From 515d5c65d5f5d05eb8d2777e59cb5680dfcb4bd9 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Wed, 7 Sep 2022 22:24:22 +0900 Subject: [PATCH 001/161] Add dev docs on satellite packages (#11435) * Add dev docs on satellite packages * Apply suggestions from code review Co-authored-by: Sofie Van Landeghem * Add displacy link Co-authored-by: Sofie Van Landeghem --- extra/DEVELOPER_DOCS/Satellite Packages.md | 82 ++++++++++++++++++++++ 1 file changed, 82 insertions(+) create mode 100644 extra/DEVELOPER_DOCS/Satellite Packages.md diff --git a/extra/DEVELOPER_DOCS/Satellite Packages.md b/extra/DEVELOPER_DOCS/Satellite Packages.md new file mode 100644 index 000000000..02b06a90e --- /dev/null +++ b/extra/DEVELOPER_DOCS/Satellite Packages.md @@ -0,0 +1,82 @@ +# spaCy Satellite Packages + +This is a list of all the active repos relevant to spaCy besides the main one, with short descriptions, history, and current status. Archived repos will not be covered. + +## Always Included in spaCy + +These packages are always pulled in when you install spaCy. Most of them are direct dependencies, but some are transitive dependencies through other packages. + +- [spacy-legacy](https://github.com/explosion/spacy-legacy): When an architecture in spaCy changes enough to get a new version, the old version is frozen and moved to spacy-legacy. This allows us to keep the core library slim while also preserving backwards compatability. +- [thinc](https://github.com/explosion/thinc): Thinc is the machine learning library that powers trainable components in spaCy. It wraps backends like Numpy, PyTorch, and Tensorflow to provide a functional interface for specifying architectures. +- [catalogue](https://github.com/explosion/catalogue): Small library for adding function registries, like those used for model architectures in spaCy. +- [confection](https://github.com/explosion/confection): This library contains the functionality for config parsing that was formerly contained directly in Thinc. +- [spacy-loggers](https://github.com/explosion/spacy-loggers): Contains loggers beyond the default logger available in spaCy's core code base. This includes loggers integrated with third-party services, which may differ in release cadence from spaCy itself. +- [wasabi](https://github.com/explosion/wasabi): A command line formatting library, used for terminal output in spaCy. +- [srsly](https://github.com/explosion/srsly): A wrapper that vendors several serialization libraries for spaCy. Includes parsers for JSON, JSONL, MessagePack, (extended) Pickle, and YAML. +- [preshed](https://github.com/explosion/preshed): A Cython library for low-level data structures like hash maps, used for memory efficient data storage. +- [cython-blis](https://github.com/explosion/cython-blis): Fast matrix multiplication using BLIS without depending on system libraries. Required by Thinc, rather than spaCy directly. +- [murmurhash](https://github.com/explosion/murmurhash): A wrapper library for a C++ murmurhash implementation, used for string IDs in spaCy and preshed. +- [cymem](https://github.com/explosion/cymem): A small library for RAII-style memory management in Cython. + +## Optional Extensions for spaCy + +These are repos that can be used by spaCy but aren't part of a default installation. Many of these are wrappers to integrate various kinds of third-party libraries. + +- [spacy-transformers](https://github.com/explosion/spacy-transformers): A wrapper for the [HuggingFace Transformers](https://huggingface.co/docs/transformers/index) library, this handles the extensive conversion necessary to coordinate spaCy's powerful `Doc` representation, training pipeline, and the Transformer embeddings. When released, this was known as `spacy-pytorch-transformers`, but it changed to the current name when HuggingFace update the name of their library as well. +- [spacy-huggingface-hub](https://github.com/explosion/spacy-huggingface-hub): This package has a CLI script for uploading a packaged spaCy pipeline (created with `spacy package`) to the [Hugging Face Hub](https://huggingface.co/models). +- [spacy-alignments](https://github.com/explosion/spacy-alignments): A wrapper for the tokenizations library (mentioned below) with a modified build system to simplify cross-platform wheel creation. Used in spacy-transformers for aligning spaCy and HuggingFace tokenizations. +- [spacy-experimental](https://github.com/explosion/spacy-experimental): Experimental components that are not quite ready for inclusion in the main spaCy library. Usually there are unresolved questions around their APIs, so the experimental library allows us to expose them to the community for feedback before fully integrating them. +- [spacy-lookups-data](https://github.com/explosion/spacy-lookups-data): A repository of linguistic data, such as lemmas, that takes up a lot of disk space. Originally created to reduce the size of the spaCy core library. This is mainly useful if you want the data included but aren't using a pretrained pipeline; for the affected languages, the relevant data is included in pretrained pipelines directly. +- [coreferee](https://github.com/explosion/coreferee): Coreference resolution for English, French, German and Polish, optimised for limited training data and easily extensible for further languages. Used as a spaCy pipeline component. +- [spacy-stanza](https://github.com/explosion/spacy-stanza): This is a wrapper that allows the use of Stanford's Stanza library in spaCy. +- [spacy-streamlit](https://github.com/explosion/spacy-streamlit): A wrapper for the Streamlit dashboard building library to help with integrating [displaCy](https://spacy.io/api/top-level/#displacy). +- [spacymoji](https://github.com/explosion/spacymoji): A library to add extra support for emoji to spaCy, such as including character names. +- [thinc-apple-ops](https://github.com/explosion/thinc-apple-ops): A special backend for OSX that uses Apple's native libraries for improved performance. +- [os-signpost](https://github.com/explosion/os-signpost): A Python package that allows you to use the `OSSignposter` API in OSX for performance analysis. +- [spacy-ray](https://github.com/explosion/spacy-ray): A wrapper to integrate spaCy with Ray, a distributed training framework. Currently a work in progress. + +## Prodigy + +[Prodigy](https://prodi.gy) is Explosion's easy to use and highly customizable tool for annotating data. Prodigy itself requires a license, but the repos below contain documentation, examples, and editor or notebook integrations. + +- [prodigy-recipes](https://github.com/explosion/prodigy-recipes): Sample recipes for Prodigy, along with notebooks and other examples of usage. +- [vscode-prodigy](https://github.com/explosion/vscode-prodigy): A VS Code extension that lets you run Prodigy inside VS Code. +- [jupyterlab-prodigy](https://github.com/explosion/jupyterlab-prodigy): An extension for JupyterLab that lets you run Prodigy inside JupyterLab. + +## Independent Tools or Projects + +These are tools that may be related to or use spaCy, but are functional independent projects in their own right as well. + +- [floret](https://github.com/explosion/floret): A modification of fastText to use Bloom Embeddings. Can be used to add vectors with subword features to spaCy, and also works independently in the same manner as fastText. +- [sense2vec](https://github.com/explosion/sense2vec): A library to make embeddings of noun phrases or words coupled with their part of speech. This library uses spaCy. +- [spacy-vectors-builder](https://github.com/explosion/spacy-vectors-builder): This is a spaCy project that builds vectors using floret and a lot of input text. It handles downloading the input data as well as the actual building of vectors. +- [holmes-extractor](https://github.com/explosion/holmes-extractor): Information extraction from English and German texts based on predicate logic. Uses spaCy. +- [healthsea](https://github.com/explosion/healthsea): Healthsea is a project to extract information from comments about health supplements. Structurally, it's a self-contained, large spaCy project. +- [spacy-pkuseg](https://github.com/explosion/spacy-pkuseg): A fork of the pkuseg Chinese tokenizer. Used for Chinese support in spaCy, but also works independently. +- [ml-datasets](https://github.com/explosion/ml-datasets): This repo includes loaders for several standard machine learning datasets, like MNIST or WikiNER, and has historically been used in spaCy example code and documentation. + +## Documentation and Informational Repos + +These repos are used to support the spaCy docs or otherwise present information about spaCy or other Explosion projects. + +- [projects](https://github.com/explosion/projects): The projects repo is used to show detailed examples of spaCy usage. Individual projects can be checked out using the spaCy command line tool, rather than checking out the projects repo directly. +- [spacy-course](https://github.com/explosion/spacy-course): Home to the interactive spaCy course for learning about how to use the library and some basic NLP principles. +- [spacy-io-binder](https://github.com/explosion/spacy-io-binder): Home to the notebooks used for interactive examples in the documentation. + +## Organizational / Meta + +These repos are used for organizing data around spaCy, but are not something an end user would need to install as part of using the library. + +- [spacy-models](https://github.com/explosion/spacy-models): This repo contains metadata (but not training data) for all the spaCy models. This includes information about where their training data came from, version compatability, and performance information. It also includes tests for the model packages, and the built models are hosted as releases of this repo. +- [wheelwright](https://github.com/explosion/wheelwright): A tool for automating our PyPI builds and releases. +- [ec2buildwheel](https://github.com/explosion/ec2buildwheel): A small project that allows you to build Python packages in the manner of cibuildwheel, but on any EC2 image. Used by wheelwright. + +## Other + +Repos that don't fit in any of the above categories. + +- [blis](https://github.com/explosion/blis): A fork of the official BLIS library. The main branch is not updated, but work continues in various branches. This is used for cython-blis. +- [tokenizations](https://github.com/explosion/tokenizations): A library originally by Yohei Tamura to align strings with tolerance to some variations in features like case and diacritics, used for aligning tokens and wordpieces. Adopted and maintained by Explosion, but usually spacy-alignments is used instead. +- [conll-2012](https://github.com/explosion/conll-2012): A repo to hold some slightly cleaned up versions of the official scripts for the CoNLL 2012 shared task involving coreference resolution. Used in the coref project. +- [fastapi-explosion-extras](https://github.com/explosion/fastapi-explosion-extras): Some small tweaks to FastAPI used at Explosion. + From 1f23c615d7a7326ca5a38a7d768b8b70caaa0e17 Mon Sep 17 00:00:00 2001 From: Raphael Mitsch Date: Thu, 8 Sep 2022 10:38:07 +0200 Subject: [PATCH 002/161] Refactor KB for easier customization (#11268) * Add implementation of batching + backwards compatibility fixes. Tests indicate issue with batch disambiguation for custom singular entity lookups. * Fix tests. Add distinction w.r.t. batch size. * Remove redundant and add new comments. * Adjust comments. Fix variable naming in EL prediction. * Fix mypy errors. * Remove KB entity type config option. Change return types of candidate retrieval functions to Iterable from Iterator. Fix