenizer_handles_exc_in_text(la_tokenizer): + text = "scio te omnia facturum, ut nobiscum quam primum sis" + tokens = la_tokenizer(text) + assert len(tokens) == 11 + assert tokens[6].text == "nobis" diff --git a/spacy/tests/lang/la/test_text.py b/spacy/tests/lang/la/test_text.py new file mode 100644 index 000000000..11676b92b --- /dev/null +++ b/spacy/tests/lang/la/test_text.py @@ -0,0 +1,33 @@ +import pytest +from spacy.lang.la.lex_attrs import like_num + +@pytest.mark.parametrize( + "text,match", + [ + ("IIII", True), + ("VI", True), + ("vi", True), + ("IV", True), + ("iv", True), + ("IX", True), + ("ix", True), + ("MMXXII", True), + ("0", True), + ("1", True), + ("quattuor", True), + ("decem", True), + ("tertius", True), + ("canis", False), + ("MMXX11", False), + (",", False), + ], +) +def test_lex_attrs_like_number(la_tokenizer, text, match): + tokens = la_tokenizer(text) + assert len(tokens) == 1 + assert tokens[0].like_num == match + +@pytest.mark.parametrize("word", ["quinque"]) +def test_la_lex_attrs_capitals(word): + assert like_num(word) + assert like_num(word.upper()) diff --git a/website/docs/api/top-level.md b/website/docs/api/top-level.md index c3dc42f1a..724f2775e 100644 --- a/website/docs/api/top-level.md +++ b/website/docs/api/top-level.md @@ -451,7 +451,7 @@ factories. | Registry name | Description | | ----------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | | `architectures` | Registry for functions that create [model architectures](/api/architectures). Can be used to register custom model architectures and reference them in the `config.cfg`. | -| `augmenters` | Registry for functions that create [data augmentation](#augmenters) callbacks for corpora and other training data iterators. | +| `augmenters` | Registry for functions that create [data augmentation](#augmenters) callbacks for corpora and other training data iterators. | | `batchers` | Registry for training and evaluation [data batchers](#batchers). | | `callbacks` | Registry for custom callbacks to [modify the `nlp` object](/usage/training#custom-code-nlp-callbacks) before training. | | `displacy_colors` | Registry for custom color scheme for the [`displacy` NER visualizer](/usage/visualizers). Automatically reads from [entry points](/usage/saving-loading#entry-points). | From 3f4b4b7b4fa2df6c5d888cdc97efb71093d3fb6b Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Dani=C3=ABl=20de=20Kok?= Date: Tue, 30 Aug 2022 14:21:02 +0200 Subject: [PATCH 06/34] Fix `test_{prefer,require}_gpu` (#11390) * Fix `test_{prefer,require}_gpu` These tests assumed that GPUs are only supported with CuPy, but since Thinc 8.1 we also support Metal Performance Shaders. * test_misc: arrange thinc imports to be together --- spacy/tests/test_misc.py | 25 ++++++++++++------------- 1 file changed, 12 insertions(+), 13 deletions(-) diff --git a/spacy/tests/test_misc.py b/spacy/tests/test_misc.py index d8743d322..1c9b045ac 100644 --- a/spacy/tests/test_misc.py +++ b/spacy/tests/test_misc.py @@ -10,7 +10,8 @@ from spacy.ml._precomputable_affine import _backprop_precomputable_affine_paddin from spacy.util import dot_to_object, SimpleFrozenList, import_file from spacy.util import to_ternary_int from thinc.api import Config, Optimizer, ConfigValidationError -from thinc.api import set_current_ops +from thinc.api import get_current_ops, set_current_ops, NumpyOps, CupyOps, MPSOps +from thinc.compat import has_cupy_gpu, has_torch_mps_gpu from spacy.training.batchers import minibatch_by_words from spacy.lang.en import English from spacy.lang.nl import Dutch @@ -18,7 +19,6 @@ from spacy.language import DEFAULT_CONFIG_PATH from spacy.schemas import ConfigSchemaTraining, TokenPattern, TokenPatternSchema from pydantic import ValidationError -from thinc.api import get_current_ops, NumpyOps, CupyOps from .util import get_random_doc, make_tempdir @@ -111,26 +111,25 @@ def test_PrecomputableAffine(nO=4, nI=5, nF=3, nP=2): def test_prefer_gpu(): current_ops = get_current_ops() - try: - import cupy # noqa: F401 - - prefer_gpu() + if has_cupy_gpu: + assert prefer_gpu() assert isinstance(get_current_ops(), CupyOps) - except ImportError: + elif has_torch_mps_gpu: + assert prefer_gpu() + assert isinstance(get_current_ops(), MPSOps) + else: assert not prefer_gpu() set_current_ops(current_ops) def test_require_gpu(): current_ops = get_current_ops() - try: - import cupy # noqa: F401 - + if has_cupy_gpu: require_gpu() assert isinstance(get_current_ops(), CupyOps) - except ImportError: - with pytest.raises(ValueError): - require_gpu() + elif has_torch_mps_gpu: + require_gpu() + assert isinstance(get_current_ops(), MPSOps) set_current_ops(current_ops) From 8fc0efc502da2f02076575e0887cb585d0e0f391 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Wed, 31 Aug 2022 09:02:34 +0200 Subject: [PATCH 07/34] Allow string argument for disable/enable/exclude (#11406) * adding unit test for spacy.load with disable/exclude string arg * allow pure strings in from_config * update docs * upstream type adjustements * docs update * make docstring more consistent * Update spacy/language.py Co-authored-by: Adriane Boyd * two more cleanups * fix type in internal method Co-authored-by: Adriane Boyd --- spacy/__init__.py | 12 ++--- spacy/language.py | 32 +++++++----- spacy/tests/pipeline/test_pipe_methods.py | 11 +++++ spacy/util.py | 60 +++++++++++------------ website/docs/api/language.md | 27 +++++----- website/docs/api/top-level.md | 58 +++++++++++----------- 6 files changed, 112 insertions(+), 88 deletions(-) diff --git a/spacy/__init__.py b/spacy/__init__.py index 069215fda..d60f46b96 100644 --- a/spacy/__init__.py +++ b/spacy/__init__.py @@ -31,21 +31,21 @@ def load( name: Union[str, Path], *, vocab: Union[Vocab, bool] = True, - disable: Iterable[str] = util.SimpleFrozenList(), - enable: Iterable[str] = util.SimpleFrozenList(), - exclude: Iterable[str] = util.SimpleFrozenList(), + disable: Union[str, Iterable[str]] = util.SimpleFrozenList(), + enable: Union[str, Iterable[str]] = util.SimpleFrozenList(), + exclude: Union[str, Iterable[str]] = util.SimpleFrozenList(), config: Union[Dict[str, Any], Config] = util.SimpleFrozenDict(), ) -> Language: """Load a spaCy model from an installed package or a local path. name (str): Package name or model path. vocab (Vocab): A Vocab object. If True, a vocab is created. - disable (Iterable[str]): Names of pipeline components to disable. Disabled + disable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to disable. Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling nlp.enable_pipe. - enable (Iterable[str]): Names of pipeline components to enable. All other + enable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to enable. All other pipes will be disabled (but can be enabled later using nlp.enable_pipe). - exclude (Iterable[str]): Names of pipeline components to exclude. Excluded + exclude (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to exclude. Excluded components won't be loaded. config (Dict[str, Any] / Config): Config overrides as nested dict or dict keyed by section values in dot notation. diff --git a/spacy/language.py b/spacy/language.py index e89ae142b..ec330753c 100644 --- a/spacy/language.py +++ b/spacy/language.py @@ -1063,7 +1063,7 @@ class Language: """ if enable is None and disable is None: raise ValueError(Errors.E991) - if disable is not None and isinstance(disable, str): + if isinstance(disable, str): disable = [disable] if enable is not None: if isinstance(enable, str): @@ -1698,9 +1698,9 @@ class Language: config: Union[Dict[str, Any], Config] = {}, *, vocab: Union[Vocab, bool] = True, - disable: Iterable[str] = SimpleFrozenList(), - enable: Iterable[str] = SimpleFrozenList(), - exclude: Iterable[str] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = SimpleFrozenList(), + enable: Union[str, Iterable[str]] = SimpleFrozenList(), + exclude: Union[str, Iterable[str]] = SimpleFrozenList(), meta: Dict[str, Any] = SimpleFrozenDict(), auto_fill: bool = True, validate: bool = True, @@ -1711,12 +1711,12 @@ class Language: config (Dict[str, Any] / Config): The loaded config. vocab (Vocab): A Vocab object. If True, a vocab is created. - disable (Iterable[str]): Names of pipeline components to disable. + disable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to disable. Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling nlp.enable_pipe. - enable (Iterable[str]): Names of pipeline components to enable. All other + enable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to enable. All other pipes will be disabled (and can be enabled using `nlp.enable_pipe`). - exclude (Iterable[str]): Names of pipeline components to exclude. + exclude (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to exclude. Excluded components won't be loaded. meta (Dict[str, Any]): Meta overrides for nlp.meta. auto_fill (bool): Automatically fill in missing values in config based @@ -1727,6 +1727,12 @@ class Language: DOCS: https://spacy.io/api/language#from_config """ + if isinstance(disable, str): + disable = [disable] + if isinstance(enable, str): + enable = [enable] + if isinstance(exclude, str): + exclude = [exclude] if auto_fill: config = Config( cls.default_config, section_order=CONFIG_SECTION_ORDER @@ -2031,25 +2037,29 @@ class Language: @staticmethod def _resolve_component_status( - disable: Iterable[str], enable: Iterable[str], pipe_names: Collection[str] + disable: Union[str, Iterable[str]], + enable: Union[str, Iterable[str]], + pipe_names: Iterable[str], ) -> Tuple[str, ...]: """Derives whether (1) `disable` and `enable` values are consistent and (2) resolves those to a single set of disabled components. Raises an error in case of inconsistency. - disable (Iterable[str]): Names of components or serialization fields to disable. - enable (Iterable[str]): Names of pipeline components to enable. + disable (Union[str, Iterable[str]]): Name(s) of component(s) or serialization fields to disable. + enable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to enable. pipe_names (Iterable[str]): Names of all pipeline components. RETURNS (Tuple[str, ...]): Names of components to exclude from pipeline w.r.t. specified includes and excludes. """ - if disable is not None and isinstance(disable, str): + if isinstance(disable, str): disable = [disable] to_disable = disable if enable: + if isinstance(enable, str): + enable = [enable] to_disable = [ pipe_name for pipe_name in pipe_names if pipe_name not in enable ] diff --git a/spacy/tests/pipeline/test_pipe_methods.py b/spacy/tests/pipeline/test_pipe_methods.py index 6f00a1cd9..b946061f6 100644 --- a/spacy/tests/pipeline/test_pipe_methods.py +++ b/spacy/tests/pipeline/test_pipe_methods.py @@ -618,6 +618,7 @@ def test_load_disable_enable() -> None: base_nlp.to_disk(tmp_dir) to_disable = ["parser", "tagger"] to_enable = ["tagger", "parser"] + single_str = "tagger" # Setting only `disable`. nlp = spacy.load(tmp_dir, disable=to_disable) @@ -632,6 +633,16 @@ def test_load_disable_enable() -> None: ] ) + # Loading with a string representing one component + nlp = spacy.load(tmp_dir, exclude=single_str) + assert single_str not in nlp.component_names + + nlp = spacy.load(tmp_dir, disable=single_str) + assert single_str in nlp.component_names + assert single_str not in nlp.pipe_names + assert nlp._disabled == {single_str} + assert nlp.disabled == [single_str] + # Testing consistent enable/disable combination. nlp = spacy.load( tmp_dir, diff --git a/spacy/util.py b/spacy/util.py index d170fc15b..4e1a62d05 100644 --- a/spacy/util.py +++ b/spacy/util.py @@ -398,9 +398,9 @@ def load_model( name: Union[str, Path], *, vocab: Union["Vocab", bool] = True, - disable: Iterable[str] = SimpleFrozenList(), - enable: Iterable[str] = SimpleFrozenList(), - exclude: Iterable[str] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = SimpleFrozenList(), + enable: Union[str, Iterable[str]] = SimpleFrozenList(), + exclude: Union[str, Iterable[str]] = SimpleFrozenList(), config: Union[Dict[str, Any], Config] = SimpleFrozenDict(), ) -> "Language": """Load a model from a package or data path. @@ -408,9 +408,9 @@ def load_model( name (str): Package name or model path. vocab (Vocab / True): Optional vocab to pass in on initialization. If True, a new Vocab object will be created. - disable (Iterable[str]): Names of pipeline components to disable. - enable (Iterable[str]): Names of pipeline components to enable. All others will be disabled. - exclude (Iterable[str]): Names of pipeline components to exclude. + disable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to disable. + enable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to enable. All others will be disabled. + exclude (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to exclude. config (Dict[str, Any] / Config): Config overrides as nested dict or dict keyed by section values in dot notation. RETURNS (Language): The loaded nlp object. @@ -440,9 +440,9 @@ def load_model_from_package( name: str, *, vocab: Union["Vocab", bool] = True, - disable: Iterable[str] = SimpleFrozenList(), - enable: Iterable[str] = SimpleFrozenList(), - exclude: Iterable[str] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = SimpleFrozenList(), + enable: Union[str, Iterable[str]] = SimpleFrozenList(), + exclude: Union[str, Iterable[str]] = SimpleFrozenList(), config: Union[Dict[str, Any], Config] = SimpleFrozenDict(), ) -> "Language": """Load a model from an installed package. @@ -450,12 +450,12 @@ def load_model_from_package( name (str): The package name. vocab (Vocab / True): Optional vocab to pass in on initialization. If True, a new Vocab object will be created. - disable (Iterable[str]): Names of pipeline components to disable. Disabled + disable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to disable. Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling nlp.enable_pipe. - enable (Iterable[str]): Names of pipeline components to enable. All other + enable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to enable. All other pipes will be disabled (and can be enabled using `nlp.enable_pipe`). - exclude (Iterable[str]): Names of pipeline components to exclude. Excluded + exclude (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to exclude. Excluded components won't be loaded. config (Dict[str, Any] / Config): Config overrides as nested dict or dict keyed by section values in dot notation. @@ -470,9 +470,9 @@ def load_model_from_path( *, meta: Optional[Dict[str, Any]] = None, vocab: Union["Vocab", bool] = True, - disable: Iterable[str] = SimpleFrozenList(), - enable: Iterable[str] = SimpleFrozenList(), - exclude: Iterable[str] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = SimpleFrozenList(), + enable: Union[str, Iterable[str]] = SimpleFrozenList(), + exclude: Union[str, Iterable[str]] = SimpleFrozenList(), config: Union[Dict[str, Any], Config] = SimpleFrozenDict(), ) -> "Language": """Load a model from a data directory path. Creates Language class with @@ -482,12 +482,12 @@ def load_model_from_path( meta (Dict[str, Any]): Optional model meta. vocab (Vocab / True): Optional vocab to pass in on initialization. If True, a new Vocab object will be created. - disable (Iterable[str]): Names of pipeline components to disable. Disabled + disable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to disable. Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling nlp.enable_pipe. - enable (Iterable[str]): Names of pipeline components to enable. All other + enable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to enable. All other pipes will be disabled (and can be enabled using `nlp.enable_pipe`). - exclude (Iterable[str]): Names of pipeline components to exclude. Excluded + exclude (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to exclude. Excluded components won't be loaded. config (Dict[str, Any] / Config): Config overrides as nested dict or dict keyed by section values in dot notation. @@ -516,9 +516,9 @@ def load_model_from_config( *, meta: Dict[str, Any] = SimpleFrozenDict(), vocab: Union["Vocab", bool] = True, - disable: Iterable[str] = SimpleFrozenList(), - enable: Iterable[str] = SimpleFrozenList(), - exclude: Iterable[str] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = SimpleFrozenList(), + enable: Union[str, Iterable[str]] = SimpleFrozenList(), + exclude: Union[str, Iterable[str]] = SimpleFrozenList(), auto_fill: bool = False, validate: bool = True, ) -> "Language": @@ -529,12 +529,12 @@ def load_model_from_config( meta (Dict[str, Any]): Optional model meta. vocab (Vocab / True): Optional vocab to pass in on initialization. If True, a new Vocab object will be created. - disable (Iterable[str]): Names of pipeline components to disable. Disabled + disable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to disable. Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling nlp.enable_pipe. - enable (Iterable[str]): Names of pipeline components to enable. All other + enable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to enable. All other pipes will be disabled (and can be enabled using `nlp.enable_pipe`). - exclude (Iterable[str]): Names of pipeline components to exclude. Excluded + exclude (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to exclude. Excluded components won't be loaded. auto_fill (bool): Whether to auto-fill config with missing defaults. validate (bool): Whether to show config validation errors. @@ -616,9 +616,9 @@ def load_model_from_init_py( init_file: Union[Path, str], *, vocab: Union["Vocab", bool] = True, - disable: Iterable[str] = SimpleFrozenList(), - enable: Iterable[str] = SimpleFrozenList(), - exclude: Iterable[str] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = SimpleFrozenList(), + enable: Union[str, Iterable[str]] = SimpleFrozenList(), + exclude: Union[str, Iterable[str]] = SimpleFrozenList(), config: Union[Dict[str, Any], Config] = SimpleFrozenDict(), ) -> "Language": """Helper function to use in the `load()` method of a model package's @@ -626,12 +626,12 @@ def load_model_from_init_py( vocab (Vocab / True): Optional vocab to pass in on initialization. If True, a new Vocab object will be created. - disable (Iterable[str]): Names of pipeline components to disable. Disabled + disable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to disable. Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling nlp.enable_pipe. - enable (Iterable[str]): Names of pipeline components to enable. All other + enable (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to enable. All other pipes will be disabled (and can be enabled using `nlp.enable_pipe`). - exclude (Iterable[str]): Names of pipeline components to exclude. Excluded + exclude (Union[str, Iterable[str]]): Name(s) of pipeline component(s) to exclude. Excluded components won't be loaded. config (Dict[str, Any] / Config): Config overrides as nested dict or dict keyed by section values in dot notation. diff --git a/website/docs/api/language.md b/website/docs/api/language.md index 9a413efaf..ed763e36a 100644 --- a/website/docs/api/language.md +++ b/website/docs/api/language.md @@ -63,17 +63,18 @@ spaCy loads a model under the hood based on its > nlp = Language.from_config(config) > ``` -| Name | Description | -| -------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | -| `config` | The loaded config. ~~Union[Dict[str, Any], Config]~~ | -| _keyword-only_ | | -| `vocab` | A `Vocab` object. If `True`, a vocab is created using the default language data settings. ~~Vocab~~ | -| `disable` | Names of pipeline components to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [`nlp.enable_pipe`](/api/language#enable_pipe). ~~List[str]~~ | -| `exclude` | Names of pipeline components to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~List[str]~~ | -| `meta` | [Meta data](/api/data-formats#meta) overrides. ~~Dict[str, Any]~~ | -| `auto_fill` | Whether to automatically fill in missing values in the config, based on defaults and function argument annotations. Defaults to `True`. ~~bool~~ | -| `validate` | Whether to validate the component config and arguments against the types expected by the factory. Defaults to `True`. ~~bool~~ | -| **RETURNS** | The initialized object. ~~Language~~ | +| Name | Description | +| ------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `config` | The loaded config. ~~Union[Dict[str, Any], Config]~~ | +| _keyword-only_ | | +| `vocab` | A `Vocab` object. If `True`, a vocab is created using the default language data settings. ~~Vocab~~ | +| `disable` | Name(s) of pipeline component(s) to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [`nlp.enable_pipe`](/api/language#enable_pipe). ~~Union[str, Iterable[str]]~~ | +| `enable` 3.4 | Name(s) of pipeline component(s) to [enable](/usage/processing-pipelines#disabling). All other pipes will be disabled, but can be enabled again using [`nlp.enable_pipe`](/api/language#enable_pipe). ~~Union[str, Iterable[str]]~~ | +| `exclude` | Name(s) of pipeline component(s) to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~Union[str, Iterable[str]]~~ | +| `meta` | [Meta data](/api/data-formats#meta) overrides. ~~Dict[str, Any]~~ | +| `auto_fill` | Whether to automatically fill in missing values in the config, based on defaults and function argument annotations. Defaults to `True`. ~~bool~~ | +| `validate` | Whether to validate the component config and arguments against the types expected by the factory. Defaults to `True`. ~~bool~~ | +| **RETURNS** | The initialized object. ~~Language~~ | ## Language.component {#component tag="classmethod" new="3"} @@ -695,8 +696,8 @@ As of spaCy v3.0, the `disable_pipes` method has been renamed to `select_pipes`: | Name | Description | | -------------- | ------------------------------------------------------------------------------------------------------ | | _keyword-only_ | | -| `disable` | Name(s) of pipeline components to disable. ~~Optional[Union[str, Iterable[str]]]~~ | -| `enable` | Name(s) of pipeline components that will not be disabled. ~~Optional[Union[str, Iterable[str]]]~~ | +| `disable` | Name(s) of pipeline component(s) to disable. ~~Optional[Union[str, Iterable[str]]]~~ | +| `enable` | Name(s) of pipeline component(s) that will not be disabled. ~~Optional[Union[str, Iterable[str]]]~~ | | **RETURNS** | The disabled pipes that can be restored by calling the object's `.restore()` method. ~~DisabledPipes~~ | ## Language.get_factory_meta {#get_factory_meta tag="classmethod" new="3"} diff --git a/website/docs/api/top-level.md b/website/docs/api/top-level.md index 724f2775e..220b2d6e9 100644 --- a/website/docs/api/top-level.md +++ b/website/docs/api/top-level.md @@ -45,16 +45,16 @@ specified separately using the new `exclude` keyword argument. > nlp = spacy.load("en_core_web_sm", exclude=["parser", "tagger"]) > ``` -| Name | Description | -| ------------------------------------ | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `name` | Pipeline to load, i.e. package name or path. ~~Union[str, Path]~~ | -| _keyword-only_ | | -| `vocab` | Optional shared vocab to pass in on initialization. If `True` (default), a new `Vocab` object will be created. ~~Union[Vocab, bool]~~ | -| `disable` | Names of pipeline components to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [nlp.enable_pipe](/api/language#enable_pipe). ~~List[str]~~ | -| `enable` | Names of pipeline components to [enable](/usage/processing-pipelines#disabling). All other pipes will be disabled. ~~List[str]~~ | -| `exclude` 3 | Names of pipeline components to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~List[str]~~ | -| `config` 3 | Optional config overrides, either as nested dict or dict keyed by section value in dot notation, e.g. `"components.name.value"`. ~~Union[Dict[str, Any], Config]~~ | -| **RETURNS** | A `Language` object with the loaded pipeline. ~~Language~~ | +| Name | Description | +| ------------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | +| `name` | Pipeline to load, i.e. package name or path. ~~Union[str, Path]~~ | +| _keyword-only_ | | +| `vocab` | Optional shared vocab to pass in on initialization. If `True` (default), a new `Vocab` object will be created. ~~Union[Vocab, bool]~~ | +| `disable` | Name(s) of pipeline component(s) to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [nlp.enable_pipe](/api/language#enable_pipe). ~~Union[str, Iterable[str]]~~ | +| `enable` 3.4 | Name(s) of pipeline component(s) to [enable](/usage/processing-pipelines#disabling). All other pipes will be disabled. ~~Union[str, Iterable[str]]~~ | +| `exclude` 3 | Name(s) of pipeline component(s) to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~Union[str, Iterable[str]]~~ | +| `config` 3 | Optional config overrides, either as nested dict or dict keyed by section value in dot notation, e.g. `"components.name.value"`. ~~Union[Dict[str, Any], Config]~~ | +| **RETURNS** | A `Language` object with the loaded pipeline. ~~Language~~ | Essentially, `spacy.load()` is a convenience wrapper that reads the pipeline's [`config.cfg`](/api/data-formats#config), uses the language and pipeline @@ -1049,15 +1049,16 @@ and create a `Language` object. The model data will then be loaded in via > nlp = util.load_model("/path/to/data") > ``` -| Name | Description | -| ------------------------------------ | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | -| `name` | Package name or path. ~~str~~ | -| _keyword-only_ | | -| `vocab` | Optional shared vocab to pass in on initialization. If `True` (default), a new `Vocab` object will be created. ~~Union[Vocab, bool]~~ | -| `disable` | Names of pipeline components to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [`nlp.enable_pipe`](/api/language#enable_pipe). ~~List[str]~~ | -| `exclude` 3 | Names of pipeline components to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~List[str]~~ | -| `config` 3 | Config overrides as nested dict or flat dict keyed by section values in dot notation, e.g. `"nlp.pipeline"`. ~~Union[Dict[str, Any], Config]~~ | -| **RETURNS** | `Language` class with the loaded pipeline. ~~Language~~ | +| Name | Description | +| ------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `name` | Package name or path. ~~str~~ | +| _keyword-only_ | | +| `vocab` | Optional shared vocab to pass in on initialization. If `True` (default), a new `Vocab` object will be created. ~~Union[Vocab, bool]~~ | +| `disable` | Name(s) of pipeline component(s) to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [`nlp.enable_pipe`](/api/language#enable_pipe). ~~Union[str, Iterable[str]]~~ | +| `enable` 3.4 | Name(s) of pipeline component(s) to [enable](/usage/processing-pipelines#disabling). All other pipes will be disabled, but can be enabled again using [`nlp.enable_pipe`](/api/language#enable_pipe). ~~Union[str, Iterable[str]]~~ | +| `exclude` | Name(s) of pipeline component(s) to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~Union[str, Iterable[str]]~~ | +| `config` 3 | Config overrides as nested dict or flat dict keyed by section values in dot notation, e.g. `"nlp.pipeline"`. ~~Union[Dict[str, Any], Config]~~ | +| **RETURNS** | `Language` class with the loaded pipeline. ~~Language~~ | ### util.load_model_from_init_py {#util.load_model_from_init_py tag="function" new="2"} @@ -1073,15 +1074,16 @@ A helper function to use in the `load()` method of a pipeline package's > return load_model_from_init_py(__file__, **overrides) > ``` -| Name | Description | -| ------------------------------------ | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `init_file` | Path to package's `__init__.py`, i.e. `__file__`. ~~Union[str, Path]~~ | -| _keyword-only_ | | -| `vocab` 3 | Optional shared vocab to pass in on initialization. If `True` (default), a new `Vocab` object will be created. ~~Union[Vocab, bool]~~ | -| `disable` | Names of pipeline components to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [nlp.enable_pipe](/api/language#enable_pipe). ~~List[str]~~ | -| `exclude` 3 | Names of pipeline components to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~List[str]~~ | -| `config` 3 | Config overrides as nested dict or flat dict keyed by section values in dot notation, e.g. `"nlp.pipeline"`. ~~Union[Dict[str, Any], Config]~~ | -| **RETURNS** | `Language` class with the loaded pipeline. ~~Language~~ | +| Name | Description | +| ------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `init_file` | Path to package's `__init__.py`, i.e. `__file__`. ~~Union[str, Path]~~ | +| _keyword-only_ | | +| `vocab` 3 | Optional shared vocab to pass in on initialization. If `True` (default), a new `Vocab` object will be created. ~~Union[Vocab, bool]~~ | +| `disable` | Name(s) of pipeline component(s) to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [`nlp.enable_pipe`](/api/language#enable_pipe). ~~Union[str, Iterable[str]]~~ | +| `enable` 3.4 | Name(s) of pipeline component(s) to [enable](/usage/processing-pipelines#disabling). All other pipes will be disabled, but can be enabled again using [`nlp.enable_pipe`](/api/language#enable_pipe). ~~Union[str, Iterable[str]]~~ | +| `exclude` 3 | Name(s) of pipeline component(s) to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~Union[str, Iterable[str]]~~ | +| `config` 3 | Config overrides as nested dict or flat dict keyed by section values in dot notation, e.g. `"nlp.pipeline"`. ~~Union[Dict[str, Any], Config]~~ | +| **RETURNS** | `Language` class with the loaded pipeline. ~~Language~~ | ### util.load_config {#util.load_config tag="function" new="3"} From 78f5503a29b3ab27b860220499346b79d26e666b Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Thu, 1 Sep 2022 19:37:23 +0200 Subject: [PATCH 08/34] Check for any non-Doc returned value for components (#11424) --- spacy/errors.py | 5 +++-- spacy/language.py | 4 ++-- spacy/tests/test_language.py | 22 ++++++++++++++++++++++ 3 files changed, 27 insertions(+), 4 deletions(-) diff --git a/spacy/errors.py b/spacy/errors.py index 608305a06..5ee1476c2 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -230,8 +230,9 @@ class Errors(metaclass=ErrorsWithCodes): "initialized component.") E004 = ("Can't set up pipeline component: a factory for '{name}' already " "exists. Existing factory: {func}. New factory: {new_func}") - E005 = ("Pipeline component '{name}' returned None. If you're using a " - "custom component, maybe you forgot to return the processed Doc?") + E005 = ("Pipeline component '{name}' returned {returned_type} instead of a " + "Doc. If you're using a custom component, maybe you forgot to " + "return the processed Doc?") E006 = ("Invalid constraints for adding pipeline component. You can only " "set one of the following: before (component name or index), " "after (component name or index), first (True) or last (True). " diff --git a/spacy/language.py b/spacy/language.py index ec330753c..34a06e576 100644 --- a/spacy/language.py +++ b/spacy/language.py @@ -1028,8 +1028,8 @@ class Language: raise ValueError(Errors.E109.format(name=name)) from e except Exception as e: error_handler(name, proc, [doc], e) - if doc is None: - raise ValueError(Errors.E005.format(name=name)) + if not isinstance(doc, Doc): + raise ValueError(Errors.E005.format(name=name, returned_type=type(doc))) return doc def disable_pipes(self, *names) -> "DisabledPipes": diff --git a/spacy/tests/test_language.py b/spacy/tests/test_language.py index 6f3ba8acc..03a98d32f 100644 --- a/spacy/tests/test_language.py +++ b/spacy/tests/test_language.py @@ -670,3 +670,25 @@ def test_dot_in_factory_names(nlp): with pytest.raises(ValueError, match="not permitted"): Language.factory("my.evil.component.v1", func=evil_component) + + +def test_component_return(): + """Test that an error is raised if components return a type other than a + doc.""" + nlp = English() + + @Language.component("test_component_good_pipe") + def good_pipe(doc): + return doc + + nlp.add_pipe("test_component_good_pipe") + nlp("text") + nlp.remove_pipe("test_component_good_pipe") + + @Language.component("test_component_bad_pipe") + def bad_pipe(doc): + return doc.text + + nlp.add_pipe("test_component_bad_pipe") + with pytest.raises(ValueError, match="instead of a Doc"): + nlp("text") From d1760ebe027852a10b3ba7c5c7a187859bdae76b Mon Sep 17 00:00:00 2001 From: Madeesh Kannan Date: Fri, 2 Sep 2022 09:09:48 +0200 Subject: [PATCH 09/34] Better handling of unexpected types in `SetPredicate` (#11312) * `Matcher`: Better type checking of values in `SetPredicate` `SetPredicate`: Emit warning and return `False` on unexpected value types * Rename `value_type_mismatch` variable * Inline warning * Remove unexpected type warning from `_SetPredicate` * Ensure that `str` values are not interpreted as sequences Check elements of sequence values for convertibility to `str` or `int` * Add more `INTERSECT` and `IN` test cases * Test for inputs with multiple characters * Return `False` early instead of using a boolean flag * Remove superfluous `int` check, parentheses * Apply suggestions from code review Co-authored-by: Adriane Boyd * Appy suggestions from code review * Clarify test comment Co-authored-by: Adriane Boyd --- spacy/matcher/matcher.pyx | 23 +++++++++++++++-------- spacy/tests/matcher/test_matcher_api.py | 20 +++++++++++++++++++- 2 files changed, 34 insertions(+), 9 deletions(-) diff --git a/spacy/matcher/matcher.pyx b/spacy/matcher/matcher.pyx index 5105f69ed..e1dba01a2 100644 --- a/spacy/matcher/matcher.pyx +++ b/spacy/matcher/matcher.pyx @@ -1,5 +1,5 @@ # cython: infer_types=True, cython: profile=True -from typing import List +from typing import List, Iterable from libcpp.vector cimport vector from libc.stdint cimport int32_t, int8_t @@ -867,20 +867,27 @@ class _SetPredicate: def __call__(self, Token token): if self.is_extension: - value = get_string_id(token._.get(self.attr)) + value = token._.get(self.attr) else: value = get_token_attr_for_matcher(token.c, self.attr) - if self.predicate in ("IS_SUBSET", "IS_SUPERSET", "INTERSECTS"): + if self.predicate in ("IN", "NOT_IN"): + if isinstance(value, (str, int)): + value = get_string_id(value) + else: + return False + elif self.predicate in ("IS_SUBSET", "IS_SUPERSET", "INTERSECTS"): + # ensure that all values are enclosed in a set if self.attr == MORPH: # break up MORPH into individual Feat=Val values value = set(get_string_id(v) for v in MorphAnalysis.from_id(self.vocab, value)) + elif isinstance(value, (str, int)): + value = set((get_string_id(value),)) + elif isinstance(value, Iterable) and all(isinstance(v, (str, int)) for v in value): + value = set(get_string_id(v) for v in value) else: - # treat a single value as a list - if isinstance(value, (str, int)): - value = set([get_string_id(value)]) - else: - value = set(get_string_id(v) for v in value) + return False + if self.predicate == "IN": return value in self.value elif self.predicate == "NOT_IN": diff --git a/spacy/tests/matcher/test_matcher_api.py b/spacy/tests/matcher/test_matcher_api.py index 7c16da9f8..ac905eeb4 100644 --- a/spacy/tests/matcher/test_matcher_api.py +++ b/spacy/tests/matcher/test_matcher_api.py @@ -368,6 +368,16 @@ def test_matcher_intersect_value_operator(en_vocab): doc[0]._.ext = ["A", "B"] assert len(matcher(doc)) == 1 + # INTERSECTS matches nothing for iterables that aren't all str or int + matcher = Matcher(en_vocab) + pattern = [{"_": {"ext": {"INTERSECTS": ["Abx", "C"]}}}] + matcher.add("M", [pattern]) + doc = Doc(en_vocab, words=["a", "b", "c"]) + doc[0]._.ext = [["Abx"], "B"] + assert len(matcher(doc)) == 0 + doc[0]._.ext = ["Abx", "B"] + assert len(matcher(doc)) == 1 + # INTERSECTS with an empty pattern list matches nothing matcher = Matcher(en_vocab) pattern = [{"_": {"ext": {"INTERSECTS": []}}}] @@ -476,14 +486,22 @@ def test_matcher_extension_set_membership(en_vocab): assert len(matches) == 0 -@pytest.mark.xfail(reason="IN predicate must handle sequence values in extensions") def test_matcher_extension_in_set_predicate(en_vocab): matcher = Matcher(en_vocab) Token.set_extension("ext", default=[]) pattern = [{"_": {"ext": {"IN": ["A", "C"]}}}] matcher.add("M", [pattern]) doc = Doc(en_vocab, words=["a", "b", "c"]) + + # The IN predicate expects an exact match between the + # extension value and one of the pattern's values. doc[0]._.ext = ["A", "B"] + assert len(matcher(doc)) == 0 + + doc[0]._.ext = ["A"] + assert len(matcher(doc)) == 0 + + doc[0]._.ext = "A" assert len(matcher(doc)) == 1 From 71884d0942c9b45f0ce5408496aec1aff2f0a4b7 Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 2 Sep 2022 11:43:20 +0200 Subject: [PATCH 10/34] Auto-format code with black (#11427) Co-authored-by: explosion-bot --- spacy/lang/la/__init__.py | 2 +- spacy/lang/la/lex_attrs.py | 4 +- spacy/lang/la/tokenizer_exceptions.py | 70 ++++++++++++++++++++++----- spacy/tests/conftest.py | 2 +- spacy/tests/lang/la/test_exception.py | 1 + spacy/tests/lang/la/test_text.py | 4 +- 6 files changed, 67 insertions(+), 16 deletions(-) diff --git a/spacy/lang/la/__init__.py b/spacy/lang/la/__init__.py index 5f2cccee3..15b87c5b9 100644 --- a/spacy/lang/la/__init__.py +++ b/spacy/lang/la/__init__.py @@ -6,7 +6,7 @@ from .lex_attrs import LEX_ATTRS class LatinDefaults(BaseDefaults): tokenizer_exceptions = TOKENIZER_EXCEPTIONS - stop_words = STOP_WORDS + stop_words = STOP_WORDS lex_attr_getters = LEX_ATTRS diff --git a/spacy/lang/la/lex_attrs.py b/spacy/lang/la/lex_attrs.py index 9348a811a..9efb4dd3c 100644 --- a/spacy/lang/la/lex_attrs.py +++ b/spacy/lang/la/lex_attrs.py @@ -2,7 +2,9 @@ from ...attrs import LIKE_NUM import re # cf. Goyvaerts/Levithan 2009; case-insensitive, allow 4 -roman_numerals_compile = re.compile(r'(?i)^(?=[MDCLXVI])M*(C[MD]|D?C{0,4})(X[CL]|L?X{0,4})(I[XV]|V?I{0,4})$') +roman_numerals_compile = re.compile( + r"(?i)^(?=[MDCLXVI])M*(C[MD]|D?C{0,4})(X[CL]|L?X{0,4})(I[XV]|V?I{0,4})$" +) _num_words = set( """ diff --git a/spacy/lang/la/tokenizer_exceptions.py b/spacy/lang/la/tokenizer_exceptions.py index 905304188..060f6e085 100644 --- a/spacy/lang/la/tokenizer_exceptions.py +++ b/spacy/lang/la/tokenizer_exceptions.py @@ -9,21 +9,67 @@ _exc = { "tecum": [{ORTH: "te"}, {ORTH: "cum"}], "nobiscum": [{ORTH: "nobis"}, {ORTH: "cum"}], "vobiscum": [{ORTH: "vobis"}, {ORTH: "cum"}], - "uobiscum": [{ORTH: "uobis"}, {ORTH: "cum"}], + "uobiscum": [{ORTH: "uobis"}, {ORTH: "cum"}], } for orth in [ - - 'A.', 'Agr.', 'Ap.', 'C.', 'Cn.', 'D.', 'F.', 'K.', 'L.', "M'.", 'M.', 'Mam.', 'N.', 'Oct.', - 'Opet.', 'P.', 'Paul.', 'Post.', 'Pro.', 'Q.', 'S.', 'Ser.', 'Sert.', 'Sex.', 'St.', 'Sta.', - 'T.', 'Ti.', 'V.', 'Vol.', 'Vop.', 'U.', 'Uol.', 'Uop.', - - 'Ian.', 'Febr.', 'Mart.', 'Apr.', 'Mai.', 'Iun.', 'Iul.', 'Aug.', 'Sept.', 'Oct.', 'Nov.', 'Nou.', - 'Dec.', - - 'Non.', 'Id.', 'A.D.', - - 'Coll.', 'Cos.', 'Ord.', 'Pl.', 'S.C.', 'Suff.', 'Trib.', + "A.", + "Agr.", + "Ap.", + "C.", + "Cn.", + "D.", + "F.", + "K.", + "L.", + "M'.", + "M.", + "Mam.", + "N.", + "Oct.", + "Opet.", + "P.", + "Paul.", + "Post.", + "Pro.", + "Q.", + "S.", + "Ser.", + "Sert.", + "Sex.", + "St.", + "Sta.", + "T.", + "Ti.", + "V.", + "Vol.", + "Vop.", + "U.", + "Uol.", + "Uop.", + "Ian.", + "Febr.", + "Mart.", + "Apr.", + "Mai.", + "Iun.", + "Iul.", + "Aug.", + "Sept.", + "Oct.", + "Nov.", + "Nou.", + "Dec.", + "Non.", + "Id.", + "A.D.", + "Coll.", + "Cos.", + "Ord.", + "Pl.", + "S.C.", + "Suff.", + "Trib.", ]: _exc[orth] = [{ORTH: orth}] diff --git a/spacy/tests/conftest.py b/spacy/tests/conftest.py index 0395ba7ca..742bfcc6a 100644 --- a/spacy/tests/conftest.py +++ b/spacy/tests/conftest.py @@ -258,7 +258,7 @@ def ko_tokenizer_tokenizer(): @pytest.fixture(scope="module") def la_tokenizer(): - return get_lang_class("la")().tokenizer + return get_lang_class("la")().tokenizer @pytest.fixture(scope="session") diff --git a/spacy/tests/lang/la/test_exception.py b/spacy/tests/lang/la/test_exception.py index 04bc1d489..966ae22cf 100644 --- a/spacy/tests/lang/la/test_exception.py +++ b/spacy/tests/lang/la/test_exception.py @@ -1,5 +1,6 @@ import pytest + def test_la_tokenizer_handles_exc_in_text(la_tokenizer): text = "scio te omnia facturum, ut nobiscum quam primum sis" tokens = la_tokenizer(text) diff --git a/spacy/tests/lang/la/test_text.py b/spacy/tests/lang/la/test_text.py index 11676b92b..48e7359a4 100644 --- a/spacy/tests/lang/la/test_text.py +++ b/spacy/tests/lang/la/test_text.py @@ -1,6 +1,7 @@ import pytest from spacy.lang.la.lex_attrs import like_num + @pytest.mark.parametrize( "text,match", [ @@ -13,7 +14,7 @@ from spacy.lang.la.lex_attrs import like_num ("ix", True), ("MMXXII", True), ("0", True), - ("1", True), + ("1", True), ("quattuor", True), ("decem", True), ("tertius", True), @@ -27,6 +28,7 @@ def test_lex_attrs_like_number(la_tokenizer, text, match): assert len(tokens) == 1 assert tokens[0].like_num == match + @pytest.mark.parametrize("word", ["quinque"]) def test_la_lex_attrs_capitals(word): assert like_num(word) From 977dc33312dd189b5b4ae1d791031d090c169c24 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Fri, 2 Sep 2022 18:58:21 +0900 Subject: [PATCH 11/34] Add a way to get the URL to download a pipeline to the CLI (#11175) * Add a dry run flag to download * Remove --dry-run, add --url option to `spacy info` instead * Make mypy happy * Print only the URL, so it's easier to use in scripts * Don't add the egg hash unless downloading an sdist * Update spacy/cli/info.py Co-authored-by: Sofie Van Landeghem * Add two implementations of requirements * Clean up requirements sample slightly This should make mypy happy * Update URL help string * Remove requirements option * Add url option to docs * Add URL to spacy info model output, when available * Add types-setuptools to testing reqs * Add types-setuptools to requirements * Add "compatible", expand docstring * Update spacy/cli/info.py Co-authored-by: Adriane Boyd * Run prettier on CLI docs * Update docs Add a sidebar about finding download URLs, with some examples of the new command. * Add download URLs to table on model page * Apply suggestions from code review Co-authored-by: Adriane Boyd * Updates from review * download url -> download link * Update docs Co-authored-by: Sofie Van Landeghem Co-authored-by: Adriane Boyd --- requirements.txt | 1 + spacy/cli/download.py | 32 ++++++++++--- spacy/cli/info.py | 58 +++++++++++++++++++++++- spacy/tests/package/test_requirements.py | 1 + website/docs/api/cli.md | 17 +++---- website/docs/usage/models.md | 36 ++++++++++----- website/src/templates/models.js | 10 ++++ 7 files changed, 127 insertions(+), 28 deletions(-) diff --git a/requirements.txt b/requirements.txt index 3b8d66e0e..3e8501b2f 100644 --- a/requirements.txt +++ b/requirements.txt @@ -34,4 +34,5 @@ mypy>=0.910,<0.970; platform_machine!='aarch64' types-dataclasses>=0.1.3; python_version < "3.7" types-mock>=0.1.1 types-requests +types-setuptools>=57.0.0 black>=22.0,<23.0 diff --git a/spacy/cli/download.py b/spacy/cli/download.py index b7de88729..0c9a32b93 100644 --- a/spacy/cli/download.py +++ b/spacy/cli/download.py @@ -20,7 +20,7 @@ def download_cli( ctx: typer.Context, model: str = Arg(..., help="Name of pipeline package to download"), direct: bool = Opt(False, "--direct", "-d", "-D", help="Force direct download of name + version"), - sdist: bool = Opt(False, "--sdist", "-S", help="Download sdist (.tar.gz) archive instead of pre-built binary wheel") + sdist: bool = Opt(False, "--sdist", "-S", help="Download sdist (.tar.gz) archive instead of pre-built binary wheel"), # fmt: on ): """ @@ -36,7 +36,12 @@ def download_cli( download(model, direct, sdist, *ctx.args) -def download(model: str, direct: bool = False, sdist: bool = False, *pip_args) -> None: +def download( + model: str, + direct: bool = False, + sdist: bool = False, + *pip_args, +) -> None: if ( not (is_package("spacy") or is_package("spacy-nightly")) and "--no-deps" not in pip_args @@ -50,13 +55,10 @@ def download(model: str, direct: bool = False, sdist: bool = False, *pip_args) - "dependencies, you'll have to install them manually." ) pip_args = pip_args + ("--no-deps",) - suffix = SDIST_SUFFIX if sdist else WHEEL_SUFFIX - dl_tpl = "{m}-{v}/{m}-{v}{s}#egg={m}=={v}" if direct: components = model.split("-") model_name = "".join(components[:-1]) version = components[-1] - download_model(dl_tpl.format(m=model_name, v=version, s=suffix), pip_args) else: model_name = model if model in OLD_MODEL_SHORTCUTS: @@ -67,13 +69,26 @@ def download(model: str, direct: bool = False, sdist: bool = False, *pip_args) - model_name = OLD_MODEL_SHORTCUTS[model] compatibility = get_compatibility() version = get_version(model_name, compatibility) - download_model(dl_tpl.format(m=model_name, v=version, s=suffix), pip_args) + + filename = get_model_filename(model_name, version, sdist) + + download_model(filename, pip_args) msg.good( "Download and installation successful", f"You can now load the package via spacy.load('{model_name}')", ) +def get_model_filename(model_name: str, version: str, sdist: bool = False) -> str: + dl_tpl = "{m}-{v}/{m}-{v}{s}" + egg_tpl = "#egg={m}=={v}" + suffix = SDIST_SUFFIX if sdist else WHEEL_SUFFIX + filename = dl_tpl.format(m=model_name, v=version, s=suffix) + if sdist: + filename += egg_tpl.format(m=model_name, v=version) + return filename + + def get_compatibility() -> dict: if is_prerelease_version(about.