various other issues. * Update spacy/pipeline/entity_linker.py Co-authored-by: Paul O'Leary McCann * Update spacy/pipeline/entity_linker.py Co-authored-by: Paul O'Leary McCann * Update spacy/kb_base.pyx Co-authored-by: Paul O'Leary McCann * Update spacy/kb_base.pyx Co-authored-by: Paul O'Leary McCann * Update spacy/pipeline/entity_linker.py Co-authored-by: Paul O'Leary McCann * Add error messages to NotImplementedErrors. Remove redundant comment. * Fix imports. * Remove redundant comments. * Rename KnowledgeBase to InMemoryLookupKB and BaseKnowledgeBase to KnowledgeBase. * Fix tests. * Update spacy/errors.py Co-authored-by: Sofie Van Landeghem * Move KB into subdirectory. * Adjust imports after KB move to dedicated subdirectory. * Fix config imports. * Move Candidate + retrieval functions to separate module. Fix other, small issues. * Fix docstrings and error message w.r.t. class names. Fix typing for candidate retrieval functions. * Update spacy/kb/kb_in_memory.pyx Co-authored-by: Sofie Van Landeghem * Update spacy/ml/models/entity_linker.py Co-authored-by: Sofie Van Landeghem * Fix typing. * Change typing of mentions to be Span instead of Union[Span, str]. * Update docs. * Update EntityLinker and _architecture docs. * Update website/docs/api/entitylinker.md Co-authored-by: Paul O'Leary McCann * Adjust message for E1046. * Re-add section for Candidate in kb.md, add reference to dedicated page. * Update docs and docstrings. * Re-add section + reference for KnowledgeBase.get_alias_candidates() in docs. * Update spacy/kb/candidate.pyx * Update spacy/kb/kb_in_memory.pyx * Update spacy/pipeline/legacy/entity_linker.py * Remove canididate.md. Remove mistakenly added config snippet in entity_linker.py. Co-authored-by: Paul O'Leary McCann Co-authored-by: Sofie Van Landeghem --- setup.py | 4 +- spacy/errors.py | 10 +- spacy/kb/__init__.py | 3 + spacy/kb/candidate.pxd | 12 + spacy/kb/candidate.pyx | 74 +++++ spacy/kb/kb.pxd | 10 + spacy/kb/kb.pyx | 108 +++++++ spacy/{kb.pxd => kb/kb_in_memory.pxd} | 24 +- spacy/{kb.pyx => kb/kb_in_memory.pyx} | 96 ++---- spacy/ml/models/entity_linker.py | 30 +- spacy/pipeline/entity_linker.py | 184 +++++++---- spacy/pipeline/legacy/entity_linker.py | 5 +- spacy/tests/pipeline/test_entity_linker.py | 98 +++--- .../tests/serialize/test_resource_warning.py | 8 +- spacy/tests/serialize/test_serialize_kb.py | 16 +- website/docs/api/architectures.md | 14 +- website/docs/api/entitylinker.md | 5 +- website/docs/api/kb.md | 219 +++++-------- website/docs/api/kb_in_memory.md | 302 ++++++++++++++++++ website/docs/usage/101/_architecture.md | 4 +- 20 files changed, 854 insertions(+), 372 deletions(-) create mode 100644 spacy/kb/__init__.py create mode 100644 spacy/kb/candidate.pxd create mode 100644 spacy/kb/candidate.pyx create mode 100644 spacy/kb/kb.pxd create mode 100644 spacy/kb/kb.pyx rename spacy/{kb.pxd => kb/kb_in_memory.pxd} (92%) rename spacy/{kb.pyx => kb/kb_in_memory.pyx} (90%) create mode 100644 website/docs/api/kb_in_memory.md diff --git a/setup.py b/setup.py index ec1bd35fa..899d940ed 100755 --- a/setup.py +++ b/setup.py @@ -30,7 +30,9 @@ MOD_NAMES = [ "spacy.lexeme", "spacy.vocab", "spacy.attrs", - "spacy.kb", + "spacy.kb.candidate", + "spacy.kb.kb", + "spacy.kb.kb_in_memory", "spacy.ml.parser_model", "spacy.morphology", "spacy.pipeline.dep_parser", diff --git a/spacy/errors.py b/spacy/errors.py index 5ee1476c2..e2201284f 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -709,9 +709,9 @@ class Errors(metaclass=ErrorsWithCodes): "`nlp.enable_pipe` instead.") E927 = ("Can't write to frozen list Maybe you're trying to modify a computed " "property or default function argument?") - E928 = ("A KnowledgeBase can only be serialized to/from from a directory, " + E928 = ("An InMemoryLookupKB can only be serialized to/from from a directory, " "but the provided argument {loc} points to a file.") - E929 = ("Couldn't read KnowledgeBase from {loc}. The path does not seem to exist.") + E929 = ("Couldn't read InMemoryLookupKB from {loc}. The path does not seem to exist.") E930 = ("Received invalid get_examples callback in `{method}`. " "Expected function that returns an iterable of Example objects but " "got: {obj}") @@ -941,6 +941,12 @@ class Errors(metaclass=ErrorsWithCodes): "`{arg2}`={arg2_values} but these arguments are conflicting.") E1043 = ("Expected None or a value in range [{range_start}, {range_end}] for entity linker threshold, but got " "{value}.") + E1044 = ("Expected `candidates_batch_size` to be >= 1, but got: {value}") + E1045 = ("Encountered {parent} subclass without `{parent}.{method}` " + "method in '{name}'. If you want to use this method, make " + "sure it's overwritten on the subclass.") + E1046 = ("{cls_name} is an abstract class and cannot be instantiated. If you are looking for spaCy's default " + "knowledge base, use `InMemoryLookupKB`.") # Deprecated model shortcuts, only used in errors and warnings diff --git a/spacy/kb/__init__.py b/spacy/kb/__init__.py new file mode 100644 index 000000000..1d70a9b34 --- /dev/null +++ b/spacy/kb/__init__.py @@ -0,0 +1,3 @@ +from .kb import KnowledgeBase +from .kb_in_memory import InMemoryLookupKB +from .candidate import Candidate, get_candidates, get_candidates_batch diff --git a/spacy/kb/candidate.pxd b/spacy/kb/candidate.pxd new file mode 100644 index 000000000..942ce9dd0 --- /dev/null +++ b/spacy/kb/candidate.pxd @@ -0,0 +1,12 @@ +from .kb cimport KnowledgeBase +from libcpp.vector cimport vector +from ..typedefs cimport hash_t + +# Object used by the Entity Linker that summarizes one entity-alias candidate combination. +cdef class Candidate: + cdef readonly KnowledgeBase kb + cdef hash_t entity_hash + cdef float entity_freq + cdef vector[float] entity_vector + cdef hash_t alias_hash + cdef float prior_prob diff --git a/spacy/kb/candidate.pyx b/spacy/kb/candidate.pyx new file mode 100644 index 000000000..c89efeb03 --- /dev/null +++ b/spacy/kb/candidate.pyx @@ -0,0 +1,74 @@ +# cython: infer_types=True, profile=True + +from typing import Iterable +from .kb cimport KnowledgeBase +from ..tokens import Span + +cdef class Candidate: + """A `Candidate` object refers to a textual mention (`alias`) that may or may not be resolved + to a specific `entity` from a Knowledge Base. This will be used as input for the entity linking + algorithm which will disambiguate the various candidates to the correct one. + Each candidate (alias, entity) pair is assigned a certain prior probability. + + DOCS: https://spacy.io/api/kb/#candidate-init + """ + + def __init__(self, KnowledgeBase kb, entity_hash, entity_freq, entity_vector, alias_hash, prior_prob): + self.kb = kb + self.entity_hash = entity_hash + self.entity_freq = entity_freq + self.entity_vector = entity_vector + self.alias_hash = alias_hash + self.prior_prob = prior_prob + + @property + def entity(self) -> int: + """RETURNS (uint64): hash of the entity's KB ID/name""" + return self.entity_hash + + @property + def entity_(self) -> str: + """RETURNS (str): ID/name of this entity in the KB""" + return self.kb.vocab.strings[self.entity_hash] + + @property + def alias(self) -> int: + """RETURNS (uint64): hash of the alias""" + return self.alias_hash + + @property + def alias_(self) -> str: + """RETURNS (str): ID of the original alias""" + return self.kb.vocab.strings[self.alias_hash] + + @property + def entity_freq(self) -> float: + return self.entity_freq + + @property + def entity_vector(self) -> Iterable[float]: + return self.entity_vector + + @property + def prior_prob(self) -> float: + return self.prior_prob + + +def get_candidates(kb: KnowledgeBase, mention: Span) -> Iterable[Candidate]: + """ + Return candidate entities for a given mention and fetching appropriate entries from the index. + kb (KnowledgeBase): Knowledge base to query. + mention (Span): Entity mention for which to identify candidates. + RETURNS (Iterable[Candidate]): Identified candidates. + """ + return kb.get_candidates(mention) + + +def get_candidates_batch(kb: KnowledgeBase, mentions: Iterable[Span]) -> Iterable[Iterable[Candidate]]: + """ + Return candidate entities for the given mentions and fetching appropriate entries from the index. + kb (KnowledgeBase): Knowledge base to query. + mention (Iterable[Span]): Entity mentions for which to identify candidates. + RETURNS (Iterable[Iterable[Candidate]]): Identified candidates. + """ + return kb.get_candidates_batch(mentions) diff --git a/spacy/kb/kb.pxd b/spacy/kb/kb.pxd new file mode 100644 index 000000000..1adeef8ae --- /dev/null +++ b/spacy/kb/kb.pxd @@ -0,0 +1,10 @@ +"""Knowledge-base for entity or concept linking.""" + +from cymem.cymem cimport Pool +from libc.stdint cimport int64_t +from ..vocab cimport Vocab + +cdef class KnowledgeBase: + cdef Pool mem + cdef readonly Vocab vocab + cdef readonly int64_t entity_vector_length diff --git a/spacy/kb/kb.pyx b/spacy/kb/kb.pyx new file mode 100644 index 000000000..ce4bc0138 --- /dev/null +++ b/spacy/kb/kb.pyx @@ -0,0 +1,108 @@ +# cython: infer_types=True, profile=True + +from pathlib import Path +from typing import Iterable, Tuple, Union +from cymem.cymem cimport Pool + +from .candidate import Candidate +from ..tokens import Span +from ..util import SimpleFrozenList +from ..errors import Errors + + +cdef class KnowledgeBase: + """A `KnowledgeBase` instance stores unique identifiers for entities and their textual aliases, + to support entity linking of named entities to real-world concepts. + This is an abstract class and requires its operations to be implemented. + + DOCS: https://spacy.io/api/kb + """ + + def __init__(self, vocab: Vocab, entity_vector_length: int): + """Create a KnowledgeBase.""" + # Make sure abstract KB is not instantiated. + if self.__class__ == KnowledgeBase: + raise TypeError( + Errors.E1046.format(cls_name=self.__class__.__name__) + ) + + self.vocab = vocab + self.entity_vector_length = entity_vector_length + self.mem = Pool() + + def get_candidates_batch(self, mentions: Iterable[Span]) -> Iterable[Iterable[Candidate]]: + """ + Return candidate entities for specified texts. Each candidate defines the entity, the original alias, + and the prior probability of that alias resolving to that entity. + If no candidate is found for a given text, an empty list is returned. + mentions (Iterable[Span]): Mentions for which to get candidates. + RETURNS (Iterable[Iterable[Candidate]]): Identified candidates. + """ + return [self.get_candidates(span) for span in mentions] + + def get_candidates(self, mention: Span) -> Iterable[Candidate]: + """ + Return candidate entities for specified text. Each candidate defines the entity, the original alias, + and the prior probability of that alias resolving to that entity. + If the no candidate is found for a given text, an empty list is returned. + mention (Span): Mention for which to get candidates. + RETURNS (Iterable[Candidate]): Identified candidates. + """ + raise NotImplementedError( + Errors.E1045.format(parent="KnowledgeBase", method="get_candidates", name=self.__name__) + ) + + def get_vectors(self, entities: Iterable[str]) -> Iterable[Iterable[float]]: + """ + Return vectors for entities. + entity (str): Entity name/ID. + RETURNS (Iterable[Iterable[float]]): Vectors for specified entities. + """ + return [self.get_vector(entity) for entity in entities] + + def get_vector(self, str entity) -> Iterable[float]: + """ + Return vector for entity. + entity (str): Entity name/ID. + RETURNS (Iterable[float]): Vector for specified entity. + """ + raise NotImplementedError( + Errors.E1045.format(parent="KnowledgeBase", method="get_vector", name=self.