__version__): version: Optional[str] = about.__version__ @@ -105,6 +120,11 @@ def get_version(model: str, comp: dict) -> str: return comp[model][0] +def get_latest_version(model: str) -> str: + comp = get_compatibility() + return get_version(model, comp) + + def download_model( filename: str, user_pip_args: Optional[Sequence[str]] = None ) -> None: diff --git a/spacy/cli/info.py b/spacy/cli/info.py index e6a1cb616..e6ac4270f 100644 --- a/spacy/cli/info.py +++ b/spacy/cli/info.py @@ -1,10 +1,13 @@ from typing import Optional, Dict, Any, Union, List import platform +import pkg_resources +import json from pathlib import Path from wasabi import Printer, MarkdownRenderer import srsly from ._util import app, Arg, Opt, string_to_list +from .download import get_model_filename, get_latest_version from .. import util from .. import about @@ -16,6 +19,7 @@ def info_cli( markdown: bool = Opt(False, "--markdown", "-md", help="Generate Markdown for GitHub issues"), silent: bool = Opt(False, "--silent", "-s", "-S", help="Don't print anything (just return)"), exclude: str = Opt("labels", "--exclude", "-e", help="Comma-separated keys to exclude from the print-out"), + url: bool = Opt(False, "--url", "-u", help="Print the URL to download the most recent compatible version of the pipeline"), # fmt: on ): """ @@ -23,10 +27,19 @@ def info_cli( print its meta information. Flag --markdown prints details in Markdown for easy copy-pasting to GitHub issues. + Flag --url prints only the download URL of the most recent compatible + version of the pipeline. + DOCS: https://spacy.io/api/cli#info """ exclude = string_to_list(exclude) - info(model, markdown=markdown, silent=silent, exclude=exclude) + info( + model, + markdown=markdown, + silent=silent, + exclude=exclude, + url=url, + ) def info( @@ -35,11 +48,20 @@ def info( markdown: bool = False, silent: bool = True, exclude: Optional[List[str]] = None, + url: bool = False, ) -> Union[str, dict]: msg = Printer(no_print=silent, pretty=not silent) if not exclude: exclude = [] - if model: + if url: + if model is not None: + title = f"Download info for pipeline '{model}'" + data = info_model_url(model) + print(data["download_url"]) + return data + else: + msg.fail("--url option requires a pipeline name", exits=1) + elif model: title = f"Info about pipeline '{model}'" data = info_model(model, silent=silent) else: @@ -99,11 +121,43 @@ def info_model(model: str, *, silent: bool = True) -> Dict[str, Any]: meta["source"] = str(model_path.resolve()) else: meta["source"] = str(model_path) + download_url = info_installed_model_url(model) + if download_url: + meta["download_url"] = download_url return { k: v for k, v in meta.items() if k not in ("accuracy", "performance", "speed") } +def info_installed_model_url(model: str) -> Optional[str]: + """Given a pipeline name, get the download URL if available, otherwise + return None. + + This is only available for pipelines installed as modules that have + dist-info available. + """ + try: + dist = pkg_resources.get_distribution(model) + data = json.loads(dist.get_metadata("direct_url.json")) + return data["url"] + except pkg_resources.DistributionNotFound: + # no such package + return None + except Exception: + # something else, like no file or invalid JSON + return None + +def info_model_url(model: str) -> Dict[str, Any]: + """Return the download URL for the latest version of a pipeline.""" + version = get_latest_version(model) + + filename = get_model_filename(model, version) + download_url = about.__download_url__ + "/" + filename + release_tpl = "https://github.com/explosion/spacy-models/releases/tag/{m}-{v}" + release_url = release_tpl.format(m=model, v=version) + return {"download_url": download_url, "release_url": release_url} + + def get_markdown( data: Dict[str, Any], title: Optional[str] = None, diff --git a/spacy/tests/package/test_requirements.py b/spacy/tests/package/test_requirements.py index e20227455..b403f274f 100644 --- a/spacy/tests/package/test_requirements.py +++ b/spacy/tests/package/test_requirements.py @@ -17,6 +17,7 @@ def test_build_dependencies(): "types-dataclasses", "types-mock", "types-requests", + "types-setuptools", ] # ignore language-specific packages that shouldn't be installed by all libs_ignore_setup = [ diff --git a/website/docs/api/cli.md b/website/docs/api/cli.md index cbd1f794a..e5cd3089b 100644 --- a/website/docs/api/cli.md +++ b/website/docs/api/cli.md @@ -77,14 +77,15 @@ $ python -m spacy info [--markdown] [--silent] [--exclude] $ python -m spacy info [model] [--markdown] [--silent] [--exclude] ``` -| Name | Description | -| ------------------------------------------------ | --------------------------------------------------------------------------------------------- | -| `model` | A trained pipeline, i.e. package name or path (optional). ~~Optional[str] \(option)~~ | -| `--markdown`, `-md` | Print information as Markdown. ~~bool (flag)~~ | -| `--silent`, `-s` 2.0.12 | Don't print anything, just return the values. ~~bool (flag)~~ | -| `--exclude`, `-e` | Comma-separated keys to exclude from the print-out. Defaults to `"labels"`. ~~Optional[str]~~ | -| `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | -| **PRINTS** | Information about your spaCy installation. | +| Name | Description | +| ------------------------------------------------ | ----------------------------------------------------------------------------------------------------------------------- | +| `model` | A trained pipeline, i.e. package name or path (optional). ~~Optional[str] \(option)~~ | +| `--markdown`, `-md` | Print information as Markdown. ~~bool (flag)~~ | +| `--silent`, `-s` 2.0.12 | Don't print anything, just return the values. ~~bool (flag)~~ | +| `--exclude`, `-e` | Comma-separated keys to exclude from the print-out. Defaults to `"labels"`. ~~Optional[str]~~ | +| `--url`, `-u` 3.5.0 | Print the URL to download the most recent compatible version of the pipeline. Requires a pipeline name. ~~bool (flag)~~ | +| `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | +| **PRINTS** | Information about your spaCy installation. | ## validate {#validate new="2" tag="command"} diff --git a/website/docs/usage/models.md b/website/docs/usage/models.md index 56992e7e3..6971ac8b4 100644 --- a/website/docs/usage/models.md +++ b/website/docs/usage/models.md @@ -365,15 +365,32 @@ pipeline package can be found. To download a trained pipeline directly using [pip](https://pypi.python.org/pypi/pip), point `pip install` to the URL or local path of the wheel file or archive. Installing the wheel is usually more -efficient. To find the direct link to a package, head over to the -[releases](https://github.com/explosion/spacy-models/releases), right click on -the archive link and copy it to your clipboard. +efficient. + +> #### Pipeline Package URLs {#pipeline-urls} +> +> Pretrained pipeline distributions are hosted on +> [Github Releases](https://github.com/explosion/spacy-models/releases), and you +> can find download links there, as well as on the model page. You can also get +> URLs directly from the command line by using `spacy info` with the `--url` +> flag, which may be useful for automation. +> +> ```bash +> spacy info en_core_web_sm --url +> ``` +> +> This command will print the URL for the latest version of a pipeline +> compatible with the version of spaCy you're using. Note that in order to look +> up the compatibility information an internet connection is required. ```bash # With external URL $ pip install https://github.com/explosion/spacy-models/releases/download/en_core_web_sm-3.0.0/en_core_web_sm-3.0.0-py3-none-any.whl $ pip install https://github.com/explosion/spacy-models/releases/download/en_core_web_sm-3.0.0/en_core_web_sm-3.0.0.tar.gz +# Using spacy info to get the external URL +$ pip install $(spacy info en_core_web_sm --url) + # With local file $ pip install /Users/you/en_core_web_sm-3.0.0-py3-none-any.whl $ pip install /Users/you/en_core_web_sm-3.0.0.tar.gz @@ -514,21 +531,16 @@ should be specifying them directly. Because pipeline packages are valid Python packages, you can add them to your application's `requirements.txt`. If you're running your own internal PyPi installation, you can upload the pipeline packages there. pip's -[requirements file format](https://pip.pypa.io/en/latest/reference/pip_install/#requirements-file-format) -supports both package names to download via a PyPi server, as well as direct -URLs. +[requirements file format](https://pip.pypa.io/en/latest/reference/requirements-file-format/) +supports both package names to download via a PyPi server, as well as +[direct URLs](#pipeline-urls). ```text ### requirements.txt spacy>=3.0.0,<4.0.0 -https://github.com/explosion/spacy-models/releases/download/en_core_web_sm-3.0.0/en_core_web_sm-3.0.0.tar.gz#egg=en_core_web_sm +en_core_web_sm @ https://github.com/explosion/spacy-models/releases/download/en_core_web_sm-3.4.0/en_core_web_sm-3.4.0-py3-none-any.whl ``` -Specifying `#egg=` with the package name tells pip which package to expect from -the download URL. This way, the package won't be re-downloaded and overwritten -if it's already installed - just like when you're downloading a package from -PyPi. - All pipeline packages are versioned and specify their spaCy dependency. This ensures cross-compatibility and lets you specify exact version requirements for each pipeline. If you've [trained](/usage/training) your own pipeline, you can diff --git a/website/src/templates/models.js b/website/src/templates/models.js index df53f8c3c..16a2360d5 100644 --- a/website/src/templates/models.js +++ b/website/src/templates/models.js @@ -76,6 +76,7 @@ const MODEL_META = { benchmark_ner: 'NER accuracy', benchmark_speed: 'Speed', compat: 'Latest compatible package version for your spaCy installation', + download_link: 'Download link for the pipeline', } const LABEL_SCHEME_META = { @@ -138,6 +139,13 @@ function formatAccuracy(data, lang) { .filter(item => item) } +function formatDownloadLink(lang, name, version) { + const fullName = `${lang}_${name}-${version}` + const filename = `${fullName}-py3-none-any.whl` + const url = `https://github.com/explosion/spacy-models/releases/download/${fullName}/${filename}` + return {filename} +} + function formatModelMeta(data) { return { fullName: `${data.lang}_${data.name}-${data.version}`, @@ -154,6 +162,7 @@ function formatModelMeta(data) { labels: isEmptyObj(data.labels) ? null : data.labels, vectors: formatVectors(data.vectors), accuracy: formatAccuracy(data.performance, data.lang), + download_link: formatDownloadLink(data.lang, data.name, data.version), } } @@ -244,6 +253,7 @@ const Model = ({ { label: 'Components', content: components, help: MODEL_META.components }, { label: 'Pipeline', content: pipeline, help: MODEL_META.pipeline }, { label: 'Vectors', content: meta.vectors, help: MODEL_META.vecs }, + { label: 'Download Link', content: meta.download_link, help: MODEL_META.download_link }, { label: 'Sources', content: sources, help: MODEL_META.sources }, { label: 'Author', content: author }, { label: 'License', content: license }, From ff0522f8daac603e4dfb2773e1a73da61acc621d Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Thu, 1 Sep 2022 11:35:52 +0900 Subject: [PATCH 12/34] Fix asent pip package name --- website/meta/universe.json | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/website/meta/universe.json b/website/meta/universe.json index 6c8caa6a6..9145855c6 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -1192,7 +1192,7 @@ "slogan": "Fast, flexible and transparent sentiment analysis", "description": "Asent is a rule-based sentiment analysis library for Python made using spaCy. It is inspired by VADER, but uses a more modular ruleset, that allows the user to change e.g. the method for finding negations. Furthermore it includes visualisers to visualize the model predictions, making the model easily interpretable.", "github": "kennethenevoldsen/asent", - "pip": "aseny", + "pip": "asent", "code_example": [ "import spacy", "import asent", From 515d5c65d5f5d05eb8d2777e59cb5680dfcb4bd9 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Wed, 7 Sep 2022 22:24:22 +0900 Subject: [PATCH 13/34] Add dev docs on satellite packages (#11435) * Add dev docs on satellite packages * Apply suggestions from code review Co-authored-by: Sofie Van Landeghem * Add displacy link Co-authored-by: Sofie Van Landeghem --- extra/DEVELOPER_DOCS/Satellite Packages.md | 82 ++++++++++++++++++++++ 1 file changed, 82 insertions(+) create mode 100644 extra/DEVELOPER_DOCS/Satellite Packages.md diff --git a/extra/DEVELOPER_DOCS/Satellite Packages.md b/extra/DEVELOPER_DOCS/Satellite Packages.md new file mode 100644 index 000000000..02b06a90e --- /dev/null +++ b/extra/DEVELOPER_DOCS/Satellite Packages.md @@ -0,0 +1,82 @@ +# spaCy Satellite Packages + +This is a list of all the active repos relevant to spaCy besides the main one, with short descriptions, history, and current status. Archived repos will not be covered. + +## Always Included in spaCy + +These packages are always pulled in when you install spaCy. Most of them are direct dependencies, but some are transitive dependencies through other packages. + +- [spacy-legacy](https://github.com/explosion/spacy-legacy): When an architecture in spaCy changes enough to get a new version, the old version is frozen and moved to spacy-legacy. This allows us to keep the core library slim while also preserving backwards compatability. +- [thinc](https://github.com/explosion/thinc): Thinc is the machine learning library that powers trainable components in spaCy. It wraps backends like Numpy, PyTorch, and Tensorflow to provide a functional interface for specifying architectures. +- [catalogue](https://github.com/explosion/catalogue): Small library for adding function registries, like those used for model architectures in spaCy. +- [confection](https://github.com/explosion/confection): This library contains the functionality for config parsing that was formerly contained directly in Thinc. +- [spacy-loggers](https://github.com/explosion/spacy-loggers): Contains loggers beyond the default logger available in spaCy's core code base. This includes loggers integrated with third-party services, which may differ in release cadence from spaCy itself. +- [wasabi](https://github.com/explosion/wasabi): A command line formatting library, used for terminal output in spaCy. +- [srsly](https://github.com/explosion/srsly): A wrapper that vendors several serialization libraries for spaCy. Includes parsers for JSON, JSONL, MessagePack, (extended) Pickle, and YAML. +- [preshed](https://github.com/explosion/preshed): A Cython library for low-level data structures like hash maps, used for memory efficient data storage. +- [cython-blis](https://github.com/explosion/cython-blis): Fast matrix multiplication using BLIS without depending on system libraries. Required by Thinc, rather than spaCy directly. +- [murmurhash](https://github.com/explosion/murmurhash): A wrapper library for a C++ murmurhash implementation, used for string IDs in spaCy and preshed. +- [cymem](https://github.com/explosion/cymem): A small library for RAII-style memory management in Cython. + +## Optional Extensions for spaCy + +These are repos that can be used by spaCy but aren't part of a default installation. Many of these are wrappers to integrate various kinds of third-party libraries. + +- [spacy-transformers](https://github.com/explosion/spacy-transformers): A wrapper for the [HuggingFace Transformers](https://huggingface.co/docs/transformers/index) library, this handles the extensive conversion necessary to coordinate spaCy's powerful `Doc` representation, training pipeline, and the Transformer embeddings. When released, this was known as `spacy-pytorch-transformers`, but it changed to the current name when HuggingFace update the name of their library as well. +- [spacy-huggingface-hub](https://github.com/explosion/spacy-huggingface-hub): This package has a CLI script for uploading a packaged spaCy pipeline (created with `spacy package`) to the [Hugging Face Hub](https://huggingface.co/models). +- [spacy-alignments](https://github.com/explosion/spacy-alignments): A wrapper for the tokenizations library (mentioned below) with a modified build system to simplify cross-platform wheel creation. Used in spacy-transformers for aligning spaCy and HuggingFace tokenizations. +- [spacy-experimental](https://github.com/explosion/spacy-experimental): Experimental components that are not quite ready for inclusion in the main spaCy library. Usually there are unresolved questions around their APIs, so the experimental library allows us to expose them to the community for feedback before fully integrating them. +- [spacy-lookups-data](https://github.com/explosion/spacy-lookups-data): A repository of linguistic data, such as lemmas, that takes up a lot of disk space. Originally created to reduce the size of the spaCy core library. This is mainly useful if you want the data included but aren't using a pretrained pipeline; for the affected languages, the relevant data is included in pretrained pipelines directly. +- [coreferee](https://github.com/explosion/coreferee): Coreference resolution for English, French, German and Polish, optimised for limited training data and easily extensible for further languages. Used as a spaCy pipeline component. +- [spacy-stanza](https://github.com/explosion/spacy-stanza): This is a wrapper that allows the use of Stanford's Stanza library in spaCy. +- [spacy-streamlit](https://github.com/explosion/spacy-streamlit): A wrapper for the Streamlit dashboard building library to help with integrating [displaCy](https://spacy.io/api/top-level/#displacy). +- [spacymoji](https://github.com/explosion/spacymoji): A library to add extra support for emoji to spaCy, such as including character names. +- [thinc-apple-ops](https://github.com/explosion/thinc-apple-ops): A special backend for OSX that uses Apple's native libraries for improved performance. +- [os-signpost](https://github.com/explosion/os-signpost): A Python package that allows you to use the `OSSignposter` API in OSX for performance analysis. +- [spacy-ray](https://github.com/explosion/spacy-ray): A wrapper to integrate spaCy with Ray, a distributed training framework. Currently a work in progress. + +## Prodigy + +[Prodigy](https://prodi.gy) is Explosion's easy to use and highly customizable tool for annotating data. Prodigy itself requires a license, but the repos below contain documentation, examples, and editor or notebook integrations. + +- [prodigy-recipes](https://github.com/explosion/prodigy-recipes): Sample recipes for Prodigy, along with notebooks and other examples of usage. +- [vscode-prodigy](https://github.com/explosion/vscode-prodigy): A VS Code extension that lets you run Prodigy inside VS Code. +- [jupyterlab-prodigy](https://github.com/explosion/jupyterlab-prodigy): An extension for JupyterLab that lets you run Prodigy inside JupyterLab. + +## Independent Tools or Projects + +These are tools that may be related to or use spaCy, but are functional independent projects in their own right as well. + +- [floret](https://github.com/explosion/floret): A modification of fastText to use Bloom Embeddings. Can be used to add vectors with subword features to spaCy, and also works independently in the same manner as fastText. +- [sense2vec](https://github.com/explosion/sense2vec): A library to make embeddings of noun phrases or words coupled with their part of speech. This library uses spaCy. +- [spacy-vectors-builder](https://github.com/explosion/spacy-vectors-builder): This is a spaCy project that builds vectors using floret and a lot of input text. It handles downloading the input data as well as the actual building of vectors. +- [holmes-extractor](https://github.com/explosion/holmes-extractor): Information extraction from English and German texts based on predicate logic. Uses spaCy. +- [healthsea](https://github.com/explosion/healthsea): Healthsea is a project to extract information from comments about health supplements. Structurally, it's a self-contained, large spaCy project. +- [spacy-pkuseg](https://github.com/explosion/spacy-pkuseg): A fork of the pkuseg Chinese tokenizer. Used for Chinese support in spaCy, but also works independently. +- [ml-datasets](https://github.com/explosion/ml-datasets): This repo includes loaders for several standard machine learning datasets, like MNIST or WikiNER, and has historically been used in spaCy example code and documentation. + +## Documentation and Informational Repos + +These repos are used to support the spaCy docs or otherwise present information about spaCy or other Explosion projects. + +- [projects](https://github.com/explosion/projects): The projects repo is used to show detailed examples of spaCy usage. Individual projects can be checked out using the spaCy command line tool, rather than checking out the projects repo directly. +- [spacy-course](https://github.com/explosion/spacy-course): Home to the interactive spaCy course for learning about how to use the library and some basic NLP principles. +- [spacy-io-binder](https://github.com/explosion/spacy-io-binder): Home to the notebooks used for interactive examples in the documentation. + +## Organizational / Meta + +These repos are used for organizing data around spaCy, but are not something an end user would need to install as part of using the library. + +- [spacy-models](https://github.com/explosion/spacy-models): This repo contains metadata (but not training data) for all the spaCy models. This includes information about where their training data came from, version compatability, and performance information. It also includes tests for the model packages, and the built models are hosted as releases of this repo. +- [wheelwright](https://github.com/explosion/wheelwright): A tool for automating our PyPI builds and releases. +- [ec2buildwheel](https://github.com/explosion/ec2buildwheel): A small project that allows you to build Python packages in the manner of cibuildwheel, but on any EC2 image. Used by wheelwright. + +## Other + +Repos that don't fit in any of the above categories. + +- [blis](https://github.com/explosion/blis): A fork of the official BLIS library. The main branch is not updated, but work continues in various branches. This is used for cython-blis. +- [tokenizations](https://github.com/explosion/tokenizations): A library originally by Yohei Tamura to align strings with tolerance to some variations in features like case and diacritics, used for aligning tokens and wordpieces. Adopted and maintained by Explosion, but usually spacy-alignments is used instead. +- [conll-2012](https://github.com/explosion/conll-2012): A repo to hold some slightly cleaned up versions of the official scripts for the CoNLL 2012 shared task involving coreference resolution. Used in the coref project. +- [fastapi-explosion-extras](https://github.com/explosion/fastapi-explosion-extras): Some small tweaks to FastAPI used at Explosion. + From 2602a30d326e561776fecce95ac03cc5df55652b Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Thu, 8 Sep 2022 20:42:47 +0900 Subject: [PATCH 14/34] Fix DVC command example (#11457) This command doesn't have the project dir, but it's required. --- website/docs/usage/projects.