__name__) + ) + + def to_bytes(self, **kwargs) -> bytes: + """Serialize the current state to a binary string. + RETURNS (bytes): Current state as binary string. + """ + raise NotImplementedError( + Errors.E1045.format(parent="KnowledgeBase", method="to_bytes", name=self.__name__) + ) + + def from_bytes(self, bytes_data: bytes, *, exclude: Tuple[str] = tuple()): + """Load state from a binary string. + bytes_data (bytes): KB state. + exclude (Tuple[str]): Properties to exclude when restoring KB. + """ + raise NotImplementedError( + Errors.E1045.format(parent="KnowledgeBase", method="from_bytes", name=self.__name__) + ) + + def to_disk(self, path: Union[str, Path], exclude: Iterable[str] = SimpleFrozenList()) -> None: + """ + Write KnowledgeBase content to disk. + path (Union[str, Path]): Target file path. + exclude (Iterable[str]): List of components to exclude. + """ + raise NotImplementedError( + Errors.E1045.format(parent="KnowledgeBase", method="to_disk", name=self.__name__) + ) + + def from_disk(self, path: Union[str, Path], exclude: Iterable[str] = SimpleFrozenList()) -> None: + """ + Load KnowledgeBase content from disk. + path (Union[str, Path]): Target file path. + exclude (Iterable[str]): List of components to exclude. + """ + raise NotImplementedError( + Errors.E1045.format(parent="KnowledgeBase", method="from_disk", name=self.__name__) + ) diff --git a/spacy/kb.pxd b/spacy/kb/kb_in_memory.pxd similarity index 92% rename from spacy/kb.pxd rename to spacy/kb/kb_in_memory.pxd index a823dbe1e..825a6bde9 100644 --- a/spacy/kb.pxd +++ b/spacy/kb/kb_in_memory.pxd @@ -1,14 +1,12 @@ """Knowledge-base for entity or concept linking.""" -from cymem.cymem cimport Pool from preshed.maps cimport PreshMap from libcpp.vector cimport vector from libc.stdint cimport int32_t, int64_t from libc.stdio cimport FILE -from .vocab cimport Vocab -from .typedefs cimport hash_t -from .structs cimport KBEntryC, AliasC - +from ..typedefs cimport hash_t +from ..structs cimport KBEntryC, AliasC +from .kb cimport KnowledgeBase ctypedef vector[KBEntryC] entry_vec ctypedef vector[AliasC] alias_vec @@ -16,21 +14,7 @@ ctypedef vector[float] float_vec ctypedef vector[float_vec] float_matrix -# Object used by the Entity Linker that summarizes one entity-alias candidate combination. -cdef class Candidate: - cdef readonly KnowledgeBase kb - cdef hash_t entity_hash - cdef float entity_freq - cdef vector[float] entity_vector - cdef hash_t alias_hash - cdef float prior_prob - - -cdef class KnowledgeBase: - cdef Pool mem - cdef readonly Vocab vocab - cdef int64_t entity_vector_length - +cdef class InMemoryLookupKB(KnowledgeBase): # This maps 64bit keys (hash of unique entity string) # to 64bit values (position of the _KBEntryC struct in the _entries vector). # The PreshMap is pretty space efficient, as it uses open addressing. So diff --git a/spacy/kb.pyx b/spacy/kb/kb_in_memory.pyx similarity index 90% rename from spacy/kb.pyx rename to spacy/kb/kb_in_memory.pyx index ae1983a8d..485e52c2f 100644 --- a/spacy/kb.pyx +++ b/spacy/kb/kb_in_memory.pyx @@ -1,8 +1,7 @@ # cython: infer_types=True, profile=True -from typing import Iterator, Iterable, Callable, Dict, Any +from typing import Iterable, Callable, Dict, Any, Union import srsly -from cymem.cymem cimport Pool from preshed.maps cimport PreshMap from cpython.exc cimport PyErr_SetFromErrno from libc.stdio cimport fopen, fclose, fread, fwrite, feof, fseek @@ -12,85 +11,28 @@ from libcpp.vector cimport vector from pathlib import Path import warnings -from .typedefs cimport hash_t -from .errors import Errors, Warnings -from . import util -from .util import SimpleFrozenList, ensure_path - -cdef class Candidate: - """A `Candidate` object refers to a textual mention (`alias`) that may or may not be resolved - to a specific `entity` from a Knowledge Base. This will be used as input for the entity linking - algorithm which will disambiguate the various candidates to the correct one. - Each candidate (alias, entity) pair is assigned to a certain prior probability. - - DOCS: https://spacy.io/api/kb/#candidate_init - """ - - def __init__(self, KnowledgeBase kb, entity_hash, entity_freq, entity_vector, alias_hash, prior_prob): - self.kb = kb - self.entity_hash = entity_hash - self.entity_freq = entity_freq - self.entity_vector = entity_vector - self.alias_hash = alias_hash - self.prior_prob = prior_prob - - @property - def entity(self): - """RETURNS (uint64): hash of the entity's KB ID/name""" - return self.entity_hash - - @property - def entity_(self): - """RETURNS (str): ID/name of this entity in the KB""" - return self.kb.vocab.strings[self.entity_hash] - - @property - def alias(self): - """RETURNS (uint64): hash of the alias""" - return self.alias_hash - - @property - def alias_(self): - """RETURNS (str): ID of the original alias""" - return self.kb.vocab.strings[self.alias_hash] - - @property - def entity_freq(self): - return self.entity_freq - - @property - def entity_vector(self): - return self.entity_vector - - @property - def prior_prob(self): - return self.prior_prob +from ..tokens import Span +from ..typedefs cimport hash_t +from ..errors import Errors, Warnings +from .. import util +from ..util import SimpleFrozenList, ensure_path +from ..vocab cimport Vocab +from .kb cimport KnowledgeBase +from .candidate import Candidate as Candidate -def get_candidates(KnowledgeBase kb, span) -> Iterator[Candidate]: - """ - Return candidate entities for a given span by using the text of the span as the alias - and fetching appropriate entries from the index. - This particular function is optimized to work with the built-in KB functionality, - but any other custom candidate generation method can be used in combination with the KB as well. - """ - return kb.get_alias_candidates(span.text) - - -cdef class KnowledgeBase: - """A `KnowledgeBase` instance stores unique identifiers for entities and their textual aliases, +cdef class InMemoryLookupKB(KnowledgeBase): + """An `InMemoryLookupKB` instance stores unique identifiers for entities and their textual aliases, to support entity linking of named entities to real-world concepts. - DOCS: https://spacy.io/api/kb + DOCS: https://spacy.io/api/kb_in_memory """ def __init__(self, Vocab vocab, entity_vector_length): - """Create a KnowledgeBase.""" - self.mem = Pool() - self.entity_vector_length = entity_vector_length + """Create an InMemoryLookupKB.""" + super().__init__(vocab, entity_vector_length) self._entry_index = PreshMap() self._alias_index = PreshMap() - self.vocab = vocab self._create_empty_vectors(dummy_hash=self.vocab.strings[""]) def _initialize_entities(self, int64_t nr_entities): @@ -104,11 +46,6 @@ cdef class KnowledgeBase: self._alias_index = PreshMap(nr_aliases + 1) self._aliases_table = alias_vec(nr_aliases + 1) - @property - def entity_vector_length(self): - """RETURNS (uint64): length of the entity vectors""" - return self.entity_vector_length - def __len__(self): return self.get_size_entities() @@ -286,7 +223,10 @@ cdef class KnowledgeBase: alias_entry.probs = probs self._aliases_table[alias_index] = alias_entry - def get_alias_candidates(self, str alias) -> Iterator[Candidate]: + def get_candidates(self, mention: Span) -> Iterable[Candidate]: + return self.get_alias_candidates(mention.text) # type: ignore + + def get_alias_candidates(self, str alias) -> Iterable[Candidate]: """ Return candidate entities for an alias. Each candidate defines the entity, the original alias, and the prior probability of that alias resolving to that entity. diff --git a/spacy/ml/models/entity_linker.py b/spacy/ml/models/entity_linker.py index d847342a3..4d18d216a 100644 --- a/spacy/ml/models/entity_linker.py +++ b/spacy/ml/models/entity_linker.py @@ -1,11 +1,12 @@ from pathlib import Path from typing import Optional, Callable, Iterable, List, Tuple from thinc.types import Floats2d -from thinc.api import chain, clone, list2ragged, reduce_mean, residual -from thinc.api import Model, Maxout, Linear, noop, tuplify, Ragged +from thinc.api import chain, list2ragged, reduce_mean, residual +from thinc.api import Model, Maxout, Linear, tuplify, Ragged from ...util import registry -from ...kb import KnowledgeBase, Candidate, get_candidates +from ...kb import KnowledgeBase, InMemoryLookupKB +from ...kb import Candidate, get_candidates, get_candidates_batch from ...vocab import Vocab from ...tokens import Span, Doc from ..extract_spans import extract_spans @@ -78,9 +79,11 @@ def span_maker_forward(model, docs: List[Doc], is_train) -> Tuple[Ragged, Callab @registry.misc("spacy.KBFromFile.v1") -def load_kb(kb_path: Path) -> Callable[[Vocab], KnowledgeBase]: - def kb_from_file(vocab): - kb = KnowledgeBase(vocab, entity_vector_length=1) +def load_kb( + kb_path: Path, +) -> Callable[[Vocab], KnowledgeBase]: + def kb_from_file(vocab: Vocab): + kb = InMemoryLookupKB(vocab, entity_vector_length=1) kb.from_disk(kb_path) return kb @@ -88,9 +91,11 @@ def load_kb(kb_path: Path) -> Callable[[Vocab], KnowledgeBase]: @registry.misc("spacy.EmptyKB.v1") -def empty_kb(entity_vector_length: int) -> Callable[[Vocab], KnowledgeBase]: - def empty_kb_factory(vocab): - return KnowledgeBase(vocab=vocab, entity_vector_length=entity_vector_length) +def empty_kb( + entity_vector_length: int, +) -> Callable[[Vocab], KnowledgeBase]: + def empty_kb_factory(vocab: Vocab): + return InMemoryLookupKB(vocab=vocab, entity_vector_length=entity_vector_length) return empty_kb_factory @@ -98,3 +103,10 @@ def empty_kb(entity_vector_length: int) -> Callable[[Vocab], KnowledgeBase]: @registry.misc("spacy.CandidateGenerator.v1") def create_candidates() -> Callable[[KnowledgeBase, Span], Iterable[Candidate]]: return get_candidates + + +@registry.misc("spacy.CandidateBatchGenerator.v1") +def create_candidates_batch() -> Callable[ + [KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]] +]: + return get_candidates_batch diff --git a/spacy/pipeline/entity_linker.py b/spacy/pipeline/entity_linker.py index 73a90b268..62845287b 100644 --- a/spacy/pipeline/entity_linker.py +++ b/spacy/pipeline/entity_linker.py @@ -53,9 +53,11 @@ DEFAULT_NEL_MODEL = Config().from_str(default_model_config)["model"] "incl_context": True, "entity_vector_length": 64, "get_candidates": {"@misc": "spacy.CandidateGenerator.v1"}, + "get_candidates_batch": {"@misc": "spacy.CandidateBatchGenerator.v1"}, "overwrite": True, "scorer": {"@scorers": "spacy.entity_linker_scorer.v1"}, "use_gold_ents": True, + "candidates_batch_size": 1, "threshold": None, }, default_score_weights={ @@ -75,9 +77,13 @@ def make_entity_linker( incl_context: bool, entity_vector_length: int, get_candidates: Callable[[KnowledgeBase, Span], Iterable[Candidate]], + get_candidates_batch: Callable[ + [KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]] + ], overwrite: bool, scorer: Optional[Callable], use_gold_ents: bool, + candidates_batch_size: int, threshold: Optional[float] = None, ): """Construct an EntityLinker component. @@ -90,17 +96,21 @@ def make_entity_linker( incl_prior (bool): Whether or not to include prior probabilities from the KB in the model. incl_context (bool): Whether or not to include the local context in the model. entity_vector_length (int): Size of encoding vectors in the KB. - get_candidates (Callable[[KnowledgeBase, "Span"], Iterable[Candidate]]): Function that + get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that produces a list of candidates, given a certain knowledge base and a textual mention. + get_candidates_batch ( + Callable[[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]], Iterable[Candidate]] + ): Function that produces a list of candidates, given a certain knowledge base and several textual mentions. scorer (Optional[Callable]): The scoring