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/website/docs/usage/projects.md b/website/docs/usage/projects.md index 566ae561b..35150035a 100644 --- a/website/docs/usage/projects.md +++ b/website/docs/usage/projects.md @@ -758,7 +758,7 @@ and [`dvc repro`](https://dvc.org/doc/command-reference/repro) to reproduce the workflow or individual commands. ```cli -$ python -m spacy project dvc [workflow_name] +$ python -m spacy project dvc [project_dir] [workflow_name] ``` From aac9a58c2935768c7751b8db7043e7c073362c90 Mon Sep 17 00:00:00 2001 From: Madeesh Kannan Date: Fri, 9 Sep 2022 10:46:01 +0200 Subject: [PATCH 15/34] Add docs for the `spacy.models_and_pipes_with_nvtx_range.v1` callback (#11463) * Add docs for the `spacy.models_and_pipes_with_nvtx_range.v1` callback * Add `new` tag --- website/docs/api/top-level.md | 21 +++++++++++++++++++++ 1 file changed, 21 insertions(+) diff --git a/website/docs/api/top-level.md b/website/docs/api/top-level.md index 220b2d6e9..bc53fc868 100644 --- a/website/docs/api/top-level.md +++ b/website/docs/api/top-level.md @@ -887,6 +887,27 @@ backprop passes. | `backprop_color` | Color identifier for backpropagation passes. Defaults to `-1`. ~~int~~ | | **CREATES** | A function that takes the current `nlp` and wraps forward/backprop passes in NVTX ranges. ~~Callable[[Language], Language]~~ | +### spacy.models_and_pipes_with_nvtx_range.v1 {#models_and_pipes_with_nvtx_range tag="registered function" new="3.4"} + +> #### Example config +> +> ```ini +> [nlp] +> after_pipeline_creation = {"@callbacks":"spacy.models_and_pipes_with_nvtx_range.v1"} +> ``` + +Recursively wrap both the models and methods of each pipe using +[NVTX](https://nvidia.github.io/NVTX/) range markers. By default, the following +methods are wrapped: `pipe`, `predict`, `set_annotations`, `update`, `rehearse`, +`get_loss`, `initialize`, `begin_update`, `finish_update`, `update`. + +| Name | Description | +| --------------------------- | --------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `forward_color` | Color identifier for model forward passes. Defaults to `-1`. ~~int~~ | +| `backprop_color` | Color identifier for model backpropagation passes. Defaults to `-1`. ~~int~~ | +| `additional_pipe_functions` | Additional pipeline methods to wrap. Keys are pipeline names and values are lists of method identifiers. Defaults to `None`. ~~Optional[Dict[str, List[str]]]~~ | +| **CREATES** | A function that takes the current `nlp` and wraps pipe models and methods in NVTX ranges. ~~Callable[[Language], Language]~~ | + ## Training data and alignment {#gold source="spacy/training"} ### training.offsets_to_biluo_tags {#offsets_to_biluo_tags tag="function"} From 0c72c6bb2c04677654ffeda2a706e3df3a58b3cc Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 9 Sep 2022 11:21:17 +0200 Subject: [PATCH 16/34] Auto-format code with black (#11468) Co-authored-by: explosion-bot --- spacy/cli/info.py | 1 + 1 file changed, 1 insertion(+) diff --git a/spacy/cli/info.py b/spacy/cli/info.py index e6ac4270f..974bc0f4e 100644 --- a/spacy/cli/info.py +++ b/spacy/cli/info.py @@ -147,6 +147,7 @@ def info_installed_model_url(model: str) -> Optional[str]: # something else, like no file or invalid JSON return None + def info_model_url(model: str) -> Dict[str, Any]: """Return the download URL for the latest version of a pipeline.""" version = get_latest_version(model) From 8a86a35eab45a69d795c2950da61058047d1a516 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Fri, 9 Sep 2022 15:10:04 +0200 Subject: [PATCH 17/34] Remove has_letters in config template (#11465) Due to problems with the javascript conversion in the website quickstart, remove the `has_letters` setting to simplify generating `attrs` for the default `tok2vec`. Additionally reduce `PREFIX` as in the trained pipelines. --- spacy/cli/templates/quickstart_training.jinja | 7 +------ .../cli/templates/quickstart_training_recommendations.yml | 1 - 2 files changed, 1 insertion(+), 7 deletions(-) diff --git a/spacy/cli/templates/quickstart_training.jinja b/spacy/cli/templates/quickstart_training.jinja index ae11dcafc..58864883a 100644 --- a/spacy/cli/templates/quickstart_training.jinja +++ b/spacy/cli/templates/quickstart_training.jinja @@ -271,13 +271,8 @@ factory = "tok2vec" [components.tok2vec.model.embed] @architectures = "spacy.MultiHashEmbed.v2" width = ${components.tok2vec.model.encode.width} -{% if has_letters -%} attrs = ["NORM", "PREFIX", "SUFFIX", "SHAPE"] -rows = [5000, 2500, 2500, 2500] -{% else -%} -attrs = ["ORTH", "SHAPE"] -rows = [5000, 2500] -{% endif -%} +rows = [5000, 1000, 2500, 2500] include_static_vectors = {{ "true" if optimize == "accuracy" else "false" }} [components.tok2vec.model.encode] diff --git a/spacy/cli/templates/quickstart_training_recommendations.yml b/spacy/cli/templates/quickstart_training_recommendations.yml index a7bf9b74a..27945e27a 100644 --- a/spacy/cli/templates/quickstart_training_recommendations.yml +++ b/spacy/cli/templates/quickstart_training_recommendations.yml @@ -271,4 +271,3 @@ zh: accuracy: name: bert-base-chinese size_factor: 3 - has_letters: false From 6b83fee58db27cee70ef8d893cbbf7470db4e242 Mon Sep 17 00:00:00 2001 From: kadarakos Date: Fri, 9 Sep 2022 17:17:10 +0200 Subject: [PATCH 18/34] Assets message (#11458) * new error message when 'project run assets' * new error message when 'project run assets' * Update spacy/cli/project/run.py Co-authored-by: Sofie Van Landeghem Co-authored-by: Sofie Van Landeghem --- spacy/cli/project/run.py | 2 ++ 1 file changed, 2 insertions(+) diff --git a/spacy/cli/project/run.py b/spacy/cli/project/run.py index 734803bc4..d42d95465 100644 --- a/spacy/cli/project/run.py +++ b/spacy/cli/project/run.py @@ -195,6 +195,8 @@ def validate_subcommand( msg.fail(f"No commands or workflows defined in {PROJECT_FILE}", exits=1) if subcommand not in commands and subcommand not in workflows: help_msg = [] + if subcommand in ["assets", "asset"]: + help_msg.append("Did you mean to run: python -m spacy project assets?") if commands: help_msg.append(f"Available commands: {', '.join(commands)}") if workflows: From 0ec9a696e60933807c189c7be22623a81a840289 Mon Sep 17 00:00:00 2001 From: Madeesh Kannan Date: Mon, 12 Sep 2022 14:55:41 +0200 Subject: [PATCH 19/34] Fix config validation failures caused by NVTX pipeline wrappers (#11460) * Enable Cython<->Python bindings for `Pipe` and `TrainablePipe` methods * `pipes_with_nvtx_range`: Skip hooking methods whose signature cannot be ascertained When loading pipelines from a config file, the arguments passed to individual pipeline components is validated by `pydantic` during init. For this, the validation model attempts to parse the function signature of the component's c'tor/entry point so that it can check if all mandatory parameters are present in the config file. When using the `models_and_pipes_with_nvtx_range` as a `after_pipeline_creation` callback, the methods of all pipeline components get replaced by a NVTX range wrapper **before** the above-mentioned validation takes place. This can be problematic for components that are implemented as Cython extension types - if the extension type is not compiled with Python bindings for its methods, they will have no signatures at runtime. This resulted in `pydantic` matching the *wrapper's* parameters with the those in the config and raising errors. To avoid this, we now skip applying the wrapper to any (Cython) methods that do not have signatures. --- spacy/ml/callbacks.py | 7 +++++-- spacy/pipeline/pipe.pyx | 2 +- spacy/pipeline/trainable_pipe.pyx | 2 +- 3 files changed, 7 insertions(+), 4 deletions(-) diff --git a/spacy/ml/callbacks.py b/spacy/ml/callbacks.py index 18290b947..3b60ec2ab 100644 --- a/spacy/ml/callbacks.py +++ b/spacy/ml/callbacks.py @@ -89,11 +89,14 @@ def pipes_with_nvtx_range( types.MethodType(nvtx_range_wrapper_for_pipe_method, pipe), func ) - # Try to preserve the original function signature. + # We need to preserve the original function signature so that + # the original parameters are passed to pydantic for validation downstream. try: wrapped_func.__signature__ = inspect.signature(func) # type: ignore except: - pass + # Can fail for Cython methods that do not have bindings. + warnings.warn(Warnings.W122.format(method=name, pipe=pipe.name)) + continue try: setattr( diff --git a/spacy/pipeline/pipe.pyx b/spacy/pipeline/pipe.pyx index 4e3ae1cf0..8407acc45 100644 --- a/spacy/pipeline/pipe.pyx +++ b/spacy/pipeline/pipe.pyx @@ -1,4 +1,4 @@ -# cython: infer_types=True, profile=True +# cython: infer_types=True, profile=True, binding=True from typing import Optional, Tuple, Iterable, Iterator, Callable, Union, Dict import srsly import warnings diff --git a/spacy/pipeline/trainable_pipe.pyx b/spacy/pipeline/trainable_pipe.pyx index 76b0733cf..3f0507d4b 100644 --- a/spacy/pipeline/trainable_pipe.pyx +++ b/spacy/pipeline/trainable_pipe.pyx @@ -1,4 +1,4 @@ -# cython: infer_types=True, profile=True +# cython: infer_types=True, profile=True, binding=True from typing import Iterable, Iterator, Optional, Dict, Tuple, Callable import srsly from thinc.api import set_dropout_rate, Model, Optimizer From 6be6913ba5aaa7aa35deb1a9fcd4418d93824b24 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Tue, 13 Sep 2022 09:04:53 +0200 Subject: [PATCH 20/34] Update cupy extras (#11279) * Update cupy extras: * Extend to v11 * Add `cupy-cuda11x` and `cupy-wheel` * Update quickstart to use `cupy-wheel` for CUDA 10.2+ * Rename cuda-wheel to cuda-autodetect, remove repeated CUDA in menu --- setup.cfg | 36 +++++++++++++---------- website/src/widgets/quickstart-install.js | 12 ++------ 2 files changed, 22 insertions(+), 26 deletions(-) diff --git a/setup.cfg b/setup.cfg index 5fd820a96..2dc5e7042 100644 --- a/setup.cfg +++ b/setup.cfg @@ -76,37 +76,41 @@ transformers = ray = spacy_ray>=0.1.0,<1.0.0 cuda = - cupy>=5.0.0b4,<11.0.0 + cupy>=5.0.0b4,<12.0.0 cuda80 = - cupy-cuda80>=5.0.0b4,<11.0.0 + cupy-cuda80>=5.0.0b4,<12.0.0 cuda90 = - cupy-cuda90>=5.0.0b4,<11.0.0 + cupy-cuda90>=5.0.0b4,<12.0.0 cuda91 = - cupy-cuda91>=5.0.0b4,<11.0.0 + cupy-cuda91>=5.0.0b4,<12.0.0 cuda92 = - cupy-cuda92>=5.0.0b4,<11.0.0 + cupy-cuda92>=5.0.0b4,<12.0.0 cuda100 = - cupy-cuda100>=5.0.0b4,<11.0.0 + cupy-cuda100>=5.0.0b4,<12.0.0 cuda101 = - cupy-cuda101>=5.0.0b4,<11.0.0 + cupy-cuda101>=5.0.0b4,<12.0.0 cuda102 = - cupy-cuda102>=5.0.0b4,<11.0.0 + cupy-cuda102>=5.0.0b4,<12.0.0 cuda110 = - cupy-cuda110>=5.0.0b4,<11.0.0 + cupy-cuda110>=5.0.0b4,<12.0.0 cuda111 = - cupy-cuda111>=5.0.0b4,<11.0.0 + cupy-cuda111>=5.0.0b4,<12.0.0 cuda112 = - cupy-cuda112>=5.0.0b4,<11.0.0 + cupy-cuda112>=5.0.0b4,<12.0.0 cuda113 = - cupy-cuda113>=5.0.0b4,<11.0.0 + cupy-cuda113>=5.0.0b4,<12.0.0 cuda114 = - cupy-cuda114>=5.0.0b4,<11.0.0 + cupy-cuda114>=5.0.0b4,<12.0.0 cuda115 = - cupy-cuda115>=5.0.0b4,<11.0.0 + cupy-cuda115>=5.0.0b4,<12.0.0 cuda116 = - cupy-cuda116>=5.0.0b4,<11.0.0 + cupy-cuda116>=5.0.0b4,<12.0.0 cuda117 = - cupy-cuda117>=5.0.0b4,<11.0.0 + cupy-cuda117>=5.0.0b4,<12.0.0 +cuda11x = + cupy-cuda11x>=11.0.0,<12.0.0 +cuda-autodetect = + cupy-wheel>=11.0.0,<12.0.0 apple = thinc-apple-ops>=0.1.0.dev0,<1.0.0 # Language tokenizers with external dependencies diff --git a/website/src/widgets/quickstart-install.js b/website/src/widgets/quickstart-install.js index 61c0678dd..0d2186acb 100644 --- a/website/src/widgets/quickstart-install.js +++ b/website/src/widgets/quickstart-install.js @@ -9,7 +9,7 @@ const DEFAULT_PLATFORM = 'x86' const DEFAULT_MODELS = ['en'] const DEFAULT_OPT = 'efficiency' const DEFAULT_HARDWARE = 'cpu' -const DEFAULT_CUDA = 'cuda113' +const DEFAULT_CUDA = 'cuda-autodetect' const CUDA = { '8.0': 'cuda80', '9.0': 'cuda90', @@ -17,15 +17,7 @@ const CUDA = { '9.2': 'cuda92', '10.0': 'cuda100', '10.1': 'cuda101', - '10.2': 'cuda102', - '11.0': 'cuda110', - '11.1': 'cuda111', - '11.2': 'cuda112', - '11.3': 'cuda113', - '11.4': 'cuda114', - '11.5': 'cuda115', - '11.6': 'cuda116', - '11.7': 'cuda117', + '10.2, 11.0+': 'cuda-autodetect', } const LANG_EXTRAS = ['ja'] // only for languages with models From 3f0c3ad7d30d493cd017b6bb41b174d991bbcdc1 Mon Sep 17 00:00:00 2001 From: Richard Hudson Date: Wed, 14 Sep 2022 09:36:55 +0200 Subject: [PATCH 21/34] Correct alignment example and documentation (#11491) * Correct example and documentation * Added altered example.md * Changes based on review + apply prettier * Remote unnecessary 'the' Co-authored-by: Madeesh Kannan Co-authored-by: Madeesh Kannan --- website/docs/api/example.md | 16 ++++++++++------ website/docs/usage/linguistic-features.md | 10 +++++----- 2 files changed, 15 insertions(+), 11 deletions(-) diff --git a/website/docs/api/example.md b/website/docs/api/example.md index ca9d3c056..0228e8935 100644 --- a/website/docs/api/example.md +++ b/website/docs/api/example.md @@ -286,10 +286,14 @@ Calculate alignment tables between two tokenizations. ### Alignment attributes {#alignment-attributes"} -| Name | Description | -| ----- | --------------------------------------------------------------------- | -| `x2y` | The `Ragged` object holding the alignment from `x` to `y`. ~~Ragged~~ | -| `y2x` | The `Ragged` object holding the alignment from `y` to `x`. ~~Ragged~~ | +Alignment attributes are managed using `AlignmentArray`, which is a +simplified version of Thinc's [Ragged](https://thinc.ai/docs/api-types#ragged) +type that only supports the `data` and `length` attributes. + +| Name | Description | +| ----- | ------------------------------------------------------------------------------------- | +| `x2y` | The `AlignmentArray` object holding the alignment from `x` to `y`. ~~AlignmentArray~~ | +| `y2x` | The `AlignmentArray` object holding the alignment from `y` to `x`. ~~AlignmentArray~~ | @@ -309,10 +313,10 @@ tokenizations add up to the same string. For example, you'll be able to align > spacy_tokens = ["obama", "'s", "podcast"] > alignment = Alignment.from_strings(bert_tokens, spacy_tokens) > a2b = alignment.x2y -> assert list(a2b.dataXd) == [0, 1, 1, 2] +> assert list(a2b.data) == [0, 1, 1, 2] > ``` > -> If `a2b.dataXd[1] == a2b.dataXd[2] == 1`, that means that `A[1]` (`"'"`) and +> If `a2b.data[1] == a2b.data[2] == 1`, that means that `A[1]` (`"'"`) and > `A[2]` (`"s"`) both align to `B[1]` (`"'s"`). ### Alignment.from_strings {#classmethod tag="function"} diff --git a/website/docs/usage/linguistic-features.md b/website/docs/usage/linguistic-features.md index 82472c67e..099678c40 100644 --- a/website/docs/usage/linguistic-features.md +++ b/website/docs/usage/linguistic-features.md @@ -1422,9 +1422,9 @@ other_tokens = ["i", "listened", "to", "obama", "'", "s", "podcasts", "."] spacy_tokens = ["i", "listened", "to", "obama", "'s", "podcasts", "."] align = Alignment.from_strings(other_tokens, spacy_tokens) print(f"a -> b, lengths: {align.x2y.lengths}") # array([1, 1, 1, 1, 1, 1, 1, 1]) -print(f"a -> b, mapping: {align.x2y.dataXd}") # array([0, 1, 2, 3, 4, 4, 5, 6]) : two tokens both refer to "'s" +print(f"a -> b, mapping: {align.x2y.data}") # array([0, 1, 2, 3, 4, 4, 5, 6]) : two tokens both refer to "'s" print(f"b -> a, lengths: {align.y2x.lengths}") # array([1, 1, 1, 1, 2, 1, 1]) : the token "'s" refers to two tokens -print(f"b -> a, mappings: {align.y2x.dataXd}") # array([0, 1, 2, 3, 4, 5, 6, 7]) +print(f"b -> a, mappings: {align.y2x.data}") # array([0, 1, 2, 3, 4, 5, 6, 7]) ``` Here are some insights from the alignment information generated in the example @@ -1433,10 +1433,10 @@ above: - The one-to-one mappings for the first four tokens are identical, which means they map to each other. This makes sense because they're also identical in the input: `"i"`, `"listened"`, `"to"` and `"obama"`. -- The value of `x2y.dataXd[6]` is `5`, which means that `other_tokens[6]` +- The value of `x2y.data[6]` is `5`, which means that `other_tokens[6]` (`"podcasts"`) aligns to `spacy_tokens[5]` (also `"podcasts"`). -- `x2y.dataXd[4]` and `x2y.dataXd[5]` are both `4`, which means that both tokens - 4 and 5 of `other_tokens` (`"'"` and `"s"`) align to token 4 of `spacy_tokens` +- `x2y.data[4]` and `x2y.data[5]` are both `4`, which means that both tokens 4 + and 5 of `other_tokens` (`"'"` and `"s"`) align to token 4 of `spacy_tokens` (`"'s"`). From 7c98245c0c0f9c6c0c4a523c0bf1a75690e58620 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Wed, 14 Sep 2022 17:05:22 +0200 Subject: [PATCH 22/34] Add levenshtein from polyleven (#11418) Add a simple levenshtein distance function using the implementation from the polyleven library as `spacy.matcher.levenshtein`. --- .gitignore | 1 + licenses/3rd_party_licenses.txt | 31 ++ setup.py | 11 + spacy/matcher/__init__.py | 3 +- spacy/matcher/levenshtein.pyx | 15 + spacy/matcher/polyleven.c | 384 ++++++++++++++++++++++++ spacy/tests/matcher/test_levenshtein.py | 36 +++ 7 files changed, 480 insertions(+), 1 deletion(-) create mode 100644 spacy/matcher/levenshtein.pyx create mode 100644 spacy/matcher/polyleven.c create mode 100644 spacy/tests/matcher/test_levenshtein.py diff --git a/.gitignore b/.gitignore index ac72f2bbf..ac333f958 100644 --- a/.gitignore +++ b/.gitignore @@ -24,6 +24,7 @@ quickstart-training-generator.js cythonize.json spacy/*.html *.cpp +*.c *.so # Vim / VSCode / editors diff --git a/licenses/3rd_party_licenses.txt b/licenses/3rd_party_licenses.txt index d58da9c4a..851e09585 100644 --- a/licenses/3rd_party_licenses.txt +++ b/licenses/3rd_party_licenses.txt @@ -127,3 +127,34 @@ distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. + + +polyleven +--------- + +* Files: spacy/matcher/polyleven.c + +MIT License + +Copyright (c) 2021 Fujimoto Seiji +Copyright (c) 2021 Max Bachmann +Copyright (c) 2022 Nick Mazuk +Copyright (c) 2022 Michael Weiss + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. diff --git a/setup.py b/setup.py index ec1bd35fa..c4138aa93 100755 --- a/setup.py +++ b/setup.py @@ -205,6 +205,17 @@ def setup_package(): get_python_inc(plat_specific=True), ] ext_modules = [] + ext_modules.append( + Extension( + "spacy.matcher.levenshtein", + [ + "spacy/matcher/levenshtein.pyx", + "spacy/matcher/polyleven.c", + ], + language="c", + include_dirs=include_dirs, + ) + ) for name in MOD_NAMES: mod_path = name.replace(".", "/") + ".pyx" ext = Extension( diff --git a/spacy/matcher/__init__.py b/spacy/matcher/__init__.py index 286844787..a4f164847 100644 --- a/spacy/matcher/__init__.py +++ b/spacy/matcher/__init__.py @@ -1,5 +1,6 @@ from .matcher import Matcher from .phrasematcher import PhraseMatcher from .dependencymatcher import DependencyMatcher +from .levenshtein import levenshtein -__all__ = ["Matcher", "PhraseMatcher", "DependencyMatcher"] +__all__ = ["Matcher", "PhraseMatcher", "DependencyMatcher", "levenshtein"] diff --git a/spacy/matcher/levenshtein.pyx b/spacy/matcher/levenshtein.pyx new file mode 100644 index 000000000..8463d913d --- /dev/null +++ b/spacy/matcher/levenshtein.pyx @@ -0,0 +1,15 @@ +# cython: profile=True, binding=True, infer_types=True +from cpython.object cimport PyObject +from libc.stdint cimport int64_t + +from typing import Optional + + +cdef extern from "polyleven.c": + int64_t polyleven(PyObject *o1, PyObject *o2, int64_t k) + + +cpdef int64_t levenshtein(a: str, b: str, k: Optional[int] = None): + if k is None: + k = -1 + return polyleven(a, b, k) diff --git a/spacy/matcher/polyleven.c b/spacy/matcher/polyleven.c new file mode 100644 index 000000000..2f2b8826c --- /dev/null +++ b/spacy/matcher/polyleven.c @@ -0,0 +1,384 @@ +/* + * Adapted from Polyleven (https://ceptord.net/) + * + * Source: https://github.com/fujimotos/polyleven/blob/c3f95a080626c5652f0151a2e449963288ccae84/polyleven.c + * + * Copyright (c) 2021 Fujimoto Seiji + * Copyright (c) 2021 Max Bachmann + * Copyright (c) 2022 Nick Mazuk + * Copyright (c) 2022 Michael Weiss + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +#include +#include + +#define MIN(a,b) ((a) < (b) ? (a) : (b)) +#define MAX(a,b) ((a) > (b) ? (a) : (b)) +#define CDIV(a,b) ((a) / (b) + ((a) % (b) > 0)) +#define BIT(i,n) (((i) >> (n)) & 1) +#define FLIP(i,n) ((i) ^ ((uint64_t) 1 << (n))) +#define ISASCII(kd) ((kd) == PyUnicode_1BYTE_KIND) + +/* + * Bare bone of PyUnicode + */ +struct strbuf { + void *ptr; + int kind; + int64_t len; +}; + +static void strbuf_init(struct strbuf *s, PyObject *o) +{ + s->ptr = PyUnicode_DATA(o); + s->kind = PyUnicode_KIND(o); + s->len = PyUnicode_GET_LENGTH(o); +} + +#define strbuf_read(s, i) PyUnicode_READ((s)->kind, (s)->ptr, (i)) + +/* + * An encoded mbleven model table. + * + * Each 8-bit integer represents an edit sequence, with using two + * bits for a single operation. + * + * 01 = DELETE, 10 = INSERT, 11 = REPLACE + * + * For example, 13 is '1101' in binary notation, so it means + * DELETE + REPLACE. + */ +static const uint8_t MBLEVEN_MATRIX[] = { + 3, 0, 0, 0, 0, 0, 0, 0, + 1, 0, 0, 0, 0, 0, 0, 0, + 15, 9, 6, 0, 0, 0, 0, 0, + 13, 7, 0, 0, 0, 0, 0, 0, + 5, 0, 0, 0, 0, 0, 0, 0, + 63, 39, 45, 57, 54, 30, 27, 0, + 61, 55, 31, 37, 25, 22, 0, 0, + 53, 29, 23, 0, 0, 0, 0, 0, + 21, 0, 0, 0, 0, 0, 0, 0, +}; + +#define