method. use_gold_ents (bool): Whether to copy entities from gold docs or not. If false, another component must provide entity annotations. + candidates_batch_size (int): Size of batches for entity candidate generation. threshold (Optional[float]): Confidence threshold for entity predictions. If confidence is below the threshold, prediction is discarded. If None, predictions are not filtered by any threshold. """ if not model.attrs.get("include_span_maker", False): - # The only difference in arguments here is that use_gold_ents is not available + # The only difference in arguments here is that use_gold_ents and threshold aren't available. return EntityLinker_v1( nlp.vocab, model, @@ -124,9 +134,11 @@ def make_entity_linker( incl_context=incl_context, entity_vector_length=entity_vector_length, get_candidates=get_candidates, + get_candidates_batch=get_candidates_batch, overwrite=overwrite, scorer=scorer, use_gold_ents=use_gold_ents, + candidates_batch_size=candidates_batch_size, threshold=threshold, ) @@ -160,9 +172,13 @@ class EntityLinker(TrainablePipe): incl_context: bool, entity_vector_length: int, get_candidates: Callable[[KnowledgeBase, Span], Iterable[Candidate]], + get_candidates_batch: Callable[ + [KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]] + ], overwrite: bool = BACKWARD_OVERWRITE, scorer: Optional[Callable] = entity_linker_score, use_gold_ents: bool, + candidates_batch_size: int, threshold: Optional[float] = None, ) -> None: """Initialize an entity linker. @@ -178,10 +194,14 @@ class EntityLinker(TrainablePipe): entity_vector_length (int): Size of encoding vectors in the KB. get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that produces a list of candidates, given a certain knowledge base and a textual mention. - scorer (Optional[Callable]): The scoring method. Defaults to - Scorer.score_links. + get_candidates_batch ( + Callable[[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]], + Iterable[Candidate]] + ): Function that produces a list of candidates, given a certain knowledge base and several textual mentions. + scorer (Optional[Callable]): The scoring method. Defaults to Scorer.score_links. use_gold_ents (bool): Whether to copy entities from gold docs or not. If false, another component must provide entity annotations. + candidates_batch_size (int): Size of batches for entity candidate generation. threshold (Optional[float]): Confidence threshold for entity predictions. If confidence is below the threshold, prediction is discarded. If None, predictions are not filtered by any threshold. DOCS: https://spacy.io/api/entitylinker#init @@ -204,22 +224,27 @@ class EntityLinker(TrainablePipe): self.incl_prior = incl_prior self.incl_context = incl_context self.get_candidates = get_candidates + self.get_candidates_batch = get_candidates_batch self.cfg: Dict[str, Any] = {"overwrite": overwrite} self.distance = CosineDistance(normalize=False) # how many neighbour sentences to take into account - # create an empty KB by default. If you want to load a predefined one, specify it in 'initialize'. + # create an empty KB by default self.kb = empty_kb(entity_vector_length)(self.vocab) self.scorer = scorer self.use_gold_ents = use_gold_ents + self.candidates_batch_size = candidates_batch_size self.threshold = threshold + if candidates_batch_size < 1: + raise ValueError(Errors.E1044) + def set_kb(self, kb_loader: Callable[[Vocab], KnowledgeBase]): """Define the KB of this pipe by providing a function that will create it using this object's vocab.""" if not callable(kb_loader): raise ValueError(Errors.E885.format(arg_type=type(kb_loader))) - self.kb = kb_loader(self.vocab) + self.kb = kb_loader(self.vocab) # type: ignore def validate_kb(self) -> None: # Raise an error if the knowledge base is not initialized. @@ -241,8 +266,8 @@ class EntityLinker(TrainablePipe): get_examples (Callable[[], Iterable[Example]]): Function that returns a representative sample of gold-standard Example objects. nlp (Language): The current nlp object the component is part of. - kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates a KnowledgeBase from a Vocab instance. - Note that providing this argument, will overwrite all data accumulated in the current KB. + kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates a KnowledgeBase from a Vocab + instance. Note that providing this argument will overwrite all data accumulated in the current KB. Use this only when loading a KB as-such from file. DOCS: https://spacy.io/api/entitylinker#initialize @@ -419,66 +444,93 @@ class EntityLinker(TrainablePipe): if len(doc) == 0: continue sentences = [s for s in doc.sents] - # Looping through each entity (TODO: rewrite) - for ent in doc.ents: - sent_index = sentences.index(ent.sent) - assert sent_index >= 0 - if self.incl_context: - # get n_neighbour sentences, clipped to the length of the document - start_sentence = max(0, sent_index - self.n_sents) - end_sentence = min(len(sentences) - 1, sent_index + self.n_sents) - start_token = sentences[start_sentence].start - end_token = sentences[end_sentence].end - sent_doc = doc[start_token:end_token].as_doc() - # currently, the context is the same for each entity in a sentence (should be refined) - sentence_encoding = self.model.predict([sent_doc])[0] - sentence_encoding_t = sentence_encoding.T - sentence_norm = xp.linalg.norm(sentence_encoding_t) - entity_count += 1 - if ent.label_ in self.labels_discard: - # ignoring this entity - setting to NIL - final_kb_ids.append(self.NIL) - else: - candidates = list(self.get_candidates(self.kb, ent)) - if not candidates: - # no prediction possible for this entity - setting to NIL - final_kb_ids.append(self.NIL) - elif len(candidates) == 1 and self.threshold is None: - # shortcut for efficiency reasons: take the 1 candidate - final_kb_ids.append(candidates[0].entity_) - else: - random.shuffle(candidates) - # set all prior probabilities to 0 if incl_prior=False - prior_probs = xp.asarray([c.prior_prob for c in candidates]) - if not self.incl_prior: - prior_probs = xp.asarray([0.0 for _ in candidates]) - scores = prior_probs - # add in similarity from the context - if self.incl_context: - entity_encodings = xp.asarray( - [c.entity_vector for c in candidates] - ) - entity_norm = xp.linalg.norm(entity_encodings, axis=1) - if len(entity_encodings) != len(prior_probs): - raise RuntimeError( - Errors.E147.format( - method="predict", - msg="vectors not of equal length", - ) - ) - # cosine similarity - sims = xp.dot(entity_encodings, sentence_encoding_t) / ( - sentence_norm * entity_norm - ) - if sims.shape != prior_probs.shape: - raise ValueError(Errors.E161) - scores = prior_probs + sims - (prior_probs * sims) - final_kb_ids.append( - candidates[scores.argmax().item()].entity_ - if self.threshold is None or scores.max() >= self.threshold - else EntityLinker.NIL + # Loop over entities in batches. + for ent_idx in range(0, len(doc.ents), self.candidates_batch_size): + ent_batch = doc.ents[ent_idx : ent_idx + self.candidates_batch_size] + + # Look up candidate entities. + valid_ent_idx = [ + idx + for idx in range(len(ent_batch)) + if ent_batch[idx].label_ not in self.labels_discard + ] + + batch_candidates = list( + self.get_candidates_batch( + self.kb, [ent_batch[idx] for idx in valid_ent_idx] + ) + if self.candidates_batch_size > 1 + else [ + self.get_candidates(self.kb, ent_batch[idx]) + for idx in valid_ent_idx + ] + ) + + # Looping through each entity in batch (TODO: rewrite) + for j, ent in enumerate(ent_batch): + sent_index = sentences.index(ent.sent) + assert sent_index >= 0 + + if self.incl_context: + # get n_neighbour sentences, clipped to the length of the document + start_sentence = max(0, sent_index - self.n_sents) + end_sentence = min( + len(sentences) - 1, sent_index + self.n_sents ) + start_token = sentences[start_sentence].start + end_token = sentences[end_sentence].end + sent_doc = doc[start_token:end_token].as_doc() + # currently, the context is the same for each entity in a sentence (should be refined) + sentence_encoding = self.model.predict([sent_doc])[0] + sentence_encoding_t = sentence_encoding.T + sentence_norm = xp.linalg.norm(sentence_encoding_t) + entity_count += 1 + if ent.label_ in self.labels_discard: + # ignoring this entity - setting to NIL + final_kb_ids.append(self.NIL) + else: + candidates = list(batch_candidates[j]) + if not candidates: + # no prediction possible for this entity - setting to NIL + final_kb_ids.append(self.NIL) + elif len(candidates) == 1 and self.threshold is None: + # shortcut for efficiency reasons: take the 1 candidate + final_kb_ids.append(candidates[0].entity_) + else: + random.shuffle(candidates) + # set all prior probabilities to 0 if incl_prior=False + prior_probs = xp.asarray([c.prior_prob for c in candidates]) + if not self.incl_prior: + prior_probs = xp.asarray([0.0 for _ in candidates]) + scores = prior_probs + # add in similarity from the context + if self.incl_context: + entity_encodings = xp.asarray( + [c.entity_vector for c in candidates] + ) + entity_norm = xp.linalg.norm(entity_encodings, axis=1) + if len(entity_encodings) != len(prior_probs): + raise RuntimeError( + Errors.E147.format( + method="predict", + msg="vectors not of equal length", + ) + ) + # cosine similarity + sims = xp.dot(entity_encodings, sentence_encoding_t) / ( + sentence_norm * entity_norm + ) + if sims.shape != prior_probs.shape: + raise ValueError(Errors.E161) + scores = prior_probs + sims - (prior_probs * sims) + final_kb_ids.append( + candidates[scores.argmax().item()].entity_ + if self.threshold is None + or scores.max() >= self.threshold + else EntityLinker.NIL + ) + if not (len(final_kb_ids) == entity_count): err = Errors.E147.format( method="predict", msg="result variables not of equal length" diff --git a/spacy/pipeline/legacy/entity_linker.py b/spacy/pipeline/legacy/entity_linker.py index 2f8a1f8ea..c14dfa1db 100644 --- a/spacy/pipeline/legacy/entity_linker.py +++ b/spacy/pipeline/legacy/entity_linker.py @@ -68,8 +68,7 @@ class EntityLinker_v1(TrainablePipe): entity_vector_length (int): Size of encoding vectors in the KB. get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that produces a list of candidates, given a certain knowledge base and a textual mention. - scorer (Optional[Callable]): The scoring method. Defaults to - Scorer.score_links. + scorer (Optional[Callable]): The scoring method. Defaults to Scorer.score_links. DOCS: https://spacy.io/api/entitylinker#init """ self.vocab = vocab @@ -115,7 +114,7 @@ class EntityLinker_v1(TrainablePipe): get_examples (Callable[[], Iterable[Example]]): Function that returns a representative sample of gold-standard Example objects. nlp (Language): The current nlp object the component is part of. - kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates a KnowledgeBase from a Vocab instance. + kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates an InMemoryLookupKB from a Vocab instance. Note that providing this argument, will overwrite all data accumulated in the current KB. Use this only when loading a KB as-such from file. diff --git a/spacy/tests/pipeline/test_entity_linker.py b/spacy/tests/pipeline/test_entity_linker.py index 82bc976bb..4d683acc5 100644 --- a/spacy/tests/pipeline/test_entity_linker.py +++ b/spacy/tests/pipeline/test_entity_linker.py @@ -6,7 +6,7 @@ from numpy.testing import assert_equal from spacy import registry, util from spacy.attrs import ENT_KB_ID from spacy.compat import pickle -from spacy.kb import Candidate, KnowledgeBase, get_candidates +from spacy.kb import Candidate, InMemoryLookupKB, get_candidates, KnowledgeBase from spacy.lang.en import English from