MBLEVEN_MATRIX_GET(k, d) ((((k) + (k) * (k)) / 2 - 1) + (d)) * 8 + +static int64_t mbleven_ascii(char *s1, int64_t len1, + char *s2, int64_t len2, int k) +{ + int pos; + uint8_t m; + int64_t i, j, c, r; + + pos = MBLEVEN_MATRIX_GET(k, len1 - len2); + r = k + 1; + + while (MBLEVEN_MATRIX[pos]) { + m = MBLEVEN_MATRIX[pos++]; + i = j = c = 0; + while (i < len1 && j < len2) { + if (s1[i] != s2[j]) { + c++; + if (!m) break; + if (m & 1) i++; + if (m & 2) j++; + m >>= 2; + } else { + i++; + j++; + } + } + c += (len1 - i) + (len2 - j); + r = MIN(r, c); + if (r < 2) { + return r; + } + } + return r; +} + +static int64_t mbleven(PyObject *o1, PyObject *o2, int64_t k) +{ + int pos; + uint8_t m; + int64_t i, j, c, r; + struct strbuf s1, s2; + + strbuf_init(&s1, o1); + strbuf_init(&s2, o2); + + if (s1.len < s2.len) + return mbleven(o2, o1, k); + + if (k > 3) + return -1; + + if (k < s1.len - s2.len) + return k + 1; + + if (ISASCII(s1.kind) && ISASCII(s2.kind)) + return mbleven_ascii(s1.ptr, s1.len, s2.ptr, s2.len, k); + + pos = MBLEVEN_MATRIX_GET(k, s1.len - s2.len); + r = k + 1; + + while (MBLEVEN_MATRIX[pos]) { + m = MBLEVEN_MATRIX[pos++]; + i = j = c = 0; + while (i < s1.len && j < s2.len) { + if (strbuf_read(&s1, i) != strbuf_read(&s2, j)) { + c++; + if (!m) break; + if (m & 1) i++; + if (m & 2) j++; + m >>= 2; + } else { + i++; + j++; + } + } + c += (s1.len - i) + (s2.len - j); + r = MIN(r, c); + if (r < 2) { + return r; + } + } + return r; +} + +/* + * Data structure to store Peq (equality bit-vector). + */ +struct blockmap_entry { + uint32_t key[128]; + uint64_t val[128]; +}; + +struct blockmap { + int64_t nr; + struct blockmap_entry *list; +}; + +#define blockmap_key(c) ((c) | 0x80000000U) +#define blockmap_hash(c) ((c) % 128) + +static int blockmap_init(struct blockmap *map, struct strbuf *s) +{ + int64_t i; + struct blockmap_entry *be; + uint32_t c, k; + uint8_t h; + + map->nr = CDIV(s->len, 64); + map->list = calloc(1, map->nr * sizeof(struct blockmap_entry)); + if (map->list == NULL) { + PyErr_NoMemory(); + return -1; + } + + for (i = 0; i < s->len; i++) { + be = &(map->list[i / 64]); + c = strbuf_read(s, i); + h = blockmap_hash(c); + k = blockmap_key(c); + + while (be->key[h] && be->key[h] != k) + h = blockmap_hash(h + 1); + be->key[h] = k; + be->val[h] |= (uint64_t) 1 << (i % 64); + } + return 0; +} + +static void blockmap_clear(struct blockmap *map) +{ + if (map->list) + free(map->list); + map->list = NULL; + map->nr = 0; +} + +static uint64_t blockmap_get(struct blockmap *map, int block, uint32_t c) +{ + struct blockmap_entry *be; + uint8_t h; + uint32_t k; + + h = blockmap_hash(c); + k = blockmap_key(c); + + be = &(map->list[block]); + while (be->key[h] && be->key[h] != k) + h = blockmap_hash(h + 1); + return be->key[h] == k ? be->val[h] : 0; +} + +/* + * Myers' bit-parallel algorithm + * + * See: G. Myers. "A fast bit-vector algorithm for approximate string + * matching based on dynamic programming." Journal of the ACM, 1999. + */ +static int64_t myers1999_block(struct strbuf *s1, struct strbuf *s2, + struct blockmap *map) +{ + uint64_t Eq, Xv, Xh, Ph, Mh, Pv, Mv, Last; + uint64_t *Mhc, *Phc; + int64_t i, b, hsize, vsize, Score; + uint8_t Pb, Mb; + + hsize = CDIV(s1->len, 64); + vsize = CDIV(s2->len, 64); + Score = s2->len; + + Phc = malloc(hsize * 2 * sizeof(uint64_t)); + if (Phc == NULL) { + PyErr_NoMemory(); + return -1; + } + Mhc = Phc + hsize; + memset(Phc, -1, hsize * sizeof(uint64_t)); + memset(Mhc, 0, hsize * sizeof(uint64_t)); + Last = (uint64_t)1 << ((s2->len - 1) % 64); + + for (b = 0; b < vsize; b++) { + Mv = 0; + Pv = (uint64_t) -1; + Score = s2->len; + + for (i = 0; i < s1->len; i++) { + Eq = blockmap_get(map, b, strbuf_read(s1, i)); + + Pb = BIT(Phc[i / 64], i % 64); + Mb = BIT(Mhc[i / 64], i % 64); + + Xv = Eq | Mv; + Xh = ((((Eq | Mb) & Pv) + Pv) ^ Pv) | Eq | Mb; + + Ph = Mv | ~ (Xh | Pv); + Mh = Pv & Xh; + + if (Ph & Last) Score++; + if (Mh & Last) Score--; + + if ((Ph >> 63) ^ Pb) + Phc[i / 64] = FLIP(Phc[i / 64], i % 64); + + if ((Mh >> 63) ^ Mb) + Mhc[i / 64] = FLIP(Mhc[i / 64], i % 64); + + Ph = (Ph << 1) | Pb; + Mh = (Mh << 1) | Mb; + + Pv = Mh | ~ (Xv | Ph); + Mv = Ph & Xv; + } + } + free(Phc); + return Score; +} + +static int64_t myers1999_simple(uint8_t *s1, int64_t len1, uint8_t *s2, int64_t len2) +{ + uint64_t Peq[256]; + uint64_t Eq, Xv, Xh, Ph, Mh, Pv, Mv, Last; + int64_t i; + int64_t Score = len2; + + memset(Peq, 0, sizeof(Peq)); + + for (i = 0; i < len2; i++) + Peq[s2[i]] |= (uint64_t) 1 << i; + + Mv = 0; + Pv = (uint64_t) -1; + Last = (uint64_t) 1 << (len2 - 1); + + for (i = 0; i < len1; i++) { + Eq = Peq[s1[i]]; + + Xv = Eq | Mv; + Xh = (((Eq & Pv) + Pv) ^ Pv) | Eq; + + Ph = Mv | ~ (Xh | Pv); + Mh = Pv & Xh; + + if (Ph & Last) Score++; + if (Mh & Last) Score--; + + Ph = (Ph << 1) | 1; + Mh = (Mh << 1); + + Pv = Mh | ~ (Xv | Ph); + Mv = Ph & Xv; + } + return Score; +} + +static int64_t myers1999(PyObject *o1, PyObject *o2) +{ + struct strbuf s1, s2; + struct blockmap map; + int64_t ret; + + strbuf_init(&s1, o1); + strbuf_init(&s2, o2); + + if (s1.len < s2.len) + return myers1999(o2, o1); + + if (ISASCII(s1.kind) && ISASCII(s2.kind) && s2.len < 65) + return myers1999_simple(s1.ptr, s1.len, s2.ptr, s2.len); + + if (blockmap_init(&map, &s2)) + return -1; + + ret = myers1999_block(&s1, &s2, &map); + blockmap_clear(&map); + return ret; +} + +/* + * Interface functions + */ +static int64_t polyleven(PyObject *o1, PyObject *o2, int64_t k) +{ + int64_t len1, len2; + + len1 = PyUnicode_GET_LENGTH(o1); + len2 = PyUnicode_GET_LENGTH(o2); + + if (len1 < len2) + return polyleven(o2, o1, k); + + if (k == 0) + return PyUnicode_Compare(o1, o2) ? 1 : 0; + + if (0 < k && k < len1 - len2) + return k + 1; + + if (len2 == 0) + return len1; + + if (0 < k && k < 4) + return mbleven(o1, o2, k); + + return myers1999(o1, o2); +} diff --git a/spacy/tests/matcher/test_levenshtein.py b/spacy/tests/matcher/test_levenshtein.py new file mode 100644 index 000000000..6c7793f63 --- /dev/null +++ b/spacy/tests/matcher/test_levenshtein.py @@ -0,0 +1,36 @@ +import pytest +from spacy.matcher import levenshtein + + +# empty string plus 10 random ASCII, 10 random unicode, and 2 random long tests +# from polyleven +@pytest.mark.parametrize( + "dist,a,b", + [ + (0, "", ""), + (4, "bbcb", "caba"), + (3, "abcb", "cacc"), + (3, "aa", "ccc"), + (1, "cca", "ccac"), + (1, "aba", "aa"), + (4, "bcbb", "abac"), + (3, "acbc", "bba"), + (3, "cbba", "a"), + (2, "bcc", "ba"), + (4, "aaa", "ccbb"), + (3, "うあい", "いいうい"), + (2, "あううい", "うあい"), + (3, "いういい", "うううあ"), + (2, "うい", "あいあ"), + (2, "いあい", "いう"), + (1, "いい", "あいい"), + (3, "あうあ", "いいああ"), + (4, "いあうう", "ううああ"), + (3, "いあいい", "ういああ"), + (3, "いいああ", "ううあう"), + (166,"TCTGGGCACGGATTCGTCAGATTCCATGTCCATATTTGAGGCTCTTGCAGGCAAAATTTGGGCATGTGAACTCCTTATAGTCCCCGTGC","ATATGGATTGGGGGCATTCAAAGATACGGTTTCCCTTTCTTCAGTTTCGCGCGGCGCACGTCCGGGTGCGAGCCAGTTCGTCTTACTCACATTGTCGACTTCACGAATCGCGCATGATGTGCTTAGCCTGTACTTACGAACGAACTTTCGGTCCAAATACATTCTATCAACACCGAGGTATCCGTGCCACACGCCGAAGCTCGACCGTGTTCGTTGAGAGGTGGAAATGGTAAAAGATGAACATAGTC"), + (111,"GGTTCGGCCGAATTCATAGAGCGTGGTAGTCGACGGTATCCCGCCTGGTAGGGGCCCCTTCTACCTAGCGGAAGTTTGTCAGTACTCTATAACACGAGGGCCTCTCACACCCTAGATCGTCCAGCCACTCGAAGATCGCAGCACCCTTACAGAAAGGCATTAATGTTTCTCCTAGCACTTGTGCAATGGTGAAGGAGTGATG","CGTAACACTTCGCGCTACTGGGCTGCAACGTCTTGGGCATACATGCAAGATTATCTAATGCAAGCTTGAGCCCCGCTTGCGGAATTTCCCTAATCGGGGTCCCTTCCTGTTACGATAAGGACGCGTGCACT"), + ], +) +def test_levenshtein(dist, a, b): + assert levenshtein(a, b) == dist From ca1ad67458d96562ab28d03892e926908cb583e1 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Thu, 15 Sep 2022 15:51:19 +0200 Subject: [PATCH 23/34] disable mypy run for Python 3.10 (#11508) --- .github/azure-steps.yml | 1 + 1 file changed, 1 insertion(+) diff --git a/.github/azure-steps.yml b/.github/azure-steps.yml index 18224ba8c..c7722391f 100644 --- a/.github/azure-steps.yml +++ b/.github/azure-steps.yml @@ -27,6 +27,7 @@ steps: - script: python -m mypy spacy displayName: 'Run mypy' + condition: ne(variables['python_version'], '3.10') - task: DeleteFiles@1 inputs: From 0509f908743afc86a185346ca6cb2e4789041732 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Thu, 15 Sep 2022 17:29:42 +0200 Subject: [PATCH 24/34] add dot (#11500) --- spacy/errors.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/errors.py b/spacy/errors.py index 5ee1476c2..f55b378e9 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -707,7 +707,7 @@ class Errors(metaclass=ErrorsWithCodes): "need to modify the pipeline, use the built-in methods like " "`nlp.add_pipe`, `nlp.remove_pipe`, `nlp.disable_pipe` or " "`nlp.enable_pipe` instead.") - E927 = ("Can't write to frozen list Maybe you're trying to modify a computed " + E927 = ("Can't write to frozen list. Maybe you're trying to modify a computed " "property or default function argument?") E928 = ("A KnowledgeBase can only be serialized to/from from a directory, " "but the provided argument {loc} points to a file.") From df0b815c2382f572a127e4a35dba30cf1fa9fe45 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Fri, 16 Sep 2022 09:26:33 +0200 Subject: [PATCH 25/34] more explicit Example constructor example (#11489) * make constructor example for Example more explicit * shorten example and add spaces --- website/docs/api/example.md | 12 +++++++----- 1 file changed, 7 insertions(+), 5 deletions(-) diff --git a/website/docs/api/example.md b/website/docs/api/example.md index 0228e8935..63768d58f 100644 --- a/website/docs/api/example.md +++ b/website/docs/api/example.md @@ -23,11 +23,13 @@ both documents. > ```python > from spacy.tokens import Doc > from spacy.training import Example -> -> words = ["hello", "world", "!"] -> spaces = [True, False, False] -> predicted = Doc(nlp.vocab, words=words, spaces=spaces) -> reference = parse_gold_doc(my_data) +> pred_words = ["Apply", "some", "sunscreen"] +> pred_spaces = [True, True, False] +> gold_words = ["Apply", "some", "sun", "screen"] +> gold_spaces = [True, True, False, False] +> gold_tags = ["VERB", "DET", "NOUN", "NOUN"] +> predicted = Doc(nlp.vocab, words=pred_words, spaces=pred_spaces) +> reference = Doc(nlp.vocab, words=gold_words, spaces=gold_spaces, tags=gold_tags) > example = Example(predicted, reference) > ``` From 279358be63a6f32c49c2c89d4657a5239f238d9e Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 16 Sep 2022 11:50:19 +0200 Subject: [PATCH 26/34] Auto-format code with black (#11513) Co-authored-by: explosion-bot --- spacy/tests/matcher/test_levenshtein.py | 12 ++++++++++-- 1 file changed, 10 insertions(+), 2 deletions(-) diff --git a/spacy/tests/matcher/test_levenshtein.py b/spacy/tests/matcher/test_levenshtein.py index 6c7793f63..d30e36132 100644 --- a/spacy/tests/matcher/test_levenshtein.py +++ b/spacy/tests/matcher/test_levenshtein.py @@ -28,8 +28,16 @@ from spacy.matcher import levenshtein (4, "いあうう", "ううああ"), (3, "いあいい", "ういああ"), (3, "いいああ", "ううあう"), - (166,"TCTGGGCACGGATTCGTCAGATTCCATGTCCATATTTGAGGCTCTTGCAGGCAAAATTTGGGCATGTGAACTCCTTATAGTCCCCGTGC","ATATGGATTGGGGGCATTCAAAGATACGGTTTCCCTTTCTTCAGTTTCGCGCGGCGCACGTCCGGGTGCGAGCCAGTTCGTCTTACTCACATTGTCGACTTCACGAATCGCGCATGATGTGCTTAGCCTGTACTTACGAACGAACTTTCGGTCCAAATACATTCTATCAACACCGAGGTATCCGTGCCACACGCCGAAGCTCGACCGTGTTCGTTGAGAGGTGGAAATGGTAAAAGATGAACATAGTC"), - (111,"GGTTCGGCCGAATTCATAGAGCGTGGTAGTCGACGGTATCCCGCCTGGTAGGGGCCCCTTCTACCTAGCGGAAGTTTGTCAGTACTCTATAACACGAGGGCCTCTCACACCCTAGATCGTCCAGCCACTCGAAGATCGCAGCACCCTTACAGAAAGGCATTAATGTTTCTCCTAGCACTTGTGCAATGGTGAAGGAGTGATG","CGTAACACTTCGCGCTACTGGGCTGCAACGTCTTGGGCATACATGCAAGATTATCTAATGCAAGCTTGAGCCCCGCTTGCGGAATTTCCCTAATCGGGGTCCCTTCCTGTTACGATAAGGACGCGTGCACT"), + ( + 166, + "TCTGGGCACGGATTCGTCAGATTCCATGTCCATATTTGAGGCTCTTGCAGGCAAAATTTGGGCATGTGAACTCCTTATAGTCCCCGTGC", + "ATATGGATTGGGGGCATTCAAAGATACGGTTTCCCTTTCTTCAGTTTCGCGCGGCGCACGTCCGGGTGCGAGCCAGTTCGTCTTACTCACATTGTCGACTTCACGAATCGCGCATGATGTGCTTAGCCTGTACTTACGAACGAACTTTCGGTCCAAATACATTCTATCAACACCGAGGTATCCGTGCCACACGCCGAAGCTCGACCGTGTTCGTTGAGAGGTGGAAATGGTAAAAGATGAACATAGTC", + ), + ( + 111, + "GGTTCGGCCGAATTCATAGAGCGTGGTAGTCGACGGTATCCCGCCTGGTAGGGGCCCCTTCTACCTAGCGGAAGTTTGTCAGTACTCTATAACACGAGGGCCTCTCACACCCTAGATCGTCCAGCCACTCGAAGATCGCAGCACCCTTACAGAAAGGCATTAATGTTTCTCCTAGCACTTGTGCAATGGTGAAGGAGTGATG", + "CGTAACACTTCGCGCTACTGGGCTGCAACGTCTTGGGCATACATGCAAGATTATCTAATGCAAGCTTGAGCCCCGCTTGCGGAATTTCCCTAATCGGGGTCCCTTCCTGTTACGATAAGGACGCGTGCACT", + ), ], ) def test_levenshtein(dist, a, b): From af9b01ef97d934a8601aff46d8341fdaf78b88df Mon Sep 17 00:00:00 2001 From: Raphael Mitsch Date: Fri, 16 Sep 2022 16:54:31 +0200 Subject: [PATCH 27/34] Add dependency check to project step runs (#11226) * Add dependency check to project step running. * Fix dependency mismatch warning. * Remove newline. * Add types-setuptools to setup.cfg. * Move types-setuptools to test requirements. Move warnings into _validate_requirements(). Handle file reading in project_run(). * Remove newline formatting for output of package conflicts. * Show full version conflict message instead of just package name. * Update spacy/cli/project/run.py Co-authored-by: Adriane Boyd * Fix typo. * Re-add rephrasing of message for conflicting packages. Remove requirements path redundancy. * Update spacy/cli/project/run.py Co-authored-by: Adriane Boyd * Update spacy/cli/project/run.py Co-authored-by: Adriane Boyd * Print unified message for requirement conflicts and missing requirements. * Update spacy/cli/project/run.py Co-authored-by: Adriane Boyd * Fix warning message. * Print conflict/missing messages individually. * Print conflict/missing messages individually. * Add check_requirements setting in project.yml to disable requirements check. * Update website/docs/usage/projects.md Co-authored-by: Adriane Boyd * Update website/docs/usage/projects.md Co-authored-by: Adriane Boyd * Update description of project.yml structure in projects.md. * Update website/docs/usage/projects.md Co-authored-by: Sofie Van Landeghem * Prettify projects docs. Co-authored-by: Adriane Boyd Co-authored-by: Sofie Van Landeghem --- requirements.txt | 1 + spacy/cli/project/run.py | 40 +++++++++++++++++++++++++++++++++- website/docs/usage/projects.md | 35 ++++++++++++++++++----------- 3 files changed, 62 insertions(+), 14 deletions(-) diff --git a/requirements.txt b/requirements.txt index 3e8501b2f..e45fde787 100644 --- a/requirements.txt +++ b/requirements.txt @@ -33,6 +33,7 @@ hypothesis>=3.27.0,<7.0.0 mypy>=0.910,<0.970; platform_machine!='aarch64' types-dataclasses>=0.1.3; python_version < "3.7" types-mock>=0.1.1 +types-setuptools>=57.0.0 types-requests types-setuptools>=57.0.0 black>=22.0,<23.0 diff --git a/spacy/cli/project/run.py b/spacy/cli/project/run.py index d42d95465..ebab7471e 100644 --- a/spacy/cli/project/run.py +++ b/spacy/cli/project/run.py @@ -1,5 +1,8 @@ -from typing import Optional, List, Dict, Sequence, Any, Iterable +from typing import Optional, List, Dict, Sequence, Any, Iterable, Tuple +import os.path from pathlib import Path + +import pkg_resources from wasabi import msg from wasabi.util import locale_escape import sys @@ -71,6 +74,12 @@ def project_run( commands = {cmd["name"]: cmd for cmd in config.get("commands", [])} workflows = config.get("workflows", {}) validate_subcommand(list(commands.keys()), list(workflows.keys()), subcommand) + + req_path = project_dir / "requirements.txt" + if config.get("check_requirements", True) and os.path.exists(req_path): + with req_path.open() as requirements_file: + _check_requirements([req.replace("\n", "") for req in requirements_file]) + if subcommand in workflows: msg.info(f"Running workflow '{subcommand}'") for cmd in workflows[subcommand]: @@ -310,3 +319,32 @@ def get_fileinfo(project_dir: Path, paths: List[str]) -> List[Dict[str, Optional md5 = get_checksum(file_path) if file_path.exists() else None data.append({"path": path, "md5": md5}) return data + + +def _check_requirements(requirements: List[str]) -> Tuple[bool, bool]: + """Checks whether requirements are installed and free of version conflicts. + requirements (List[str]): List of requirements. + RETURNS (Tuple[bool, bool]): Whether (1) any packages couldn't be imported, (2) any packages with version conflicts + exist. + """ + + failed_pkgs_msgs: List[str] = [] + conflicting_pkgs_msgs: List[str] = [] + + for req in requirements: + try: + pkg_resources.require(req) + except pkg_resources.DistributionNotFound as dnf: + failed_pkgs_msgs.append(dnf.report()) + except pkg_resources.VersionConflict as vc: + conflicting_pkgs_msgs.append(vc.report()) + + if len(failed_pkgs_msgs) or len(conflicting_pkgs_msgs): + msg.warn( + title="Missing requirements or requirement conflicts detected. Make sure your Python environment is set up " + "correctly and you installed all requirements specified in your project's requirements.txt: " + ) + for pgk_msg in failed_pkgs_msgs + conflicting_pkgs_msgs: + msg.text(pgk_msg) + + return len(failed_pkgs_msgs) > 0, len(conflicting_pkgs_msgs) > 0 diff --git a/website/docs/usage/projects.md b/website/docs/usage/projects.md index 35150035a..4797bbfe3 100644 --- a/website/docs/usage/projects.md +++ b/website/docs/usage/projects.md @@ -148,6 +148,13 @@ skipped. You can also set `--force` to force re-running a command, or `--dry` to perform a "dry run" and see what would happen (without actually running the script). +Since spaCy v3.4.2, `spacy projects run` checks your installed dependencies to +verify that your environment is properly set up and aligns with the project's +`requirements.txt`, if there is one. If missing or conflicting dependencies are +detected, a corresponding warning is displayed. If you'd like to disable the +dependency check, set `check_requirements: false` in your project's +`project.yml`. + ### 4. Run a workflow {#run-workfow} > #### project.yml @@ -226,26 +233,28 @@ pipelines. ```yaml %%GITHUB_PROJECTS/pipelines/tagger_parser_ud/project.yml ``` + > #### Tip: Overriding variables on the CLI > -> If you want to override one or more variables on the CLI and are not already specifying a -> project directory, you need to add `.` as a placeholder: +> If you want to override one or more variables on the CLI and are not already +> specifying a project directory, you need to add `.` as a placeholder: > > ``` > python -m spacy project run test . --vars.foo bar > ``` -| Section | Description | -| --------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | -| `title` | An optional project title used in `--help` message and [auto-generated docs](#custom-docs). | -| `description` | An optional project description used in [auto-generated docs](#custom-docs). | -| `vars` | A dictionary of variables that can be referenced in paths, URLs and scripts and overriden on the CLI, just like [`config.cfg` variables](/usage/training#config-interpolation). For example, `${vars.name}` will use the value of the variable `name`. Variables need to be defined in the section `vars`, but can be a nested dict, so you're able to reference `${vars.model.name}`. | -| `env` | A dictionary of variables, mapped to the names of environment variables that will be read in when running the project. For example, `${env.name}` will use the value of the environment variable defined as `name`. | -| `directories` | An optional list of [directories](#project-files) that should be created in the project for assets, training outputs, metrics etc. spaCy will make sure that these directories always exist. | -| `assets` | A list of assets that can be fetched with the [`project assets`](/api/cli#project-assets) command. `url` defines a URL or local path, `dest` is the destination file relative to the project directory, and an optional `checksum` ensures that an error is raised if the file's checksum doesn't match. Instead of `url`, you can also provide a `git` block with the keys `repo`, `branch` and `path`, to download from a Git repo. | -| `workflows` | A dictionary of workflow names, mapped to a list of command names, to execute in order. Workflows can be run with the [`project run`](/api/cli#project-run) command. | -| `commands` | A list of named commands. A command can define an optional help message (shown in the CLI when the user adds `--help`) and the `script`, a list of commands to run. The `deps` and `outputs` let you define the created file the command depends on and produces, respectively. This lets spaCy determine whether a command needs to be re-run because its dependencies or outputs changed. Commands can be run as part of a workflow, or separately with the [`project run`](/api/cli#project-run) command. | -| `spacy_version` | Optional spaCy version range like `>=3.0.0,<3.1.0` that the project is compatible with. If it's loaded with an incompatible version, an error is raised when the project is loaded. | +| Section | Description | +| --------------------------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | +| `title` | An optional project title used in `--help` message and [auto-generated docs](#custom-docs). | +| `description` | An optional project description used in [auto-generated docs](#custom-docs). | +| `vars` | A dictionary of variables that can be referenced in paths, URLs and scripts and overriden on the CLI, just like [`config.cfg` variables](/usage/training#config-interpolation). For example, `${vars.name}` will use the value of the variable `name`. Variables need to be defined in the section `vars`, but can be a nested dict, so you're able to reference `${vars.model.name}`. | +| `env` | A dictionary of variables, mapped to the names of environment variables that will be read in when running the project. For example, `${env.name}` will use the value of the environment variable defined as `name`. | +| `directories` | An optional list of [directories](#project-files) that should be created in the project for assets, training outputs, metrics etc. spaCy will make sure that these directories always exist. | +| `assets` | A list of assets that can be fetched with the [`project assets`](/api/cli#project-assets) command. `url` defines a URL or local path, `dest` is the destination file relative to the project directory, and an optional `checksum` ensures that an error is raised if the file's checksum doesn't match. Instead of `url`, you can also provide a `git` block with the keys `repo`, `branch` and `path`, to download from a Git repo. | +| `workflows` | A dictionary of workflow names, mapped to a list of command names, to execute in order. Workflows can be run with the [`project run`](/api/cli#project-run) command. | +| `commands` | A list of named commands. A command can define an optional help message (shown in the CLI when the user adds `--help`) and the `script`, a list of commands to run. The `deps` and `outputs` let you define the created file the command depends on and produces, respectively. This lets spaCy determine whether a command needs to be re-run because its dependencies or outputs changed. Commands can be run as part of a workflow, or separately with the [`project run`](/api/cli#project-run) command. | +| `spacy_version` | Optional spaCy version range like `>=3.0.0,<3.1.0` that the project is compatible with. If it's loaded with an incompatible version, an error is raised when the project is loaded. | +| `check_requirements` 3.4.2 | A flag determining whether to verify that the installed dependencies align with the project's `requirements.txt`. Defaults to `true`. | ### Data assets {#data-assets} From f40d2fac29678111ec600eb7def9d58b174f14a2 Mon Sep 17 00:00:00 2001 From: Basile Dura Date: Fri, 23 Sep 2022 13:18:51 +0200 Subject: [PATCH 28/34] fix: remove duplicate v3.2 (#11530) --- website/meta/sidebars.json | 1 - 1 file changed, 1 deletion(-) diff --git a/website/meta/sidebars.json b/website/meta/sidebars.json index 1b743636c..06fce7742 100644 --- a/website/meta/sidebars.json +++ b/website/meta/sidebars.json @@ -12,7 +12,6 @@ { "text": "New in v3.0", "url": "/usage/v3" }, { "text": "New in v3.1", "url": "/usage/v3-1" }, { "text": "New in v3.2", "url": "/usage/v3-2" }, - { "text": "New in v3.2", "url": "/usage/v3-2" }, { "text": "New in v3.3", "url": "/usage/v3-3" }, { "text": "New in v3.4", "url": "/usage/v3-4" } ] From 6f692a06d54d53f702def1a2ca20a649b7a1b644 Mon Sep 17 00:00:00 2001 From: Richard Hudson Date: Mon, 26 Sep 2022 15:58:21 +0200 Subject: [PATCH 29/34] Remove side effects from Doc.