spacy.ml import load_kb from spacy.pipeline import EntityLinker @@ -34,7 +34,7 @@ def assert_almost_equal(a, b): def test_issue4674(): """Test that setting entities with overlapping identifiers does not mess up IO""" nlp = English() - kb = KnowledgeBase(nlp.vocab, entity_vector_length=3) + kb = InMemoryLookupKB(nlp.vocab, entity_vector_length=3) vector1 = [0.9, 1.1, 1.01] vector2 = [1.8, 2.25, 2.01] with pytest.warns(UserWarning): @@ -51,7 +51,7 @@ def test_issue4674(): dir_path.mkdir() file_path = dir_path / "kb" kb.to_disk(str(file_path)) - kb2 = KnowledgeBase(nlp.vocab, entity_vector_length=3) + kb2 = InMemoryLookupKB(nlp.vocab, entity_vector_length=3) kb2.from_disk(str(file_path)) assert kb2.get_size_entities() == 1 @@ -59,9 +59,9 @@ def test_issue4674(): @pytest.mark.issue(6730) def test_issue6730(en_vocab): """Ensure that the KB does not accept empty strings, but otherwise IO works fine.""" - from spacy.kb import KnowledgeBase + from spacy.kb.kb_in_memory import InMemoryLookupKB - kb = KnowledgeBase(en_vocab, entity_vector_length=3) + kb = InMemoryLookupKB(en_vocab, entity_vector_length=3) kb.add_entity(entity="1", freq=148, entity_vector=[1, 2, 3]) with pytest.raises(ValueError): @@ -127,7 +127,7 @@ def test_issue7065_b(): def create_kb(vocab): # create artificial KB - mykb = KnowledgeBase(vocab, entity_vector_length=vector_length) + mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length) mykb.add_entity(entity="Q270853", freq=12, entity_vector=[9, 1, -7]) mykb.add_alias( alias="No. 8", @@ -190,7 +190,7 @@ def test_no_entities(): def create_kb(vocab): # create artificial KB - mykb = KnowledgeBase(vocab, entity_vector_length=vector_length) + mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length) mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3]) mykb.add_alias("Russ Cochran", ["Q2146908"], [0.9]) return mykb @@ -231,7 +231,7 @@ def test_partial_links(): def create_kb(vocab): # create artificial KB - mykb = KnowledgeBase(vocab, entity_vector_length=vector_length) + mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length) mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3]) mykb.add_alias("Russ Cochran", ["Q2146908"], [0.9]) return mykb @@ -263,7 +263,7 @@ def test_partial_links(): def test_kb_valid_entities(nlp): """Test the valid construction of a KB with 3 entities and two aliases""" - mykb = KnowledgeBase(nlp.vocab, entity_vector_length=3) + mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=3) # adding entities mykb.add_entity(entity="Q1", freq=19, entity_vector=[8, 4, 3]) @@ -292,7 +292,7 @@ def test_kb_valid_entities(nlp): def test_kb_invalid_entities(nlp): """Test the invalid construction of a KB with an alias linked to a non-existing entity""" - mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1) + mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1) # adding entities mykb.add_entity(entity="Q1", freq=19, entity_vector=[1]) @@ -308,7 +308,7 @@ def test_kb_invalid_entities(nlp): def test_kb_invalid_probabilities(nlp): """Test the invalid construction of a KB with wrong prior probabilities""" - mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1) + mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1) # adding entities mykb.add_entity(entity="Q1", freq=19, entity_vector=[1]) @@ -322,7 +322,7 @@ def test_kb_invalid_probabilities(nlp): def test_kb_invalid_combination(nlp): """Test the invalid construction of a KB with non-matching entity and probability lists""" - mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1) + mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1) # adding entities mykb.add_entity(entity="Q1", freq=19, entity_vector=[1]) @@ -338,7 +338,7 @@ def test_kb_invalid_combination(nlp): def test_kb_invalid_entity_vector(nlp): """Test the invalid construction of a KB with non-matching entity vector lengths""" - mykb = KnowledgeBase(nlp.vocab, entity_vector_length=3) + mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=3) # adding entities mykb.add_entity(entity="Q1", freq=19, entity_vector=[1, 2, 3]) @@ -376,7 +376,7 @@ def test_kb_initialize_empty(nlp): def test_kb_serialize(nlp): """Test serialization of the KB""" - mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1) + mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1) with make_tempdir() as d: # normal read-write behaviour mykb.to_disk(d / "kb") @@ -393,12 +393,12 @@ def test_kb_serialize(nlp): @pytest.mark.issue(9137) def test_kb_serialize_2(nlp): v = [5, 6, 7, 8] - kb1 = KnowledgeBase(vocab=nlp.vocab, entity_vector_length=4) + kb1 = InMemoryLookupKB(vocab=nlp.vocab, entity_vector_length=4) kb1.set_entities(["E1"], [1], [v]) assert kb1.get_vector("E1") == v with make_tempdir() as d: kb1.to_disk(d / "kb") - kb2 = KnowledgeBase(vocab=nlp.vocab, entity_vector_length=4) + kb2 = InMemoryLookupKB(vocab=nlp.vocab, entity_vector_length=4) kb2.from_disk(d / "kb") assert kb2.get_vector("E1") == v @@ -408,7 +408,7 @@ def test_kb_set_entities(nlp): v = [5, 6, 7, 8] v1 = [1, 1, 1, 0] v2 = [2, 2, 2, 3] - kb1 = KnowledgeBase(vocab=nlp.vocab, entity_vector_length=4) + kb1 = InMemoryLookupKB(vocab=nlp.vocab, entity_vector_length=4) kb1.set_entities(["E0"], [1], [v]) assert kb1.get_entity_strings() == ["E0"] kb1.set_entities(["E1", "E2"], [1, 9], [v1, v2]) @@ -417,7 +417,7 @@ def test_kb_set_entities(nlp): assert kb1.get_vector("E2") == v2 with make_tempdir() as d: kb1.to_disk(d / "kb") - kb2 = KnowledgeBase(vocab=nlp.vocab, entity_vector_length=4) + kb2 = InMemoryLookupKB(vocab=nlp.vocab, entity_vector_length=4) kb2.from_disk(d / "kb") assert set(kb2.get_entity_strings()) == {"E1", "E2"} assert kb2.get_vector("E1") == v1 @@ -428,7 +428,7 @@ def test_kb_serialize_vocab(nlp): """Test serialization of the KB and custom strings""" entity = "MyFunnyID" assert entity not in nlp.vocab.strings - mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1) + mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1) assert not mykb.contains_entity(entity) mykb.add_entity(entity, freq=342, entity_vector=[3]) assert mykb.contains_entity(entity) @@ -436,14 +436,14 @@ def test_kb_serialize_vocab(nlp): with make_tempdir() as d: # normal read-write behaviour mykb.to_disk(d / "kb") - mykb_new = KnowledgeBase(Vocab(), entity_vector_length=1) + mykb_new = InMemoryLookupKB(Vocab(), entity_vector_length=1) mykb_new.from_disk(d / "kb") assert entity in mykb_new.vocab.strings def test_candidate_generation(nlp): """Test correct candidate generation""" - mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1) + mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1) doc = nlp("douglas adam Adam shrubbery") douglas_ent = doc[0:1] @@ -481,7 +481,7 @@ def test_el_pipe_configuration(nlp): ruler.add_patterns([pattern]) def create_kb(vocab): - kb = KnowledgeBase(vocab, entity_vector_length=1) + kb = InMemoryLookupKB(vocab, entity_vector_length=1) kb.add_entity(entity="Q2", freq=12, entity_vector=[2]) kb.add_entity(entity="Q3", freq=5, entity_vector=[3]) kb.add_alias(alias="douglas", entities=["Q2", "Q3"], probabilities=[0.8, 0.1]) @@ -500,10 +500,21 @@ def test_el_pipe_configuration(nlp): def get_lowercased_candidates(kb, span): return kb.get_alias_candidates(span.text.lower()) + def get_lowercased_candidates_batch(kb, spans): + return [get_lowercased_candidates(kb, span) for span in spans] + @registry.misc("spacy.LowercaseCandidateGenerator.v1") - def create_candidates() -> Callable[[KnowledgeBase, "Span"], Iterable[Candidate]]: + def create_candidates() -> Callable[ + [InMemoryLookupKB, "Span"], Iterable[Candidate] + ]: return get_lowercased_candidates + @registry.misc("spacy.LowercaseCandidateBatchGenerator.v1") + def create_candidates_batch() -> Callable[ + [InMemoryLookupKB, Iterable["Span"]], Iterable[Iterable[Candidate]] + ]: + return get_lowercased_candidates_batch + # replace the pipe with a new one with with a different candidate generator entity_linker = nlp.replace_pipe( "entity_linker", @@ -511,6 +522,9 @@ def test_el_pipe_configuration(nlp): config={ "incl_context": False, "get_candidates": {"@misc": "spacy.LowercaseCandidateGenerator.v1"}, + "get_candidates_batch": { + "@misc": "spacy.LowercaseCandidateBatchGenerator.v1" + }, }, ) entity_linker.set_kb(create_kb) @@ -532,7 +546,7 @@ def test_nel_nsents(nlp): def test_vocab_serialization(nlp): """Test that string information is retained across storage""" - mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1) + mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1) # adding entities mykb.add_entity(entity="Q1", freq=27, entity_vector=[1]) @@ -552,7 +566,7 @@ def test_vocab_serialization(nlp): with make_tempdir() as d: mykb.to_disk(d / "kb") - kb_new_vocab = KnowledgeBase(Vocab(), entity_vector_length=1) + kb_new_vocab = InMemoryLookupKB(Vocab(), entity_vector_length=1) kb_new_vocab.from_disk(d / "kb") candidates = kb_new_vocab.get_alias_candidates("adam") @@ -568,7 +582,7 @@ def test_vocab_serialization(nlp): def test_append_alias(nlp): """Test that we can append additional alias-entity pairs""" - mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1) + mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1) # adding entities mykb.add_entity(entity="Q1", freq=27, entity_vector=[1]) @@ -599,7 +613,7 @@ def test_append_alias(nlp): @pytest.mark.filterwarnings("ignore:\\[W036") def test_append_invalid_alias(nlp): """Test that append an alias will throw an error if prior probs are exceeding 1""" - mykb = KnowledgeBase(nlp.vocab, entity_vector_length=1) + mykb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1) # adding entities mykb.add_entity(entity="Q1", freq=27, entity_vector=[1]) @@ -621,7 +635,7 @@ def test_preserving_links_asdoc(nlp): vector_length = 1 def create_kb(vocab): - mykb = KnowledgeBase(vocab, entity_vector_length=vector_length) + mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length) # adding entities mykb.add_entity(entity="Q1", freq=19, entity_vector=[1]) mykb.add_entity(entity="Q2", freq=8, entity_vector=[1]) @@ -723,7 +737,7 @@ def test_overfitting_IO(): # create artificial KB - assign same prior weight to the two russ cochran's # Q2146908 (Russ Cochran): American golfer # Q7381115 (Russ Cochran): publisher - mykb = KnowledgeBase(vocab, entity_vector_length=vector_length) + mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length) mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3]) mykb.add_entity(entity="Q7381115", freq=12, entity_vector=[9, 1, -7]) mykb.add_alias( @@ -805,7 +819,7 @@ def test_kb_serialization(): kb_dir = tmp_dir / "kb" nlp1 = English() assert "Q2146908" not in nlp1.vocab.strings - mykb = KnowledgeBase(nlp1.vocab, entity_vector_length=vector_length) + mykb = InMemoryLookupKB(nlp1.vocab, entity_vector_length=vector_length) mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3]) mykb.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8]) assert "Q2146908" in nlp1.vocab.strings @@ -828,7 +842,7 @@ def test_kb_serialization(): def test_kb_pickle(): # Test that the KB can be pickled nlp = English() - kb_1 = KnowledgeBase(nlp.vocab, entity_vector_length=3) + kb_1 = InMemoryLookupKB(nlp.vocab, entity_vector_length=3) kb_1.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3]) assert not kb_1.contains_alias("Russ Cochran") kb_1.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8]) @@ -842,7 +856,7 @@ def test_kb_pickle(): def test_nel_pickle(): # Test that a pipeline with an EL component can be pickled def create_kb(vocab): - kb = KnowledgeBase(vocab, entity_vector_length=3) + kb = InMemoryLookupKB(vocab, entity_vector_length=3) kb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3]) kb.