__init__() (#11506) * Remove side effects from Doc.__init__() * Changes based on review comment * Readd test * Change interface of Doc.__init__() * Simplify test Co-authored-by: Adriane Boyd * Update doc.md Co-authored-by: Adriane Boyd --- spacy/tests/doc/test_doc_api.py | 15 +++++++++++++++ spacy/tokens/doc.pyi | 2 +- spacy/tokens/doc.pyx | 12 ++++++------ website/docs/api/doc.md | 30 +++++++++++++++--------------- 4 files changed, 37 insertions(+), 22 deletions(-) diff --git a/spacy/tests/doc/test_doc_api.py b/spacy/tests/doc/test_doc_api.py index a64ab2ba8..38003dea9 100644 --- a/spacy/tests/doc/test_doc_api.py +++ b/spacy/tests/doc/test_doc_api.py @@ -82,6 +82,21 @@ def test_issue2396(en_vocab): assert (span.get_lca_matrix() == matrix).all() +@pytest.mark.issue(11499) +def test_init_args_unmodified(en_vocab): + words = ["A", "sentence"] + ents = ["B-TYPE1", ""] + sent_starts = [True, False] + Doc( + vocab=en_vocab, + words=words, + ents=ents, + sent_starts=sent_starts, + ) + assert ents == ["B-TYPE1", ""] + assert sent_starts == [True, False] + + @pytest.mark.parametrize("text", ["-0.23", "+123,456", "±1"]) @pytest.mark.parametrize("lang_cls", [English, MultiLanguage]) @pytest.mark.issue(2782) diff --git a/spacy/tokens/doc.pyi b/spacy/tokens/doc.pyi index a40fa74aa..f0cdaee87 100644 --- a/spacy/tokens/doc.pyi +++ b/spacy/tokens/doc.pyi @@ -72,7 +72,7 @@ class Doc: lemmas: Optional[List[str]] = ..., heads: Optional[List[int]] = ..., deps: Optional[List[str]] = ..., - sent_starts: Optional[List[Union[bool, None]]] = ..., + sent_starts: Optional[List[Union[bool, int, None]]] = ..., ents: Optional[List[str]] = ..., ) -> None: ... @property diff --git a/spacy/tokens/doc.pyx b/spacy/tokens/doc.pyx index 7ba9a3341..d7d2fd8e6 100644 --- a/spacy/tokens/doc.pyx +++ b/spacy/tokens/doc.pyx @@ -217,9 +217,9 @@ cdef class Doc: head in the doc. Defaults to None. deps (Optional[List[str]]): A list of unicode strings, of the same length as words, to assign as token.dep. Defaults to None. - sent_starts (Optional[List[Union[bool, None]]]): A list of values, of - the same length as words, to assign as token.is_sent_start. Will be - overridden by heads if heads is provided. Defaults to None. + sent_starts (Optional[List[Union[bool, int, None]]]): A list of values, + of the same length as words, to assign as token.is_sent_start. Will + be overridden by heads if heads is provided. Defaults to None. ents (Optional[List[str]]): A list of unicode strings, of the same length as words, as IOB tags to assign as token.ent_iob and token.ent_type. Defaults to None. @@ -285,6 +285,7 @@ cdef class Doc: heads = [0] * len(deps) if heads and not deps: raise ValueError(Errors.E1017) + sent_starts = list(sent_starts) if sent_starts is not None else None if sent_starts is not None: for i in range(len(sent_starts)): if sent_starts[i] is True: @@ -300,12 +301,11 @@ cdef class Doc: ent_iobs = None ent_types = None if ents is not None: + ents = [ent if ent != "" else None for ent in ents] iob_strings = Token.iob_strings() # make valid IOB2 out of IOB1 or IOB2 for i, ent in enumerate(ents): - if ent is "": - ents[i] = None - elif ent is not None and not isinstance(ent, str): + if ent is not None and not isinstance(ent, str): raise ValueError(Errors.E177.format(tag=ent)) if i < len(ents) - 1: # OI -> OB diff --git a/website/docs/api/doc.md b/website/docs/api/doc.md index f97f4ad83..f97ed4547 100644 --- a/website/docs/api/doc.md +++ b/website/docs/api/doc.md @@ -31,21 +31,21 @@ Construct a `Doc` object. The most common way to get a `Doc` object is via the > doc = Doc(nlp.vocab, words=words, spaces=spaces) > ``` -| Name | Description | -| ---------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `vocab` | A storage container for lexical types. ~~Vocab~~ | -| `words` | A list of strings or integer hash values to add to the document as words. ~~Optional[List[Union[str,int]]]~~ | -| `spaces` | A list of boolean values indicating whether each word has a subsequent space. Must have the same length as `words`, if specified. Defaults to a sequence of `True`. ~~Optional[List[bool]]~~ | -| _keyword-only_ | | -| `user\_data` | Optional extra data to attach to the Doc. ~~Dict~~ | -| `tags` 3 | A list of strings, of the same length as `words`, to assign as `token.tag` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | -| `pos` 3 | A list of strings, of the same length as `words`, to assign as `token.pos` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | -| `morphs` 3 | A list of strings, of the same length as `words`, to assign as `token.morph` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | -| `lemmas` 3 | A list of strings, of the same length as `words`, to assign as `token.lemma` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | -| `heads` 3 | A list of values, of the same length as `words`, to assign as the head for each word. Head indices are the absolute position of the head in the `Doc`. Defaults to `None`. ~~Optional[List[int]]~~ | -| `deps` 3 | A list of strings, of the same length as `words`, to assign as `token.dep` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | -| `sent_starts` 3 | A list of values, of the same length as `words`, to assign as `token.is_sent_start`. Will be overridden by heads if `heads` is provided. Defaults to `None`. ~~Optional[List[Optional[bool]]]~~ | -| `ents` 3 | A list of strings, of the same length of `words`, to assign the token-based IOB tag. Defaults to `None`. ~~Optional[List[str]]~~ | +| Name | Description | +| ---------------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `vocab` | A storage container for lexical types. ~~Vocab~~ | +| `words` | A list of strings or integer hash values to add to the document as words. ~~Optional[List[Union[str,int]]]~~ | +| `spaces` | A list of boolean values indicating whether each word has a subsequent space. Must have the same length as `words`, if specified. Defaults to a sequence of `True`. ~~Optional[List[bool]]~~ | +| _keyword-only_ | | +| `user\_data` | Optional extra data to attach to the Doc. ~~Dict~~ | +| `tags` 3 | A list of strings, of the same length as `words`, to assign as `token.tag` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | +| `pos` 3 | A list of strings, of the same length as `words`, to assign as `token.pos` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | +| `morphs` 3 | A list of strings, of the same length as `words`, to assign as `token.morph` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | +| `lemmas` 3 | A list of strings, of the same length as `words`, to assign as `token.lemma` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | +| `heads` 3 | A list of values, of the same length as `words`, to assign as the head for each word. Head indices are the absolute position of the head in the `Doc`. Defaults to `None`. ~~Optional[List[int]]~~ | +| `deps` 3 | A list of strings, of the same length as `words`, to assign as `token.dep` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | +| `sent_starts` 3 | A list of values, of the same length as `words`, to assign as `token.is_sent_start`. Will be overridden by heads if `heads` is provided. Defaults to `None`. ~~Optional[List[Union[bool, int, None]]]~~ | +| `ents` 3 | A list of strings, of the same length of `words`, to assign the token-based IOB tag. Defaults to `None`. ~~Optional[List[str]]~~ | ## Doc.\_\_getitem\_\_ {#getitem tag="method"} From 936a5f0506d5a117aeae000481560e1fc0031036 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Tue, 27 Sep 2022 15:25:24 +0900 Subject: [PATCH 30/34] Fix English pipeline names in 3.4 release notes (#11542) --- website/docs/usage/v3-4.md | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/website/docs/usage/v3-4.md b/website/docs/usage/v3-4.md index 7cc4570d5..597fc3cc8 100644 --- a/website/docs/usage/v3-4.md +++ b/website/docs/usage/v3-4.md @@ -65,10 +65,10 @@ The English CNN pipelines have new word vectors: | Package | Model Version | TAG | Parser LAS | NER F | | ----------------------------------------------- | ------------- | ---: | ---------: | ----: | -| [`en_core_news_md`](/models/en#en_core_news_md) | v3.3.0 | 97.3 | 90.1 | 84.6 | -| [`en_core_news_md`](/models/en#en_core_news_lg) | v3.4.0 | 97.2 | 90.3 | 85.5 | -| [`en_core_news_lg`](/models/en#en_core_news_md) | v3.3.0 | 97.4 | 90.1 | 85.3 | -| [`en_core_news_lg`](/models/en#en_core_news_lg) | v3.4.0 | 97.3 | 90.2 | 85.6 | +| [`en_core_web_md`](/models/en#en_core_web_md) | v3.3.0 | 97.3 | 90.1 | 84.6 | +| [`en_core_web_md`](/models/en#en_core_web_lg) | v3.4.0 | 97.2 | 90.3 | 85.5 | +| [`en_core_web_lg`](/models/en#en_core_web_md) | v3.3.0 | 97.4 | 90.1 | 85.3 | +| [`en_core_web_lg`](/models/en#en_core_web_lg) | v3.4.0 | 97.3 | 90.2 | 85.6 | ## Notes about upgrading from v3.3 {#upgrading} From 877671e09a0a72ca20ccbbcd65d7073f588cd320 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Tue, 27 Sep 2022 10:16:51 +0200 Subject: [PATCH 31/34] Preserve missing entity annotation in augmenters (#11540) Preserve both `-` and `O` annotation in augmenters rather than relying on `Example.to_dict`'s default support for one option outside of labeled entity spans. This is intended as a temporary workaround for augmenters for v3.4.x. The behavior of `Example` and related IOB utils could be improved in the general case for v3.5. --- spacy/tests/training/test_augmenters.py | 7 +++++-- spacy/training/augment.py | 14 +++++++++++++- spacy/training/iob_utils.py | 8 ++++++++ 3 files changed, 26 insertions(+), 3 deletions(-) diff --git a/spacy/tests/training/test_augmenters.py b/spacy/tests/training/test_augmenters.py index e3639c5da..35860a199 100644 --- a/spacy/tests/training/test_augmenters.py +++ b/spacy/tests/training/test_augmenters.py @@ -31,7 +31,7 @@ def doc(nlp): words = ["Sarah", "'s", "sister", "flew", "to", "Silicon", "Valley", "via", "London", "."] tags = ["NNP", "POS", "NN", "VBD", "IN", "NNP", "NNP", "IN", "NNP", "."] pos = ["PROPN", "PART", "NOUN", "VERB", "ADP", "PROPN", "PROPN", "ADP", "PROPN", "PUNCT"] - ents = ["B-PERSON", "I-PERSON", "O", "O", "O", "B-LOC", "I-LOC", "O", "B-GPE", "O"] + ents = ["B-PERSON", "I-PERSON", "O", "", "O", "B-LOC", "I-LOC", "O", "B-GPE", "O"] cats = {"TRAVEL": 1.0, "BAKING": 0.0} # fmt: on doc = Doc(nlp.vocab, words=words, tags=tags, pos=pos, ents=ents) @@ -106,6 +106,7 @@ def test_lowercase_augmenter(nlp, doc): assert [(e.start, e.end, e.label) for e in eg.reference.ents] == ents for ref_ent, orig_ent in zip(eg.reference.ents, doc.ents): assert ref_ent.text == orig_ent.text.lower() + assert [t.ent_iob for t in doc] == [t.ent_iob for t in eg.reference] assert [t.pos_ for t in eg.reference] == [t.pos_ for t in doc] # check that augmentation works when lowercasing leads to different @@ -166,7 +167,7 @@ def test_make_whitespace_variant(nlp): lemmas = ["they", "fly", "to", "New", "York", "City", ".", "\n", "then", "they", "drive", "to", "Washington", ",", "D.C."] heads = [1, 1, 1, 4, 5, 2, 1, 10, 10, 10, 10, 10, 11, 12, 12] deps = ["nsubj", "ROOT", "prep", "compound", "compound", "pobj", "punct", "dep", "advmod", "nsubj", "ROOT", "prep", "pobj", "punct", "appos"] - ents = ["O", "O", "O", "B-GPE", "I-GPE", "I-GPE", "O", "O", "O", "O", "O", "O", "B-GPE", "O", "B-GPE"] + ents = ["O", "", "O", "B-GPE", "I-GPE", "I-GPE", "O", "O", "O", "O", "O", "O", "B-GPE", "O", "B-GPE"] # fmt: on doc = Doc( nlp.vocab, @@ -215,6 +216,8 @@ def test_make_whitespace_variant(nlp): assert mod_ex2.reference[j].head.i == j - 1 # entities are well-formed assert len(doc.ents) == len(mod_ex.reference.ents) + # there is one token with missing entity information + assert any(t.ent_iob == 0 for t in mod_ex.reference) for ent in mod_ex.reference.ents: assert not ent[0].is_space assert not ent[-1].is_space diff --git a/spacy/training/augment.py b/spacy/training/augment.py index 55d780ba4..2fe8c24fb 100644 --- a/spacy/training/augment.py +++ b/spacy/training/augment.py @@ -6,7 +6,7 @@ from functools import partial from ..util import registry from .example import Example -from .iob_utils import split_bilu_label +from .iob_utils import split_bilu_label, _doc_to_biluo_tags_with_partial if TYPE_CHECKING: from ..language import Language # noqa: F401 @@ -62,6 +62,9 @@ def combined_augmenter( if orth_variants and random.random() < orth_level: raw_text = example.text orig_dict = example.to_dict() + orig_dict["doc_annotation"]["entities"] = _doc_to_biluo_tags_with_partial( + example.reference + ) variant_text, variant_token_annot = make_orth_variants( nlp, raw_text, @@ -128,6 +131,9 @@ def lower_casing_augmenter( def make_lowercase_variant(nlp: "Language", example: Example): example_dict = example.to_dict() + example_dict["doc_annotation"]["entities"] = _doc_to_biluo_tags_with_partial( + example.reference + ) doc = nlp.make_doc(example.text.lower()) example_dict["token_annotation"]["ORTH"] = [t.lower_ for t in example.reference] return example.from_dict(doc, example_dict) @@ -146,6 +152,9 @@ def orth_variants_augmenter( else: raw_text = example.text orig_dict = example.to_dict() + orig_dict["doc_annotation"]["entities"] = _doc_to_biluo_tags_with_partial( + example.reference + ) variant_text, variant_token_annot = make_orth_variants( nlp, raw_text, @@ -248,6 +257,9 @@ def make_whitespace_variant( RETURNS (Example): Example with one additional space token. """ example_dict = example.to_dict() + example_dict["doc_annotation"]["entities"] = _doc_to_biluo_tags_with_partial( + example.reference + ) doc_dict = example_dict.get("doc_annotation", {}) token_dict = example_dict.get("token_annotation", {}) # returned unmodified if: diff --git a/spacy/training/iob_utils.py b/spacy/training/iob_utils.py index 61f83a1c3..0d4d246b0 100644 --- a/spacy/training/iob_utils.py +++ b/spacy/training/iob_utils.py @@ -60,6 +60,14 @@ def doc_to_biluo_tags(doc: Doc, missing: str = "O"): ) +def _doc_to_biluo_tags_with_partial(doc: Doc) -> List[str]: + ents = doc_to_biluo_tags(doc, missing="-") + for i, token in enumerate(doc): + if token.ent_iob == 2: + ents[i] = "O" + return ents + + def offsets_to_biluo_tags( doc: Doc, entities: Iterable[Tuple[int, int, Union[str, int]]], missing: str = "O" ) -> List[str]: From a44b7d4622108a42ddb95b62b642df6f142a3450 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Tue, 27 Sep 2022 18:11:23 +0900 Subject: [PATCH 32/34] Add experimental coref docs (#11291) * Add experimental coref docs * Docs cleanup * Apply suggestions from code review Co-authored-by: Sofie Van Landeghem * Apply changes from code review * Fix prettier formatting It seems a period after a number made this think it was a list? * Update docs on examples for initialize * Add docs for coref scorers * Remove 3.4 notes from coref There won't be a "new" tag until it's in core. * Add docs for span cleaner * Fix docs * Fix docs to match spacy-experimental These weren't properly updated when the code was moved out of spacy core. * More doc fixes * Formatting * Update architectures * Fix links * Fix another link Co-authored-by: Sofie Van Landeghem Co-authored-by: svlandeg --- website/docs/api/architectures.md | 92 ++++++- website/docs/api/coref.md | 353 ++++++++++++++++++++++++ website/docs/api/pipeline-functions.md | 33 +++ website/docs/api/scorer.md | 59 ++++ website/docs/api/span-resolver.md | 356 +++++++++++++++++++++++++ website/meta/sidebars.json | 2 + 6 files changed, 889 insertions(+), 6 deletions(-) create mode 100644 website/docs/api/coref.md create mode 100644 website/docs/api/span-resolver.md diff --git a/website/docs/api/architectures.md b/website/docs/api/architectures.md index 2537faff6..4c5447f75 100644 --- a/website/docs/api/architectures.md +++ b/website/docs/api/architectures.md @@ -11,6 +11,7 @@ menu: - ['Text Classification', 'textcat'] - ['Span Classification', 'spancat'] - ['Entity Linking', 'entitylinker'] + - ['Coreference', 'coref-architectures'] --- A **model architecture** is a function that wires up a @@ -587,8 +588,8 @@ consists of either two or three subnetworks: run once for each batch. - **lower**: Construct a feature-specific vector for each `(token, feature)` pair. This is also run once for each batch. Constructing the state - representation is then a matter of summing the component features and - applying the non-linearity. + representation is then a matter of summing the component features and applying + the non-linearity. - **upper** (optional): A feed-forward network that predicts scores from the state representation. If not present, the output from the lower model is used as action scores directly. @@ -628,8 +629,8 @@ same signature, but the `use_upper` argument was `True` by default. > ``` Build a tagger model, using a provided token-to-vector component. The tagger -model adds a linear layer with softmax activation to predict scores given -the token vectors. +model adds a linear layer with softmax activation to predict scores given the +token vectors. | Name | Description | | ----------- | ------------------------------------------------------------------------------------------ | @@ -920,5 +921,84 @@ A function that reads an existing `KnowledgeBase` from file. A function that takes as input a [`KnowledgeBase`](/api/kb) and a [`Span`](/api/span) object denoting a named entity, and returns a list of plausible [`Candidate`](/api/kb/#candidate) objects. The default -`CandidateGenerator` uses the text of a mention to find its potential -aliases in the `KnowledgeBase`. Note that this function is case-dependent. +`CandidateGenerator` uses the text of a mention to find its potential aliases in +the `KnowledgeBase`. Note that this function is case-dependent. + +## Coreference {#coref-architectures tag="experimental"} + +A [`CoreferenceResolver`](/api/coref) component identifies tokens that refer to +the same entity. A [`SpanResolver`](/api/span-resolver) component infers spans +from single tokens. Together these components can be used to reproduce +traditional coreference models. You can also omit the `SpanResolver` if working +with only token-level clusters is acceptable. + +### spacy-experimental.Coref.v1 {#Coref tag="experimental"} + +> #### Example Config +> +> ```ini +> +> [model] +> @architectures = "spacy-experimental.Coref.v1" +> distance_embedding_size = 20 +> dropout = 0.3 +> hidden_size = 1024 +> depth = 2 +> antecedent_limit = 50 +> antecedent_batch_size = 512 +> +> [model.tok2vec] +> @architectures = "spacy-transformers.TransformerListener.v1" +> grad_factor = 1.0 +> upstream = "transformer" +> pooling = {"@layers":"reduce_mean.v1"} +> ``` + +The `Coref` model architecture is a Thinc `Model`. + +| Name | Description | +| ------------------------- | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `tok2vec` | The [`tok2vec`](#tok2vec) layer of the model. ~~Model~~ | +| `distance_embedding_size` | A representation of the distance between candidates. ~~int~~ | +| `dropout` | The dropout to use internally. Unlike some Thinc models, this has separate dropout for the internal PyTorch layers. ~~float~~ | +| `hidden_size` | Size of the main internal layers. ~~int~~ | +| `depth` | Depth of the internal network. ~~int~~ | +| `antecedent_limit` | How many candidate antecedents to keep after rough scoring. This has a significant effect on memory usage. Typical values would be 50 to 200, or higher for very long documents. ~~int~~ | +| `antecedent_batch_size` | Internal batch size. ~~int~~ | +| **CREATES** | The model using the architecture. ~~Model[List[Doc], Floats2d]~~ | + +### spacy-experimental.SpanResolver.v1 {#SpanResolver tag="experimental"} + +> #### Example Config +> +> ```ini +> +> [model] +> @architectures = "spacy-experimental.SpanResolver.v1" +> hidden_size = 1024 +> distance_embedding_size = 64 +> conv_channels = 4 +> window_size = 1 +> max_distance = 128 +> prefix = "coref_head_clusters" +> +> [model.tok2vec] +> @architectures = "spacy-transformers.TransformerListener.v1" +> grad_factor = 1.0 +> upstream = "transformer" +> pooling = {"@layers":"reduce_mean.v1"} +> ``` + +The `SpanResolver` model architecture is a Thinc `Model`. Note that +`MentionClusters` is `List[List[Tuple[int, int]]]`. + +| Name | Description | +| ------------------------- | -------------------------------------------------------------------------------------------------------------------- | +| `tok2vec` | The [`tok2vec`](#tok2vec) layer of the model. ~~Model~~ | +| `hidden_size` | Size of the main internal layers. ~~int~~ | +| `distance_embedding_size` | A representation of the distance between two candidates. ~~int~~ | +| `conv_channels` | The