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8]) return kb @@ -864,7 +878,7 @@ def test_nel_pickle(): def test_kb_to_bytes(): # Test that the KB's to_bytes method works correctly nlp = English() - kb_1 = KnowledgeBase(nlp.vocab, entity_vector_length=3) + kb_1 = InMemoryLookupKB(nlp.vocab, entity_vector_length=3) kb_1.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3]) kb_1.add_entity(entity="Q66", freq=9, entity_vector=[1, 2, 3]) kb_1.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8]) @@ -874,7 +888,7 @@ def test_kb_to_bytes(): ) assert kb_1.contains_alias("Russ Cochran") kb_bytes = kb_1.to_bytes() - kb_2 = KnowledgeBase(nlp.vocab, entity_vector_length=3) + kb_2 = InMemoryLookupKB(nlp.vocab, entity_vector_length=3) assert not kb_2.contains_alias("Russ Cochran") kb_2 = kb_2.from_bytes(kb_bytes) # check that both KBs are exactly the same @@ -897,7 +911,7 @@ def test_kb_to_bytes(): def test_nel_to_bytes(): # Test that a pipeline with an EL component can be converted to bytes def create_kb(vocab): - kb = KnowledgeBase(vocab, entity_vector_length=3) + kb = InMemoryLookupKB(vocab, entity_vector_length=3) kb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3]) kb.add_alias(alias="Russ Cochran", entities=["Q2146908"], probabilities=[0.8]) return kb @@ -987,7 +1001,7 @@ def test_legacy_architectures(name, config): train_examples.append(Example.from_dict(doc, annotation)) def create_kb(vocab): - mykb = KnowledgeBase(vocab, entity_vector_length=vector_length) + mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length) mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3]) mykb.add_entity(entity="Q7381115", freq=12, entity_vector=[9, 1, -7]) mykb.add_alias( @@ -1054,7 +1068,7 @@ def test_no_gold_ents(patterns): def create_kb(vocab): # create artificial KB - mykb = KnowledgeBase(vocab, entity_vector_length=vector_length) + mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length) mykb.add_entity(entity="Q613241", freq=12, entity_vector=[6, -4, 3]) mykb.add_alias("Kirby", ["Q613241"], [0.9]) # Placeholder @@ -1104,7 +1118,7 @@ def test_tokenization_mismatch(): def create_kb(vocab): # create placeholder KB - mykb = KnowledgeBase(vocab, entity_vector_length=vector_length) + mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length) mykb.add_entity(entity="Q613241", freq=12, entity_vector=[6, -4, 3]) mykb.add_alias("Kirby", ["Q613241"], [0.9]) return mykb @@ -1121,6 +1135,12 @@ def test_tokenization_mismatch(): nlp.evaluate(train_examples) +def test_abstract_kb_instantiation(): + """Test whether instantiation of abstract KB base class fails.""" + with pytest.raises(TypeError): + KnowledgeBase(None, 3) + + # fmt: off @pytest.mark.parametrize( "meet_threshold,config", @@ -1151,7 +1171,7 @@ def test_threshold(meet_threshold: bool, config: Dict[str, Any]): def create_kb(vocab): # create artificial KB - mykb = KnowledgeBase(vocab, entity_vector_length=3) + mykb = InMemoryLookupKB(vocab, entity_vector_length=3) mykb.add_entity(entity=entity_id, freq=12, entity_vector=[6, -4, 3]) mykb.add_alias( alias="Mahler", diff --git a/spacy/tests/serialize/test_resource_warning.py b/spacy/tests/serialize/test_resource_warning.py index a00b2a688..38701c6d9 100644 --- a/spacy/tests/serialize/test_resource_warning.py +++ b/spacy/tests/serialize/test_resource_warning.py @@ -3,7 +3,7 @@ from unittest import TestCase import pytest import srsly from numpy import zeros -from spacy.kb import KnowledgeBase, Writer +from spacy.kb.kb_in_memory import InMemoryLookupKB, Writer from spacy.vectors import Vectors from spacy.language import Language from spacy.pipeline import TrainablePipe @@ -71,7 +71,7 @@ def entity_linker(): nlp = Language() def create_kb(vocab): - kb = KnowledgeBase(vocab, entity_vector_length=1) + kb = InMemoryLookupKB(vocab, entity_vector_length=1) kb.add_entity("test", 0.0, zeros((1, 1), dtype="f")) return kb @@ -120,7 +120,7 @@ def test_writer_with_path_py35(): def test_save_and_load_knowledge_base(): nlp = Language() - kb = KnowledgeBase(nlp.vocab, entity_vector_length=1) + kb = InMemoryLookupKB(nlp.vocab, entity_vector_length=1) with make_tempdir() as d: path = d / "kb" try: @@ -129,7 +129,7 @@ def test_save_and_load_knowledge_base(): pytest.fail(str(e)) try: - kb_loaded = KnowledgeBase(nlp.vocab, entity_vector_length=1) + kb_loaded = InMemoryLookupKB(nlp.vocab, entity_vector_length=1) kb_loaded.from_disk(path) except Exception as e: pytest.fail(str(e)) diff --git a/spacy/tests/serialize/test_serialize_kb.py b/spacy/tests/serialize/test_serialize_kb.py index 1e0ae3c76..8d3653ab1 100644 --- a/spacy/tests/serialize/test_serialize_kb.py +++ b/spacy/tests/serialize/test_serialize_kb.py @@ -2,7 +2,7 @@ from typing import Callable from spacy import util from spacy.util import ensure_path, registry, load_model_from_config -from spacy.kb import KnowledgeBase +from spacy.kb.kb_in_memory import InMemoryLookupKB from spacy.vocab import Vocab from thinc.api import Config @@ -22,7 +22,7 @@ def test_serialize_kb_disk(en_vocab): dir_path.mkdir() file_path = dir_path / "kb" kb1.to_disk(str(file_path)) - kb2 = KnowledgeBase(vocab=en_vocab, entity_vector_length=3) + kb2 = InMemoryLookupKB(vocab=en_vocab, entity_vector_length=3) kb2.from_disk(str(file_path)) # final assertions @@ -30,7 +30,7 @@ def test_serialize_kb_disk(en_vocab): def _get_dummy_kb(vocab): - kb = KnowledgeBase(vocab, entity_vector_length=3) + kb = InMemoryLookupKB(vocab, entity_vector_length=3) kb.add_entity(entity="Q53", freq=33, entity_vector=[0, 5, 3]) kb.add_entity(entity="Q17", freq=2, entity_vector=[7, 1, 0]) kb.add_entity(entity="Q007", freq=7, entity_vector=[0, 0, 7]) @@ -104,7 +104,7 @@ def test_serialize_subclassed_kb(): custom_field = 666 """ - class SubKnowledgeBase(KnowledgeBase): + class SubInMemoryLookupKB(InMemoryLookupKB): def __init__(self, vocab, entity_vector_length, custom_field): super().__init__(vocab, entity_vector_length) self.custom_field = custom_field @@ -112,9 +112,9 @@ def test_serialize_subclassed_kb(): @registry.misc("spacy.CustomKB.v1") def custom_kb( entity_vector_length: int, custom_field: int - ) -> Callable[[Vocab], KnowledgeBase]: + ) -> Callable[[Vocab], InMemoryLookupKB]: def custom_kb_factory(vocab): - kb = SubKnowledgeBase( + kb = SubInMemoryLookupKB( vocab=vocab, entity_vector_length=entity_vector_length, custom_field=custom_field, @@ -129,7 +129,7 @@ def test_serialize_subclassed_kb(): nlp.initialize() entity_linker = nlp.get_pipe("entity_linker") - assert type(entity_linker.kb) == SubKnowledgeBase + assert type(entity_linker.kb) == SubInMemoryLookupKB assert entity_linker.kb.entity_vector_length == 342 assert entity_linker.kb.custom_field == 666 @@ -139,6 +139,6 @@ def test_serialize_subclassed_kb(): nlp2 = util.load_model_from_path(tmp_dir) entity_linker2 = nlp2.get_pipe("entity_linker") # After IO, the KB is the standard one - assert type(entity_linker2.kb) == KnowledgeBase + assert type(entity_linker2.kb) == InMemoryLookupKB assert entity_linker2.kb.entity_vector_length == 342 assert not hasattr(entity_linker2.kb, "custom_field") diff --git a/website/docs/api/architectures.md b/website/docs/api/architectures.md index 2537faff6..a3cb07b44 100644 --- a/website/docs/api/architectures.md +++ b/website/docs/api/architectures.md @@ -587,8 +587,8 @@ consists of either two or three subnetworks: run once for each batch. - **lower**: Construct a feature-specific vector for each `(token, feature)` pair. This is also run once for each batch. Constructing the state - representation is then a matter of summing the component features and - applying the non-linearity. + representation is then a matter of summing the component features and applying + the non-linearity. - **upper** (optional): A feed-forward network that predicts scores from the state representation. If not present, the output from the lower model is used as action scores directly. @@ -628,8 +628,8 @@ same signature, but the `use_upper` argument was `True` by default. > ``` Build a tagger model, using a provided token-to-vector component. The tagger -model adds a linear layer with softmax activation to predict scores given -the token vectors. +model adds a linear layer with softmax activation to predict scores given the +token vectors. | Name | Description | | ----------- | ------------------------------------------------------------------------------------------ | @@ -919,6 +919,6 @@ A function that reads an existing `KnowledgeBase` from file. A function that takes as input a [`KnowledgeBase`](/api/kb) and a [`Span`](/api/span) object denoting a named entity, and returns a list of -plausible [`Candidate`](/api/kb/#candidate) objects. The default -`CandidateGenerator` uses the text of a mention to find its potential -aliases in the `KnowledgeBase`. Note that this function is case-dependent. +plausible [`Candidate`](/api/kb#candidate) objects. The default +`CandidateGenerator` uses the text of a mention to find its potential aliases in +the `KnowledgeBase`. Note that this function is case-dependent. diff --git a/website/docs/api/entitylinker.md b/website/docs/api/entitylinker.md index 43e08a39c..40ec8afb5 100644 --- a/website/docs/api/entitylinker.md +++ b/website/docs/api/entitylinker.md @@ -14,7 +14,8 @@ entities) to unique identifiers, grounding the named entities into the "real world". It requires a `KnowledgeBase`, as well as a function to generate plausible candidates from that `KnowledgeBase` given a certain textual mention, and a machine learning model to pick the right candidate, given the local -context of the mention. +context of the mention. `EntityLinker` defaults to using the +[`InMemoryLookupKB`](/api/kb_in_memory) implementation. ## Assigned Attributes {#assigned-attributes} @@ -170,7 +171,7 @@ with the current vocab. > > ```python > def create_kb(vocab): -> kb = KnowledgeBase(vocab, entity_vector_length=128) +> kb = InMemoryLookupKB(vocab, entity_vector_length=128) > kb.add_entity(...) > kb.add_alias(...) > return kb diff --git a/website/docs/api/kb.md b/website/docs/api/kb.md index e7a8fcd6f..b217a1678 100644 --- a/website/docs/api/kb.md +++ b/website/docs/api/kb.md @@ -4,27 +4,45 @@ teaser: A storage class for entities and aliases of a specific knowledge base (ontology) tag: class -source: spacy/kb.pyx +source: spacy/kb/kb.pyx new: 2.2 --- -The `KnowledgeBase` object provides a method to generate -[`Candidate`](/api/kb/#candidate) objects, which are plausible external +The `KnowledgeBase` object is an abstract class providing a method to generate +[`Candidate`](/api/kb#candidate) objects, which are plausible external identifiers given a certain textual mention. Each such `Candidate` holds information from the relevant KB entities, such as its frequency in text and possible aliases. Each entity in the knowledge base also has a pretrained entity vector of a fixed size. +Beyond that, `KnowledgeBase` classes have to implement a number of utility +functions called by the [`EntityLinker`](/api/entitylinker) component. + + + +This class was not abstract up to spaCy version 3.5. The `KnowledgeBase` +implementation up to that point is available as `InMemoryLookupKB` from 3.5 +onwards. + + + ## KnowledgeBase.\_\_init\_\_ {#init tag="method"} -Create the knowledge base. +`KnowledgeBase` is an abstract class and cannot be instantiated. Its child +classes should call `__init__()` to set up some necessary attributes. > #### Example > > ```python > from spacy.kb import KnowledgeBase +> from spacy.vocab import Vocab +> +> class FullyImplementedKB(KnowledgeBase): +> def __init__(self, vocab: Vocab, entity_vector_length: int): +> super().