number of channels in the internal CNN. ~~int~~ | +| `window_size` | The number of neighboring tokens to consider in the internal CNN. `1` means consider one token on each side. ~~int~~ | +| `max_distance` | The longest possible length of a predicted span. ~~int~~ | +| `prefix` | The prefix that indicates spans to use for input data. ~~string~~ | +| **CREATES** | The model using the architecture. ~~Model[List[Doc], List[MentionClusters]]~~ | diff --git a/website/docs/api/coref.md b/website/docs/api/coref.md new file mode 100644 index 000000000..8f54422d6 --- /dev/null +++ b/website/docs/api/coref.md @@ -0,0 +1,353 @@ +--- +title: CoreferenceResolver +tag: class,experimental +source: spacy-experimental/coref/coref_component.py +teaser: 'Pipeline component for word-level coreference resolution' +api_base_class: /api/pipe +api_string_name: coref +api_trainable: true +--- + +> #### Installation +> +> ```bash +> $ pip install -U spacy-experimental +> ``` + + + +This component is not yet integrated into spaCy core, and is available via the +extension package +[`spacy-experimental`](https://github.com/explosion/spacy-experimental) starting +in version 0.6.0. It exposes the component via +[entry points](/usage/saving-loading/#entry-points), so if you have the package +installed, using `factory = "experimental_coref"` in your +[training config](/usage/training#config) or +`nlp.add_pipe("experimental_coref")` will work out-of-the-box. + + + +A `CoreferenceResolver` component groups tokens into clusters that refer to the +same thing. Clusters are represented as SpanGroups that start with a prefix +(`coref_clusters` by default). + +A `CoreferenceResolver` component can be paired with a +[`SpanResolver`](/api/span-resolver) to expand single tokens to spans. + +## Assigned Attributes {#assigned-attributes} + +Predictions will be saved to `Doc.spans` as a [`SpanGroup`](/api/spangroup). The +span key will be a prefix plus a serial number referring to the coreference +cluster, starting from zero. + +The span key prefix defaults to `"coref_clusters"`, but can be passed as a +parameter. + +| Location | Value | +| ------------------------------------------ | ------------------------------------------------------------------------------------------------------- | +| `Doc.spans[prefix + "_" + cluster_number]` | One coreference cluster, represented as single-token spans. Cluster numbers start from 1. ~~SpanGroup~~ | + +## Config and implementation {#config} + +The default config is defined by the pipeline component factory and describes +how the component should be configured. You can override its settings via the +`config` argument on [`nlp.add_pipe`](/api/language#add_pipe) or in your +[`config.cfg` for training](/usage/training#config). See the +[model architectures](/api/architectures#coref-architectures) documentation for +details on the architectures and their arguments and hyperparameters. + +> #### Example +> +> ```python +> from spacy_experimental.coref.coref_component import DEFAULT_COREF_MODEL +> from spacy_experimental.coref.coref_util import DEFAULT_CLUSTER_PREFIX +> config={ +> "model": DEFAULT_COREF_MODEL, +> "span_cluster_prefix": DEFAULT_CLUSTER_PREFIX, +> }, +> nlp.add_pipe("experimental_coref", config=config) +> ``` + +| Setting | Description | +| --------------------- | ---------------------------------------------------------------------------------------------------------------------------------------- | +| `model` | The [`Model`](https://thinc.ai/docs/api-model) powering the pipeline component. Defaults to [Coref](/api/architectures#Coref). ~~Model~~ | +| `span_cluster_prefix` | The prefix for the keys for clusters saved to `doc.spans`. Defaults to `coref_clusters`. ~~str~~ | + +## CoreferenceResolver.\_\_init\_\_ {#init tag="method"} + +> #### Example +> +> ```python +> # Construction via add_pipe with default model +> coref = nlp.add_pipe("experimental_coref") +> +> # Construction via add_pipe with custom model +> config = {"model": {"@architectures": "my_coref.v1"}} +> coref = nlp.add_pipe("experimental_coref", config=config) +> +> # Construction from class +> from spacy_experimental.coref.coref_component import CoreferenceResolver +> coref = CoreferenceResolver(nlp.vocab, model) +> ``` + +Create a new pipeline instance. In your application, you would normally use a +shortcut for this and instantiate the component using its string name and +[`nlp.add_pipe`](/api/language#add_pipe). + +| Name | Description | +| --------------------- | --------------------------------------------------------------------------------------------------- | +| `vocab` | The shared vocabulary. ~~Vocab~~ | +| `model` | The [`Model`](https://thinc.ai/docs/api-model) powering the pipeline component. ~~Model~~ | +| `name` | String name of the component instance. Used to add entries to the `losses` during training. ~~str~~ | +| _keyword-only_ | | +| `span_cluster_prefix` | The prefix for the key for saving clusters of spans. ~~bool~~ | + +## CoreferenceResolver.\_\_call\_\_ {#call tag="method"} + +Apply the pipe to one document. The document is modified in place and returned. +This usually happens under the hood when the `nlp` object is called on a text +and all pipeline components are applied to the `Doc` in order. Both +[`__call__`](/api/coref#call) and [`pipe`](/api/coref#pipe) delegate to the +[`predict`](/api/coref#predict) and +[`set_annotations`](/api/coref#set_annotations) methods. + +> #### Example +> +> ```python +> doc = nlp("This is a sentence.") +> coref = nlp.add_pipe("experimental_coref") +> # This usually happens under the hood +> processed = coref(doc) +> ``` + +| Name | Description | +| ----------- | -------------------------------- | +| `doc` | The document to process. ~~Doc~~ | +| **RETURNS** | The processed document. ~~Doc~~ | + +## CoreferenceResolver.pipe {#pipe tag="method"} + +Apply the pipe to a stream of documents. This usually happens under the hood +when the `nlp` object is called on a text and all pipeline components are +applied to the `Doc` in order. Both [`__call__`](/api/coref#call) and +[`pipe`](/api/coref#pipe) delegate to the [`predict`](/api/coref#predict) and +[`set_annotations`](/api/coref#set_annotations) methods. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> for doc in coref.pipe(docs, batch_size=50): +> pass +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------- | +| `stream` | A stream of documents. ~~Iterable[Doc]~~ | +| _keyword-only_ | | +| `batch_size` | The number of documents to buffer. Defaults to `128`. ~~int~~ | +| **YIELDS** | The processed documents in order. ~~Doc~~ | + +## CoreferenceResolver.initialize {#initialize tag="method"} + +Initialize the component for training. `get_examples` should be a function that +returns an iterable of [`Example`](/api/example) objects. **At least one example +should be supplied.** The data examples are used to **initialize the model** of +the component and can either be the full training data or a representative +sample. Initialization includes validating the network, +[inferring missing shapes](https://thinc.ai/docs/usage-models#validation) and +setting up the label scheme based on the data. This method is typically called +by [`Language.initialize`](/api/language#initialize). + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> coref.initialize(lambda: examples, nlp=nlp) +> ``` + +| Name | Description | +| -------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `get_examples` | Function that returns gold-standard annotations in the form of [`Example`](/api/example) objects. Must contain at least one `Example`. ~~Callable[[], Iterable[Example]]~~ | +| _keyword-only_ | | +| `nlp` | The current `nlp` object. Defaults to `None`. ~~Optional[Language]~~ | + +## CoreferenceResolver.predict {#predict tag="method"} + +Apply the component's model to a batch of [`Doc`](/api/doc) objects, without +modifying them. Clusters are returned as a list of `MentionClusters`, one for +each input `Doc`. A `MentionClusters` instance is just a list of lists of pairs +of `int`s, where each item corresponds to a cluster, and the `int`s correspond +to token indices. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> clusters = coref.predict([doc1, doc2]) +> ``` + +| Name | Description | +| ----------- | ---------------------------------------------------------------------------- | +| `docs` | The documents to predict. ~~Iterable[Doc]~~ | +| **RETURNS** | The predicted coreference clusters for the `docs`. ~~List[MentionClusters]~~ | + +## CoreferenceResolver.set_annotations {#set_annotations tag="method"} + +Modify a batch of documents, saving coreference clusters in `Doc.spans`. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> clusters = coref.predict([doc1, doc2]) +> coref.set_annotations([doc1, doc2], clusters) +> ``` + +| Name | Description | +| ---------- | ---------------------------------------------------------------------------- | +| `docs` | The documents to modify. ~~Iterable[Doc]~~ | +| `clusters` | The predicted coreference clusters for the `docs`. ~~List[MentionClusters]~~ | + +## CoreferenceResolver.update {#update tag="method"} + +Learn from a batch of [`Example`](/api/example) objects. Delegates to +[`predict`](/api/coref#predict). + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> optimizer = nlp.initialize() +> losses = coref.update(examples, sgd=optimizer) +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------------------------------------ | +| `examples` | A batch of [`Example`](/api/example) objects to learn from. ~~Iterable[Example]~~ | +| _keyword-only_ | | +| `drop` | The dropout rate. ~~float~~ | +| `sgd` | An optimizer. Will be created via [`create_optimizer`](#create_optimizer) if not set. ~~Optional[Optimizer]~~ | +| `losses` | Optional record of the loss during training. Updated using the component name as the key. ~~Optional[Dict[str, float]]~~ | +| **RETURNS** | The updated `losses` dictionary. ~~Dict[str, float]~~ | + +## CoreferenceResolver.create_optimizer {#create_optimizer tag="method"} + +Create an optimizer for the pipeline component. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> optimizer = coref.create_optimizer() +> ``` + +| Name | Description | +| ----------- | ---------------------------- | +| **RETURNS** | The optimizer. ~~Optimizer~~ | + +## CoreferenceResolver.use_params {#use_params tag="method, contextmanager"} + +Modify the pipe's model, to use the given parameter values. At the end of the +context, the original parameters are restored. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> with coref.use_params(optimizer.averages): +> coref.to_disk("/best_model") +> ``` + +| Name | Description | +| -------- | -------------------------------------------------- | +| `params` | The parameter values to use in the model. ~~dict~~ | + +## CoreferenceResolver.to_disk {#to_disk tag="method"} + +Serialize the pipe to disk. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> coref.to_disk("/path/to/coref") +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------------------------------------------------------ | +| `path` | A path to a directory, which will be created if it doesn't exist. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | + +## CoreferenceResolver.from_disk {#from_disk tag="method"} + +Load the pipe from disk. Modifies the object in place and returns it. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> coref.from_disk("/path/to/coref") +> ``` + +| Name | Description | +| -------------- | ----------------------------------------------------------------------------------------------- | +| `path` | A path to a directory. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | +| **RETURNS** | The modified `CoreferenceResolver` object. ~~CoreferenceResolver~~ | + +## CoreferenceResolver.to_bytes {#to_bytes tag="method"} + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> coref_bytes = coref.to_bytes() +> ``` + +Serialize the pipe to a bytestring, including the `KnowledgeBase`. + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------- | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | +| **RETURNS** | The serialized form of the `CoreferenceResolver` object. ~~bytes~~ | + +## CoreferenceResolver.from_bytes {#from_bytes tag="method"} + +Load the pipe from a bytestring. Modifies the object in place and returns it. + +> #### Example +> +> ```python +> coref_bytes = coref.to_bytes() +> coref = nlp.add_pipe("experimental_coref") +> coref.from_bytes(coref_bytes) +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------- | +| `bytes_data` | The data to load from. ~~bytes~~ | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | +| **RETURNS** | The `CoreferenceResolver` object. ~~CoreferenceResolver~~ | + +## Serialization fields {#serialization-fields} + +During serialization, spaCy will export several data fields used to restore +different aspects of the object. If needed, you can exclude them from +serialization by passing in the string names via the `exclude` argument. + +> #### Example +> +> ```python +> data = coref.to_disk("/path", exclude=["vocab"]) +> ``` + +| Name | Description | +| ------- | -------------------------------------------------------------- | +| `vocab` | The shared [`Vocab`](/api/vocab). | +| `cfg` | The config file. You usually don't want to exclude this. | +| `model` | The binary model data. You usually don't want to exclude this. | diff --git a/website/docs/api/pipeline-functions.md b/website/docs/api/pipeline-functions.md index 1b7017ca7..070292782 100644 --- a/website/docs/api/pipeline-functions.md +++ b/website/docs/api/pipeline-functions.md @@ -153,3 +153,36 @@ whole pipeline has run. | `attrs` | A dict of the `Doc` attributes and the values to set them to. Defaults to `{"tensor": None, "_.trf_data": None}` to clean up after `tok2vec` and `transformer` components. ~~dict~~ | | `silent` | If `False`, show warnings if attributes aren't found or can't be set. Defaults to `True`. ~~bool~~ | | **RETURNS** | The modified `Doc` with the modified attributes. ~~Doc~~ | + +## span_cleaner {#span_cleaner tag="function,experimental"} + +Remove `SpanGroup`s from `doc.spans` based on a key prefix. This is used to +clean up after the [`CoreferenceResolver`](/api/coref) when it's paired with a +[`SpanResolver`](/api/span-resolver). + + + +This pipeline function is not yet integrated into spaCy core, and is available +via the extension package +[`spacy-experimental`](https://github.com/explosion/spacy-experimental) starting +in version 0.6.0. It exposes the component via +[entry points](/usage/saving-loading/#entry-points), so if you have the package +installed, using `factory = "span_cleaner"` in your +[training config](/usage/training#config) or `nlp.add_pipe("span_cleaner")` will +work out-of-the-box. + + + +> #### Example +> +> ```python +> config = {"prefix": "coref_head_clusters"} +> nlp.add_pipe("span_cleaner", config=config) +> doc = nlp("text") +> assert "coref_head_clusters_1" not in doc.spans +> ``` + +| Setting | Description | +| ----------- | ------------------------------------------------------------------------------------------------------------------------- | +| `prefix` | A prefix to check `SpanGroup` keys for. Any matching groups will be removed. Defaults to `"coref_head_clusters"`. ~~str~~ | +| **RETURNS** | The modified `Doc` with any matching spans removed. ~~Doc~~ | diff --git a/website/docs/api/scorer.md b/website/docs/api/scorer.md index 8dbe3b276..ca3462aa9 100644 --- a/website/docs/api/scorer.md +++ b/website/docs/api/scorer.md @@ -270,3 +270,62 @@ Compute micro-PRF and per-entity PRF scores. | Name | Description | | ---------- | ------------------------------------------------------------------------------------------------------------------- | | `examples` | The `Example` objects holding both the predictions and the correct gold-standard annotations. ~~Iterable[Example]~~ | + +## score_coref_clusters {#score_coref_clusters tag="experimental"} + +Returns LEA ([Moosavi and Strube, 2016](https://aclanthology.org/P16-1060/)) PRF +scores for coreference clusters. + + + +Note this scoring function is not yet included in spaCy core - for details, see +the [CoreferenceResolver](/api/coref) docs. + + + +> #### Example +> +> ```python +> scores = score_coref_clusters( +> examples, +> span_cluster_prefix="coref_clusters", +> ) +> print(scores["coref_f"]) +> ``` + +| Name | Description | +| --------------------- | ------------------------------------------------------------------------------------------------------------------- | +| `examples` | The `Example` objects holding both the predictions and the correct gold-standard annotations. ~~Iterable[Example]~~ | +| _keyword-only_ | | +| `span_cluster_prefix` | The prefix used for spans representing coreference clusters. ~~str~~ | +| **RETURNS** | A dictionary containing the scores. ~~Dict[str, Optional[float]]~~ | + +## score_span_predictions {#score_span_predictions tag="experimental"} + +Return accuracy for reconstructions of spans from single tokens. Only exactly +correct predictions are counted as correct, there is no partial credit for near +answers. Used by the [SpanResolver](/api/span-resolver). + + + +Note this scoring function is not yet included in spaCy core - for details, see +the [SpanResolver](/api/span-resolver) docs. + + + +> #### Example +> +> ```python +> scores = score_span_predictions( +> examples, +> output_prefix="coref_clusters", +> ) +> print(scores["span_coref_clusters_accuracy"]) +> ``` + +| Name | Description | +| --------------- | ------------------------------------------------------------------------------------------------------------------- | +| `examples` | The `Example` objects holding both the predictions and the correct gold-standard annotations. ~~Iterable[Example]~~ | +| _keyword-only_ | | +| `output_prefix` | The prefix used for spans representing the final predicted spans. ~~str~~ | +| **RETURNS** | A dictionary containing the scores. ~~Dict[str, Optional[float]]~~ | diff --git a/website/docs/api/span-resolver.md b/website/docs/api/span-resolver.md new file mode 100644 index 000000000..3e992cd03 --- /dev/null +++ b/website/docs/api/span-resolver.md @@ -0,0 +1,356 @@ +--- +title: SpanResolver +tag: class,experimental +source: spacy-experimental/coref/span_resolver_component.py +teaser: 'Pipeline component for resolving tokens into spans' +api_base_class: /api/pipe +api_string_name: span_resolver +api_trainable: true +--- + +> #### Installation +> +> ```bash +> $ pip install -U spacy-experimental +> ``` + + + +This component not yet integrated into spaCy core, and is available via the +extension package +[`spacy-experimental`](https://github.com/explosion/spacy-experimental) starting +in version 0.6.0. It exposes the component via +[entry points](/usage/saving-loading/#entry-points), so if you have the package +installed, using `factory = "experimental_span_resolver"` in your +[training config](/usage/training#config) or +`nlp.add_pipe("experimental_span_resolver")` will work out-of-the-box. + + + +A `SpanResolver` component takes in tokens (represented as `Span` objects of +length 1) and resolves them into `Span` objects of arbitrary length. The initial +use case is as a post-processing step on word-level +[coreference resolution](/api/coref). The input and output keys used to store +`Span` objects are configurable. + +## Assigned Attributes {#assigned-attributes} + +Predictions will be saved to `Doc.spans` as [`SpanGroup`s](/api/spangroup). + +Input token spans will be read in using an input prefix, by default +`"coref_head_clusters"`, and output spans will be saved using an output prefix +(default `"coref_clusters"`) plus a serial number starting from one. The +prefixes are configurable. + +| Location | Value | +| ------------------------------------------------- | ------------------------------------------------------------------------- | +| `Doc.spans[output_prefix + "_" + cluster_number]` | One group of predicted spans. Cluster number starts from 1. ~~SpanGroup~~ | + +## Config and implementation {#config} + +The default config is defined by the pipeline component factory and describes +how the component should be configured. You can override its settings via the +`config` argument on [`nlp.add_pipe`](/api/language#add_pipe) or in your +[`config.cfg` for training](/usage/training#config). See the +[model architectures](/api/architectures#coref-architectures) documentation for +details on the architectures and their arguments and hyperparameters. + +> #### Example +> +> ```python +> from spacy_experimental.coref.span_resolver_component import DEFAULT_SPAN_RESOLVER_MODEL +> from spacy_experimental.coref.coref_util import DEFAULT_CLUSTER_PREFIX, DEFAULT_CLUSTER_HEAD_PREFIX +> config={ +> "model": DEFAULT_SPAN_RESOLVER_MODEL, +> "input_prefix": DEFAULT_CLUSTER_HEAD_PREFIX, +> "output_prefix": DEFAULT_CLUSTER_PREFIX, +> }, +> nlp.add_pipe("experimental_span_resolver", config=config) +> ``` + +| Setting | Description | +| --------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------ | +| `model` | The [`Model`](https://thinc.ai/docs/api-model) powering the pipeline component. Defaults to [SpanResolver](/api/architectures#SpanResolver). ~~Model~~ | +| `input_prefix` | The prefix to use for input `SpanGroup`s. Defaults to `coref_head_clusters`. ~~str~~ | +| `output_prefix` | The prefix for predicted `SpanGroup`s. Defaults to `coref_clusters`. ~~str~~ | + +## SpanResolver.\_\_init\_\_ {#init tag="method"} + +> #### Example +> +> ```python +> # Construction via add_pipe with default model +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> +> # Construction via add_pipe with custom model +> config = {"model": {"@architectures": "my_span_resolver.v1"}} +> span_resolver = nlp.add_pipe("experimental_span_resolver", config=config) +> +> # Construction from class +> from spacy_experimental.coref.span_resolver_component import SpanResolver +> span_resolver = SpanResolver(nlp.vocab, model) +> ``` + +Create a new pipeline instance. In your application, you would normally use a +shortcut for this and instantiate the component using its string name and +[`nlp.add_pipe`](/api/language#add_pipe). + +| Name | Description | +| --------------- | --------------------------------------------------------------------------------------------------- | +| `vocab` | The shared vocabulary. ~~Vocab~~ | +| `model` | The [`Model`](https://thinc.ai/docs/api-model) powering the pipeline component. ~~Model~~ | +| `name` | String name of the component instance. Used to add entries to the `losses` during training. ~~str~~ | +| _keyword-only_ | | +| `input_prefix` | The prefix to use for input `SpanGroup`s. Defaults to `coref_head_clusters`. ~~str~~ | +| `output_prefix` | The prefix for predicted `SpanGroup`s. Defaults to `coref_clusters`. ~~str~~ | + +## SpanResolver.\_\_call\_\_ {#call tag="method"} + +Apply the pipe to one document. The document is modified in place and returned. +This usually happens under the hood when the `nlp` object is called on a text +and all pipeline components are applied to the `Doc` in order. Both +[`__call__`](#call) and [`pipe`](#pipe) delegate to the [`predict`](#predict) +and [`set_annotations`](#set_annotations) methods. + +> #### Example +> +> ```python +> doc = nlp("This is a sentence.") +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> # This usually happens under the hood +> processed = span_resolver(doc) +> ``` + +| Name | Description | +| ----------- | -------------------------------- | +| `doc` | The document to process. ~~Doc~~ | +| **RETURNS** | The processed document. ~~Doc~~ | + +## SpanResolver.pipe {#pipe tag="method"} + +Apply the pipe to a stream of documents. This usually happens under the hood +when the `nlp` object is called on a text and all pipeline components are +applied to the `Doc` in order. Both [`__call__`](/api/span-resolver#call) and +[`pipe`](/api/span-resolver#pipe) delegate to the +[`predict`](/api/span-resolver#predict) and +[`set_annotations`](/api/span-resolver#set_annotations) methods. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> for doc in span_resolver.pipe(docs, batch_size=50): +> pass +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------- | +| `stream` | A stream of documents. ~~Iterable[Doc]~~ | +| _keyword-only_ | | +| `batch_size` | The number of documents to buffer. Defaults to `128`. ~~int~~ | +| **YIELDS** | The processed documents in order. ~~Doc~~ | + +## SpanResolver.initialize {#initialize tag="method"} + +Initialize the component for training. `get_examples` should be a function that +returns an iterable of [`Example`](/api/example) objects. **At least one example +should be supplied.** The data examples are used to **initialize the model** of +the component and can either be the full training data or a representative +sample. Initialization includes validating the network, +[inferring missing shapes](https://thinc.ai/docs/usage-models#validation) and +setting up the label scheme based on the data. This method is typically called +by [`Language.initialize`](/api/language#initialize). + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> span_resolver.initialize(lambda: examples, nlp=nlp) +> ``` + +| Name | Description | +| -------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `get_examples` | Function that returns gold-standard annotations in the form of [`Example`](/api/example) objects. Must contain at least one `Example`. ~~Callable[[], Iterable[Example]]~~ | +| _keyword-only_ | | +| `nlp` | The current `nlp` object. Defaults to `None`. ~~Optional[Language]~~ | + +## SpanResolver.predict {#predict tag="method"} + +Apply the component's model to a batch of [`Doc`](/api/doc) objects, without +modifying them. Predictions are returned as a list of `MentionClusters`, one for +each input `Doc`. A `MentionClusters` instance is just a list of lists of pairs +of `int`s, where each item corresponds to an input `SpanGroup`, and the `int`s +correspond to token indices. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> spans = span_resolver.predict([doc1, doc2]) +> ``` + +| Name | Description | +| ----------- | ------------------------------------------------------------- | +| `docs` | The documents to predict. ~~Iterable[Doc]~~ | +| **RETURNS** | The predicted spans for the `Doc`s. ~~List[MentionClusters]~~ | + +## SpanResolver.set_annotations {#set_annotations tag="method"} + +Modify a batch of documents, saving predictions using the output prefix in +`Doc.spans`. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> spans = span_resolver.predict([doc1, doc2]) +> span_resolver.set_annotations([doc1, doc2], spans) +> ``` + +| Name | Description | +| ------- | ------------------------------------------------------------- | +| `docs` | The documents to modify. ~~Iterable[Doc]~~ | +| `spans` | The predicted spans for the `docs`. ~~List[MentionClusters]~~ | + +## SpanResolver.update {#update tag="method"} + +Learn from a batch of [`Example`](/api/example) objects. Delegates to +[`predict`](/api/span-resolver#predict). + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> optimizer = nlp.initialize() +> losses = span_resolver.update(examples, sgd=optimizer) +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------------------------------------ | +| `examples` | A batch of [`Example`](/api/example) objects to learn from. ~~Iterable[Example]~~ | +| _keyword-only_ | | +| `drop` | The dropout rate. ~~float~~ | +| `sgd` | An optimizer. Will be created via [`create_optimizer`](#create_optimizer) if not set. ~~Optional[Optimizer]~~ | +| `losses` | Optional record of the loss during training. Updated using the component name as the key. ~~Optional[Dict[str, float]]~~ | +| **RETURNS** | The updated `losses` dictionary. ~~Dict[str, float]~~ | + +## SpanResolver.create_optimizer {#create_optimizer tag="method"} + +Create an optimizer for the pipeline component. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> optimizer = span_resolver.create_optimizer() +> ``` + +| Name | Description | +| ----------- | ---------------------------- | +| **RETURNS** | The optimizer. ~~Optimizer~~ | + +## SpanResolver.use_params {#use_params tag="method, contextmanager"} + +Modify the pipe's model, to use the given parameter values. At the end of the +context, the original parameters are restored. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> with span_resolver.use_params(optimizer.averages): +> span_resolver.to_disk("/best_model") +> ``` + +| Name | Description | +| -------- | -------------------------------------------------- | +| `params` | The parameter values to use in the model. ~~dict~~ | + +## SpanResolver.to_disk {#to_disk tag="method"} + +Serialize the pipe to disk. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> span_resolver.to_disk("/path/to/span_resolver") +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------------------------------------------------------ | +| `path` | A path to a directory, which will be created if it doesn't exist. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | + +## SpanResolver.from_disk {#from_disk tag="method"} + +Load the pipe from disk. Modifies the object in place and returns it. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> span_resolver.from_disk("/path/to/span_resolver") +> ``` + +| Name | Description | +| -------------- | ----------------------------------------------------------------------------------------------- | +| `path` | A path to a directory. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | +| **RETURNS** | The modified `SpanResolver` object. ~~SpanResolver~~ | + +## SpanResolver.to_bytes {#to_bytes tag="method"} + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> span_resolver_bytes = span_resolver.to_bytes() +> ``` + +Serialize the pipe to a bytestring. + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------- | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | +| **RETURNS** | The serialized form of the `SpanResolver` object. ~~bytes~~ | + +## SpanResolver.from_bytes {#from_bytes tag="method"} + +Load the pipe from a bytestring. Modifies the object in place and returns it. + +> #### Example +> +> ```python +> span_resolver_bytes = span_resolver.to_bytes() +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> span_resolver.from_bytes(span_resolver_bytes) +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------- | +| `bytes_data` | The data to load from. ~~bytes~~ | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | +| **RETURNS** | The `SpanResolver` object. ~~SpanResolver~~ | + +## Serialization fields {#serialization-fields} + +During serialization, spaCy will export several data fields used to restore +different aspects of the object. If needed, you can exclude them from +serialization by passing in the string names via the `exclude` argument. + +> #### Example +> +> ```python +> data = span_resolver.to_disk("/path", exclude=["vocab"]) +> ``` + +| Name | Description | +| ------- | -------------------------------------------------------------- | +| `vocab` | The shared [`Vocab`](/api/vocab). | +| `cfg` | The config file. You usually don't want to exclude this. | +| `model` | The binary model data. You usually don't want to exclude this. | diff --git a/website/meta/sidebars.json b/website/meta/sidebars.json index 06fce7742..2d8745d77 100644 --- a/website/meta/sidebars.json +++ b/website/meta/sidebars.json @@ -94,6 +94,7 @@ "label": "Pipeline", "items": [ { "text": "AttributeRuler", "url": "/api/attributeruler" }, + { "text": "CoreferenceResolver", "url": "/api/coref" }, { "text": "DependencyParser", "url": "/api/dependencyparser" }, { "text": "EditTreeLemmatizer", "url": "/api/edittreelemmatizer" }, { "text": "EntityLinker", "url": "/api/entitylinker" }, @@ -104,6 +105,7 @@ { "text": "SentenceRecognizer", "url": "/api/sentencerecognizer" }, { "text": "Sentencizer", "url": "/api/sentencizer" }, { "text": "SpanCategorizer", "url": "/api/spancategorizer" }, + { "text": "SpanResolver", "url": "/api/span-resolver" }, { "text": "SpanRuler", "url": "/api/spanruler" }, { "text": "Tagger", "url": "/api/tagger" }, { "text": "TextCategorizer", "url": "/api/textcategorizer" }, From 9557b0fb01612f5b32823dfc52cae71af37f0bd8 Mon Sep 17 00:00:00 2001 From: Taniguchi Yasufumi Date: Tue, 27 Sep 2022 21:11:50 +0900 Subject: [PATCH 33/34] Add spacy-partial-tagger to spaCy Universe (#11538) --- website/meta/universe.json | 14 ++++++++++++++ 1 file changed, 14 insertions(+) diff --git a/website/meta/universe.json b/website/meta/universe.json index 9145855c6..9ec0d6c0e 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -3984,7 +3984,21 @@ }, "category": ["pipeline"], "tags": ["interpretation", "ja"] + }, + { + "id": "spacy-partial-tagger", + "title": "spaCy - Partial Tagger", + "slogan": "Sequence Tagger for Partially Annotated Dataset in spaCy", + "description": "This is a library to build a CRF tagger with a partially annotated dataset in spaCy. You can build your own tagger only from dictionary.", + "github": "doccano/spacy-partial-tagger", + "pip": "spacy-partial-tagger", + "category": ["pipeline", "training"], + "author": "Yasufumi Taniguchi", + "author_links": { + "github": "yasufumy" + } } + ], "categories": [ From aea16719be04d4d6ab889cd20fe0e323b2c7ffee Mon Sep 17 00:00:00 2001 From: Raphael Mitsch Date: Tue, 27 Sep 2022 14:22:36 +0200 Subject: [PATCH 34/34] Simplify and clarify enable/disable behavior of spacy.load() (#11459) * Change enable/disable behavior so that arguments take precedence over config options. Extend error message on conflict. Add warning message in case of overwriting config option with arguments. * Fix tests in test_serialize_pipeline.py to reflect changes to handling of enable/disable. * Fix type issue. * Move comment. * Move comment. * Issue UserWarning instead of printing wasabi message. Adjust test. * Added pytest.warns(UserWarning) for expected warning to fix tests. * Update warning message. * Move type handling out of fetch_pipes_status(). * Add global variable for default value. Use id() to determine whether used values are default value. * Fix default value for disable. * Rename DEFAULT_PIPE_STATUS to _DEFAULT_EMPTY_PIPES. --- spacy/__init__.py | 6 +- spacy/errors.py | 7 ++- spacy/language.py | 59 ++++++++++++------- spacy/tests/pipeline/test_pipe_methods.py | 33 +++++++++-- .../serialize/test_serialize_pipeline.py | 7 ++- spacy/util.py | 23 ++++---- 6 files changed, 92 insertions(+), 43 deletions(-) diff --git a/spacy/__init__.py b/spacy/__init__.py index d60f46b96..c3568bc5c 100644 --- a/spacy/__init__.py +++ b/spacy/__init__.py @@ -31,9 +31,9 @@ def load( name: Union[str, Path], *, vocab: Union[Vocab, bool] = True, - disable: Union[str, Iterable[str]] = util.SimpleFrozenList(), - enable: Union[str, Iterable[str]] = util.SimpleFrozenList(), - exclude: Union[str, Iterable[str]] = util.SimpleFrozenList(), + disable: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES, + enable: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES, + exclude: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES, config: Union[Dict[str, Any], Config] = util.SimpleFrozenDict(), ) -> Language: """Load a spaCy model from an installed package or a local path. diff --git a/spacy/errors.py b/spacy/errors.py index f55b378e9..c035f684d 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -212,6 +212,8 @@ class Warnings(metaclass=ErrorsWithCodes): W121 = ("Attempting to trace non-existent method '{method}' in pipe '{pipe}'") W122 = ("Couldn't trace method '{method}' in pipe '{pipe}'. This can happen if the pipe class " "is a Cython extension type.") + W123 = ("Argument {arg} with value {arg_value} is used instead of {config_value} as specified in the config. Be " + "aware that this might affect other components in your pipeline.") class Errors(metaclass=ErrorsWithCodes): @@ -937,8 +939,9 @@ class Errors(metaclass=ErrorsWithCodes): E1040 = ("Doc.from_json requires all tokens to have the same attributes. " "Some tokens do not contain annotation for: {partial_attrs}") E1041 = ("Expected a string, Doc, or bytes as input, but got: {type}") - E1042 = ("Function was called with `{arg1}`={arg1_values} and " - "`{arg2}`={arg2_values} but these arguments are conflicting.") + E1042 = ("`enable={enable}` and `disable={disable}` are inconsistent with each other.\nIf you only passed " + "one of `enable` or `disable`, the other argument is specified in your pipeline's configuration.\nIn that " + "case pass an empty list for the previously not specified argument to avoid this error.") E1043 = ("Expected None or a value in range [{range_start}, {range_end}] for entity linker threshold, but got " "{value}.") diff --git a/spacy/language.py b/spacy/language.py index 34a06e576..d391f15ab 100644 --- a/spacy/language.py +++ b/spacy/language.py @@ -1,4 +1,4 @@ -from typing import Iterator, Optional, Any, Dict, Callable, Iterable, Collection +from typing import Iterator, Optional, Any, Dict, Callable, Iterable from typing import Union, Tuple, List, Set, Pattern, Sequence from typing import NoReturn, TYPE_CHECKING, TypeVar, cast, overload @@ -10,6 +10,7 @@ from contextlib import contextmanager from copy import deepcopy from pathlib import Path import warnings + from thinc.api import get_current_ops, Config, CupyOps, Optimizer import srsly import multiprocessing as mp @@ -24,7 +25,7 @@ from .pipe_analysis import validate_attrs, analyze_pipes, print_pipe_analysis from .training import Example, validate_examples from .training.initialize import init_vocab, init_tok2vec from .scorer import Scorer -from .util import registry, SimpleFrozenList, _pipe, raise_error +from .util import registry, SimpleFrozenList, _pipe, raise_error, _DEFAULT_EMPTY_PIPES from .util import SimpleFrozenDict, combine_score_weights, CONFIG_SECTION_ORDER from .util import warn_if_jupyter_cupy from .lang.tokenizer_exceptions import URL_MATCH, BASE_EXCEPTIONS @@ -1698,9 +1699,9 @@ class Language: config: Union[Dict[str, Any], Config] = {}, *, vocab: Union[Vocab, bool] = True, - disable: Union[str, Iterable[str]] = SimpleFrozenList(), - enable: Union[str, Iterable[str]] = SimpleFrozenList(), - exclude: Union[str, Iterable[str]] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, meta: Dict[str, Any] = SimpleFrozenDict(), auto_fill: bool = True, validate: bool = True, @@ -1727,12 +1728,6 @@ class Language: DOCS: https://spacy.io/api/language#from_config """ - if isinstance(disable, str): - disable = [disable] - if isinstance(enable, str): - enable = [enable] - if isinstance(exclude, str): - exclude = [exclude] if auto_fill: config = Config( cls.default_config, section_order=CONFIG_SECTION_ORDER @@ -1877,9 +1872,38 @@ class Language: nlp.vocab.from_bytes(vocab_b) # Resolve disabled/enabled settings. + if isinstance(disable, str): + disable = [disable] + if isinstance(enable, str): + enable = [enable] + if isinstance(exclude, str): + exclude = [exclude] + + def fetch_pipes_status(value: Iterable[str], key: str) -> Iterable[str]: + """Fetch value for `enable` or `disable` w.r.t. the specified config and passed arguments passed to + .load(). If both arguments and config specified values for this field, the passed arguments take precedence + and a warning is printed. + value (Iterable[str]): Passed value for `enable` or `disable`. + key (str): Key for field in config (either "enabled" or "disabled"). + RETURN (Iterable[str]): + """ + # We assume that no argument was passed if the value is the specified default value. + if id(value) == id(_DEFAULT_EMPTY_PIPES): + return config["nlp"].get(key, []) + else: + if len(config["nlp"].get(key, [])): + warnings.warn( + Warnings.W123.format( + arg=key[:-1], + arg_value=value, + config_value=config["nlp"][key], + ) + ) + return value + disabled_pipes = cls._resolve_component_status( - [*config["nlp"]["disabled"], *disable], - [*config["nlp"].get("enabled", []), *enable], + fetch_pipes_status(disable, "disabled"), + fetch_pipes_status(enable, "enabled"), config["nlp"]["pipeline"], ) nlp._disabled = set(p for p in disabled_pipes if p not in exclude) @@ -2064,14 +2088,7 @@ class Language: pipe_name for pipe_name in pipe_names if pipe_name not in enable ] if disable and disable != to_disable: - raise ValueError( - Errors.E1042.format( - arg1="enable", - arg2="disable", - arg1_values=enable, - arg2_values=disable, - ) - ) + raise ValueError(Errors.E1042.format(enable=enable, disable=disable)) return tuple(to_disable) diff --git a/spacy/tests/pipeline/test_pipe_methods.py b/spacy/tests/pipeline/test_pipe_methods.py index b946061f6..14a7a36e5 100644 --- a/spacy/tests/pipeline/test_pipe_methods.py +++ b/spacy/tests/pipeline/test_pipe_methods.py @@ -605,10 +605,35 @@ def test_update_with_annotates(): assert results[component] == "" -def test_load_disable_enable() -> None: - """ - Tests spacy.load() with dis-/enabling components. - """ +@pytest.mark.issue(11443) +def test_enable_disable_conflict_with_config(): + """Test conflict between enable/disable w.r.t. `nlp.disabled` set in the config.""" + nlp = English() + nlp.add_pipe("tagger") + nlp.add_pipe("senter") + nlp.add_pipe("sentencizer") + + with make_tempdir() as tmp_dir: + nlp.to_disk(tmp_dir) + # Expected to fail, as config and arguments conflict. + with pytest.raises(ValueError): + spacy.load( + tmp_dir, enable=["tagger"], config={"nlp": {"disabled": ["senter"]}} + ) + # Expected to succeed without warning due to the lack of a conflicting config option. + spacy.load(tmp_dir, enable=["tagger"]) + # Expected to succeed with a warning, as disable=[] should override the config setting. + with pytest.warns(UserWarning): + spacy.load( + tmp_dir, + enable=["tagger"], + disable=[], + config={"nlp": {"disabled": ["senter"]}}, + ) + + +def test_load_disable_enable(): + """Tests spacy.load() with dis-/enabling components.""" base_nlp = English() for pipe in ("sentencizer", "tagger", "parser"): diff --git a/spacy/tests/serialize/test_serialize_pipeline.py b/spacy/tests/serialize/test_serialize_pipeline.py index 9fcf18e2d..b948bb76c 100644 --- a/spacy/tests/serialize/test_serialize_pipeline.py +++ b/spacy/tests/serialize/test_serialize_pipeline.py @@ -404,10 +404,11 @@ def test_serialize_pipeline_disable_enable(): assert nlp3.component_names == ["ner", "tagger"] with make_tempdir() as d: nlp3.to_disk(d) - nlp4 = spacy.load(d, disable=["ner"]) - assert nlp4.pipe_names == [] + with pytest.warns(UserWarning): + nlp4 = spacy.load(d, disable=["ner"]) + assert nlp4.pipe_names == ["tagger"] assert nlp4.component_names == ["ner", "tagger"] - assert nlp4.disabled == ["ner", "tagger"] + assert nlp4.disabled == ["ner"] with make_tempdir() as d: nlp.to_disk(d) nlp5 = spacy.load(d, exclude=["tagger"]) diff --git a/spacy/util.py b/spacy/util.py index 4e1a62d05..3034808ba 100644 --- a/spacy/util.py +++ b/spacy/util.py @@ -67,7 +67,6 @@ LEXEME_NORM_LANGS = ["cs", "da", "de", "el", "en", "id", "lb", "mk", "pt", "ru", CONFIG_SECTION_ORDER = ["paths", "variables", "system", "nlp", "components", "corpora", "training", "pretraining", "initialize"] # fmt: on - logger = logging.getLogger("spacy") logger_stream_handler = logging.StreamHandler() logger_stream_handler.setFormatter( @@ -394,13 +393,17 @@ def get_module_path(module: ModuleType) -> Path: return file_path.parent +# Default value for passed enable/disable values. +_DEFAULT_EMPTY_PIPES = SimpleFrozenList() + + def load_model( name: Union[str, Path], *, vocab: Union["Vocab", bool] = True, - disable: Union[str, Iterable[str]] = SimpleFrozenList(), - enable: Union[str, Iterable[str]] = SimpleFrozenList(), - exclude: Union[str, Iterable[str]] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, config: Union[Dict[str, Any], Config] = SimpleFrozenDict(), ) -> "Language": """Load a model from a package or data path. @@ -470,9 +473,9 @@ def load_model_from_path( *, meta: Optional[Dict[str, Any]] = None, vocab: Union["Vocab", bool] = True, - disable: Union[str, Iterable[str]] = SimpleFrozenList(), - enable: Union[str, Iterable[str]] = SimpleFrozenList(), - exclude: Union[str, Iterable[str]] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, config: Union[Dict[str, Any], Config] = SimpleFrozenDict(), ) -> "Language": """Load a model from a data directory path. Creates Language class with @@ -516,9 +519,9 @@ def load_model_from_config( *, meta: Dict[str, Any] = SimpleFrozenDict(), vocab: Union["Vocab", bool] = True, - disable: Union[str, Iterable[str]] = SimpleFrozenList(), - enable: Union[str, Iterable[str]] = SimpleFrozenList(), - exclude: Union[str, Iterable[str]] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, auto_fill: bool = False, validate: bool = True, ) -> "Language":