__init__(vocab, entity_vector_length) +> ... > vocab = nlp.vocab -> kb = KnowledgeBase(vocab=vocab, entity_vector_length=64) +> kb = FullyImplementedKB(vocab=vocab, entity_vector_length=64) > ``` | Name | Description | @@ -40,133 +58,66 @@ The length of the fixed-size entity vectors in the knowledge base. | ----------- | ------------------------------------------------ | | **RETURNS** | Length of the fixed-size entity vectors. ~~int~~ | -## KnowledgeBase.add_entity {#add_entity tag="method"} +## KnowledgeBase.get_candidates {#get_candidates tag="method"} -Add an entity to the knowledge base, specifying its corpus frequency and entity -vector, which should be of length -[`entity_vector_length`](/api/kb#entity_vector_length). +Given a certain textual mention as input, retrieve a list of candidate entities +of type [`Candidate`](/api/kb#candidate). > #### Example > > ```python -> kb.add_entity(entity="Q42", freq=32, entity_vector=vector1) -> kb.add_entity(entity="Q463035", freq=111, entity_vector=vector2) +> from spacy.lang.en import English +> nlp = English() +> doc = nlp("Douglas Adams wrote 'The Hitchhiker's Guide to the Galaxy'.") +> candidates = kb.get_candidates(doc[0:2]) > ``` -| Name | Description | -| --------------- | ---------------------------------------------------------- | -| `entity` | The unique entity identifier. ~~str~~ | -| `freq` | The frequency of the entity in a typical corpus. ~~float~~ | -| `entity_vector` | The pretrained vector of the entity. ~~numpy.ndarray~~ | +| Name | Description | +| ----------- | -------------------------------------------------------------------- | +| `mention` | The textual mention or alias. ~~Span~~ | +| **RETURNS** | An iterable of relevant `Candidate` objects. ~~Iterable[Candidate]~~ | -## KnowledgeBase.set_entities {#set_entities tag="method"} +## KnowledgeBase.get_candidates_batch {#get_candidates_batch tag="method"} -Define the full list of entities in the knowledge base, specifying the corpus -frequency and entity vector for each entity. +Same as [`get_candidates()`](/api/kb#get_candidates), but for an arbitrary +number of mentions. The [`EntityLinker`](/api/entitylinker) component will call +`get_candidates_batch()` instead of `get_candidates()`, if the config parameter +`candidates_batch_size` is greater or equal than 1. + +The default implementation of `get_candidates_batch()` executes +`get_candidates()` in a loop. We recommend implementing a more efficient way to +retrieve candidates for multiple mentions at once, if performance is of concern +to you. > #### Example > > ```python -> kb.set_entities(entity_list=["Q42", "Q463035"], freq_list=[32, 111], vector_list=[vector1, vector2]) +> from spacy.lang.en import English +> nlp = English() +> doc = nlp("Douglas Adams wrote 'The Hitchhiker's Guide to the Galaxy'.") +> candidates = kb.get_candidates((doc[0:2], doc[3:])) > ``` -| Name | Description | -| ------------- | ---------------------------------------------------------------- | -| `entity_list` | List of unique entity identifiers. ~~Iterable[Union[str, int]]~~ | -| `freq_list` | List of entity frequencies. ~~Iterable[int]~~ | -| `vector_list` | List of entity vectors. ~~Iterable[numpy.ndarray]~~ | - -## KnowledgeBase.add_alias {#add_alias tag="method"} - -Add an alias or mention to the knowledge base, specifying its potential KB -identifiers and their prior probabilities. The entity identifiers should refer -to entities previously added with [`add_entity`](/api/kb#add_entity) or -[`set_entities`](/api/kb#set_entities). The sum of the prior probabilities -should not exceed 1. Note that an empty string can not be used as alias. - -> #### Example -> -> ```python -> kb.add_alias(alias="Douglas", entities=["Q42", "Q463035"], probabilities=[0.6, 0.3]) -> ``` - -| Name | Description | -| --------------- | --------------------------------------------------------------------------------- | -| `alias` | The textual mention or alias. Can not be the empty string. ~~str~~ | -| `entities` | The potential entities that the alias may refer to. ~~Iterable[Union[str, int]]~~ | -| `probabilities` | The prior probabilities of each entity. ~~Iterable[float]~~ | - -## KnowledgeBase.\_\_len\_\_ {#len tag="method"} - -Get the total number of entities in the knowledge base. - -> #### Example -> -> ```python -> total_entities = len(kb) -> ``` - -| Name | Description | -| ----------- | ----------------------------------------------------- | -| **RETURNS** | The number of entities in the knowledge base. ~~int~~ | - -## KnowledgeBase.get_entity_strings {#get_entity_strings tag="method"} - -Get a list of all entity IDs in the knowledge base. - -> #### Example -> -> ```python -> all_entities = kb.get_entity_strings() -> ``` - -| Name | Description | -| ----------- | --------------------------------------------------------- | -| **RETURNS** | The list of entities in the knowledge base. ~~List[str]~~ | - -## KnowledgeBase.get_size_aliases {#get_size_aliases tag="method"} - -Get the total number of aliases in the knowledge base. - -> #### Example -> -> ```python -> total_aliases = kb.get_size_aliases() -> ``` - -| Name | Description | -| ----------- | ---------------------------------------------------- | -| **RETURNS** | The number of aliases in the knowledge base. ~~int~~ | - -## KnowledgeBase.get_alias_strings {#get_alias_strings tag="method"} - -Get a list of all aliases in the knowledge base. - -> #### Example -> -> ```python -> all_aliases = kb.get_alias_strings() -> ``` - -| Name | Description | -| ----------- | -------------------------------------------------------- | -| **RETURNS** | The list of aliases in the knowledge base. ~~List[str]~~ | +| Name | Description | +| ----------- | -------------------------------------------------------------------------------------------- | +| `mentions` | The textual mention or alias. ~~Iterable[Span]~~ | +| **RETURNS** | An iterable of iterable with relevant `Candidate` objects. ~~Iterable[Iterable[Candidate]]~~ | ## KnowledgeBase.get_alias_candidates {#get_alias_candidates tag="method"} -Given a certain textual mention as input, retrieve a list of candidate entities -of type [`Candidate`](/api/kb/#candidate). + +This method is _not_ available from spaCy 3.5 onwards. + -> #### Example -> -> ```python -> candidates = kb.get_alias_candidates("Douglas") -> ``` - -| Name | Description | -| ----------- | ------------------------------------------------------------- | -| `alias` | The textual mention or alias. ~~str~~ | -| **RETURNS** | The list of relevant `Candidate` objects. ~~List[Candidate]~~ | +From spaCy 3.5 on `KnowledgeBase` is an abstract class (with +[`InMemoryLookupKB`](/api/kb_in_memory) being a drop-in replacement) to allow +more flexibility in customizing knowledge bases. Some of its methods were moved +to [`InMemoryLookupKB`](/api/kb_in_memory) during this refactoring, one of those +being `get_alias_candidates()`. This method is now available as +[`InMemoryLookupKB.get_alias_candidates()`](/api/kb_in_memory#get_alias_candidates). +Note: [`InMemoryLookupKB.get_candidates()`](/api/kb_in_memory#get_candidates) +defaults to +[`InMemoryLookupKB.get_alias_candidates()`](/api/kb_in_memory#get_alias_candidates). ## KnowledgeBase.get_vector {#get_vector tag="method"} @@ -178,27 +129,30 @@ Given a certain entity ID, retrieve its pretrained entity vector. > vector = kb.get_vector("Q42") > ``` -| Name | Description | -| ----------- | ------------------------------------ | -| `entity` | The entity ID. ~~str~~ | -| **RETURNS** | The entity vector. ~~numpy.ndarray~~ | +| Name | Description | +| ----------- | -------------------------------------- | +| `entity` | The entity ID. ~~str~~ | +| **RETURNS** | The entity vector. ~~Iterable[float]~~ | -## KnowledgeBase.get_prior_prob {#get_prior_prob tag="method"} +## KnowledgeBase.get_vectors {#get_vectors tag="method"} -Given a certain entity ID and a certain textual mention, retrieve the prior -probability of the fact that the mention links to the entity ID. +Same as [`get_vector()`](/api/kb#get_vector), but for an arbitrary number of +entity IDs. + +The default implementation of `get_vectors()` executes `get_vector()` in a loop. +We recommend implementing a more efficient way to retrieve vectors for multiple +entities at once, if performance is of concern to you. > #### Example > > ```python -> probability = kb.get_prior_prob("Q42", "Douglas") +> vectors = kb.get_vectors(("Q42", "Q3107329")) > ``` -| Name | Description | -| ----------- | ------------------------------------------------------------------------- | -| `entity` | The entity ID. ~~str~~ | -| `alias` | The textual mention or alias. ~~str~~ | -| **RETURNS** | The prior probability of the `alias` referring to the `entity`. ~~float~~ | +| Name | Description | +| ----------- | --------------------------------------------------------- | +| `entities` | The entity IDs. ~~Iterable[str]~~ | +| **RETURNS** | The entity vectors. ~~Iterable[Iterable[numpy.ndarray]]~~ | ## KnowledgeBase.to_disk {#to_disk tag="method"} @@ -207,12 +161,13 @@ Save the current state of the knowledge base to a directory. > #### Example > > ```python -> kb.to_disk(loc) +> kb.to_disk(path) > ``` -| Name | Description | -| ----- | ------------------------------------------------------------------------------------------------------------------------------------------ | -| `loc` | A path to a directory, which will be created if it doesn't exist. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | +| Name | Description | +| --------- | ------------------------------------------------------------------------------------------------------------------------------------------ | +| `path` | A path to a directory, which will be created if it doesn't exist. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | +| `exclude` | List of components to exclude. ~~Iterable[str]~~ | ## KnowledgeBase.from_disk {#from_disk tag="method"} @@ -222,16 +177,16 @@ Restore the state of the knowledge base from a given directory. Note that the > #### Example > > ```python -> from spacy.kb import KnowledgeBase > from spacy.vocab import Vocab > vocab = Vocab().from_disk("/path/to/vocab") -> kb = KnowledgeBase(vocab=vocab, entity_vector_length=64) +> kb = FullyImplementedKB(vocab=vocab, entity_vector_length=64) > kb.from_disk("/path/to/kb") > ``` | Name | Description | | ----------- | ----------------------------------------------------------------------------------------------- | | `loc` | A path to a directory. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | +| `exclude` | List of components to exclude. ~~Iterable[str]~~ | | **RETURNS** | The modified `KnowledgeBase` object. ~~KnowledgeBase~~ | ## Candidate {#candidate tag="class"} diff --git a/website/docs/api/kb_in_memory.md b/website/docs/api/kb_in_memory.md new file mode 100644 index 000000000..c9ce624f0 --- /dev/null +++ b/website/docs/api/kb_in_memory.md @@ -0,0 +1,302 @@ +--- +title: InMemoryLookupKB +teaser: + The default implementation of the KnowledgeBase interface. Stores all + information in-memory. +tag: class +source: spacy/kb/kb_in_memory.pyx +new: 3.5 +--- + +The `InMemoryLookupKB` class inherits from [`KnowledgeBase`](/api/kb) and +implements all of its methods. It stores all KB data in-memory and generates +[`Candidate`](/api/kb#candidate) objects by exactly matching mentions with +entity names. It's highly optimized for both a low memory footprint and speed of +retrieval. + +## InMemoryLookupKB.\_\_init\_\_ {#init tag="method"} + +Create the knowledge base. + +> #### Example +> +> ```python +> from spacy.kb import KnowledgeBase +> vocab = nlp.vocab +> kb = KnowledgeBase(vocab=vocab, entity_vector_length=64) +> ``` + +| Name | Description | +| ---------------------- | ------------------------------------------------ | +| `vocab` | The shared vocabulary. ~~Vocab~~ | +| `entity_vector_length` | Length of the fixed-size entity vectors. ~~int~~ | + +## InMemoryLookupKB.entity_vector_length {#entity_vector_length tag="property"} + +The length of the fixed-size entity vectors in the knowledge base. + +| Name | Description | +| ----------- | ------------------------------------------------ | +| **RETURNS** | Length of the fixed-size entity vectors. ~~int~~ | + +## InMemoryLookupKB.add_entity {#add_entity tag="method"} + +Add an entity to the knowledge base, specifying its corpus frequency and entity +vector, which should be of length +[`entity_vector_length`](/api/kb_in_memory#entity_vector_length). + +> #### Example +> +> ```python +> kb.add_entity(entity="Q42", freq=32, entity_vector=vector1) +> kb.add_entity(entity="Q463035", freq=111, entity_vector=vector2) +> ``` + +| Name | Description | +| --------------- | ---------------------------------------------------------- | +| `entity` | The unique entity identifier. ~~str~~ | +| `freq` | The frequency of the entity in a typical corpus. ~~float~~ | +| `entity_vector` | The pretrained vector of the entity. ~~numpy.ndarray~~ | + +## InMemoryLookupKB.set_entities {#set_entities tag="method"} + +Define the full list of entities in the knowledge base, specifying the corpus +frequency and entity vector for each entity. + +> #### Example +> +> ```python +> kb.set_entities(entity_list=["Q42", "Q463035"], freq_list=[32, 111], vector_list=[vector1, vector2]) +> ``` + +| Name | Description | +| ------------- | ---------------------------------------------------------------- | +| `entity_list` | List of unique entity identifiers. ~~Iterable[Union[str, int]]~~ | +| `freq_list` | List of entity frequencies. ~~Iterable[int]~~ | +| `vector_list` | List of entity vectors. ~~Iterable[numpy.ndarray]~~ | + +## InMemoryLookupKB.add_alias {#add_alias tag="method"} + +Add an alias or mention to the knowledge base, specifying its potential KB +identifiers and their prior probabilities. The entity identifiers should refer +to entities previously added with [`add_entity`](/api/kb_in_memory#add_entity) +or [`set_entities`](/api/kb_in_memory#set_entities). The sum of the prior +probabilities should not exceed 1. Note that an empty string can not be used as +alias. + +> #### Example +> +> ```python +> kb.add_alias(alias="Douglas", entities=["Q42", "Q463035"], probabilities=[0.6, 0.3]) +> ``` + +| Name | Description | +| --------------- | --------------------------------------------------------------------------------- | +| `alias` | The textual mention or alias. Can not be the empty string. ~~str~~ | +| `entities` | The potential entities that the alias may refer to. ~~Iterable[Union[str, int]]~~ | +| `probabilities` | The prior probabilities of each entity. ~~Iterable[float]~~ | + +## InMemoryLookupKB.\_\_len\_\_ {#len tag="method"} + +Get the total number of entities in the knowledge base. + +> #### Example +> +> ```python +> total_entities = len(kb) +> ``` + +| Name | Description | +| ----------- | ----------------------------------------------------- | +| **RETURNS** | The number of entities in the knowledge base. ~~int~~ | + +## InMemoryLookupKB.get_entity_strings {#get_entity_strings tag="method"} + +Get a list of all entity IDs in the knowledge base. + +> #### Example +> +> ```python +> all_entities = kb.get_entity_strings() +> ``` + +| Name | Description | +| ----------- | --------------------------------------------------------- | +| **RETURNS** | The list of entities in the knowledge base. ~~List[str]~~ | + +## InMemoryLookupKB.get_size_aliases {#get_size_aliases tag="method"} + +Get the total number of aliases in the knowledge base. + +> #### Example +> +> ```python +> total_aliases = kb.get_size_aliases() +> ``` + +| Name | Description | +| ----------- | ---------------------------------------------------- | +| **RETURNS** | The number of aliases in the knowledge base. ~~int~~ | + +## InMemoryLookupKB.get_alias_strings {#get_alias_strings tag="method"} + +Get a list of all aliases in the knowledge base. + +> #### Example +> +> ```python +> all_aliases = kb.get_alias_strings() +> ``` + +| Name | Description | +| ----------- | -------------------------------------------------------- | +| **RETURNS** | The list of aliases in the knowledge base. ~~List[str]~~ | + +## InMemoryLookupKB.get_candidates {#get_candidates tag="method"} + +Given a certain textual mention as input, retrieve a list of candidate entities +of type [`Candidate`](/api/kb#candidate). Wraps +[`get_alias_candidates()`](/api/kb_in_memory#get_alias_candidates). + +> #### Example +> +> ```python +> from spacy.lang.en import English +> nlp = English() +> doc = nlp("Douglas Adams wrote 'The Hitchhiker's Guide to the Galaxy'.") +> candidates = kb.get_candidates(doc[0:2]) +> ``` + +| Name | Description | +| ----------- | -------------------------------------------------------------------- | +| `mention` | The textual mention or alias. ~~Span~~ | +| **RETURNS** | An iterable of relevant `Candidate` objects. ~~Iterable[Candidate]~~ | + +## InMemoryLookupKB.get_candidates_batch {#get_candidates_batch tag="method"} + +Same as [`get_candidates()`](/api/kb_in_memory#get_candidates), but for an +arbitrary number of mentions. The [`EntityLinker`](/api/entitylinker) component +will call `get_candidates_batch()` instead of `get_candidates()`, if the config +parameter `candidates_batch_size` is greater or equal than 1. + +The default implementation of `get_candidates_batch()` executes +`get_candidates()` in a loop. We recommend implementing a more efficient way to +retrieve candidates for multiple mentions at once, if performance is of concern +to you. + +> #### Example +> +> ```python +> from spacy.lang.en import English +> nlp = English() +> doc = nlp("Douglas Adams wrote 'The Hitchhiker's Guide to the Galaxy'.") +> candidates = kb.get_candidates((doc[0:2], doc[3:])) +> ``` + +| Name | Description | +| ----------- | -------------------------------------------------------------------------------------------- | +| `mentions` | The textual mention or alias. ~~Iterable[Span]~~ | +| **RETURNS** | An iterable of iterable with relevant `Candidate` objects. ~~Iterable[Iterable[Candidate]]~~ | + +## InMemoryLookupKB.get_alias_candidates {#get_alias_candidates tag="method"} + +Given a certain textual mention as input, retrieve a list of candidate entities +of type [`Candidate`](/api/kb#candidate). + +> #### Example +> +> ```python +> candidates = kb.get_alias_candidates("Douglas") +> ``` + +| Name | Description | +| ----------- | ------------------------------------------------------------- | +| `alias` | The textual mention or alias. ~~str~~ | +| **RETURNS** | The list of relevant `Candidate` objects. ~~List[Candidate]~~ | + +## InMemoryLookupKB.get_vector {#get_vector tag="method"} + +Given a certain entity ID, retrieve its pretrained entity vector. + +> #### Example +> +> ```python +> vector = kb.get_vector("Q42") +> ``` + +| Name | Description | +| ----------- | ------------------------------------ | +| `entity` | The entity ID. ~~str~~ | +| **RETURNS** | The entity vector. ~~numpy.ndarray~~ | + +## InMemoryLookupKB.get_vectors {#get_vectors tag="method"} + +Same as [`get_vector()`](/api/kb_in_memory#get_vector), but for an arbitrary +number of entity IDs. + +The default implementation of `get_vectors()` executes `get_vector()` in a loop. +We recommend implementing a more efficient way to retrieve vectors for multiple +entities at once, if performance is of concern to you. + +> #### Example +> +> ```python +> vectors = kb.get_vectors(("Q42", "Q3107329")) +> ``` + +| Name | Description | +| ----------- | --------------------------------------------------------- | +| `entities` | The entity IDs. ~~Iterable[str]~~ | +| **RETURNS** | The entity vectors. ~~Iterable[Iterable[numpy.ndarray]]~~ | + +## InMemoryLookupKB.get_prior_prob {#get_prior_prob tag="method"} + +Given a certain entity ID and a certain textual mention, retrieve the prior +probability of the fact that the mention links to the entity ID. + +> #### Example +> +> ```python +> probability = kb.get_prior_prob("Q42", "Douglas") +> ``` + +| Name | Description | +| ----------- | ------------------------------------------------------------------------- | +| `entity` | The entity ID. ~~str~~ | +| `alias` | The textual mention or alias. ~~str~~ | +| **RETURNS** | The prior probability of the `alias` referring to the `entity`. ~~float~~ | + +## InMemoryLookupKB.to_disk {#to_disk tag="method"} + +Save the current state of the knowledge base to a directory. + +> #### Example +> +> ```python +> kb.to_disk(path) +> ``` + +| Name | Description | +| --------- | ------------------------------------------------------------------------------------------------------------------------------------------ | +| `path` | A path to a directory, which will be created if it doesn't exist. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | +| `exclude` | List of components to exclude. ~~Iterable[str]~~ | + +## InMemoryLookupKB.from_disk {#from_disk tag="method"} + +Restore the state of the knowledge base from a given directory. Note that the +[`Vocab`](/api/vocab) should also be the same as the one used to create the KB. + +> #### Example +> +> ```python +> from spacy.vocab import Vocab +> vocab = Vocab().from_disk("/path/to/vocab") +> kb = FullyImplementedKB(vocab=vocab, entity_vector_length=64) +> kb.from_disk("/path/to/kb") +> ``` + +| Name | Description | +| ----------- | ----------------------------------------------------------------------------------------------- | +| `loc` | A path to a directory. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | +| `exclude` | List of components to exclude. ~~Iterable[str]~~ | +| **RETURNS** | The modified `KnowledgeBase` object. ~~KnowledgeBase~~ | diff --git a/website/docs/usage/101/_architecture.md b/website/docs/usage/101/_architecture.md index 22e2b961e..4ebca2756 100644 --- a/website/docs/usage/101/_architecture.md +++ b/website/docs/usage/101/_architecture.md @@ -78,7 +78,9 @@ operates on a `Doc` and gives you access to the matched tokens **in context**. | Name | Description | | ------------------------------------------------ | -------------------------------------------------------------------------------------------------- | | [`Corpus`](/api/corpus) | Class for managing annotated corpora for training and evaluation data. | -| [`KnowledgeBase`](/api/kb) | Storage for entities and aliases of a knowledge base for entity linking. | +| [`KnowledgeBase`](/api/kb) | Abstract base class for storage and retrieval of data for entity linking. | +| [`InMemoryLookupKB`](/api/kb_in_memory) | Implementation of `KnowledgeBase` storing all data in memory. | +| [`Candidate`](/api/kb#candidate) | Object associating a textual mention with a specific entity contained in a `KnowledgeBase`. | | [`Lookups`](/api/lookups) | Container for convenient access to large lookup tables and dictionaries. | | [`MorphAnalysis`](/api/morphology#morphanalysis) | A morphological analysis. | | [`Morphology`](/api/morphology) | Store morphological analyses and map them to and from hash values. | From 2602a30d326e561776fecce95ac03cc5df55652b Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Thu, 8 Sep 2022 20:42:47 +0900 Subject: [PATCH 003/161] Fix DVC command example (#11457) This command doesn't have the project dir, but it's required. --- website/docs/usage/projects.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/website/docs/usage/projects.md b/website/docs/usage/projects.md index 566ae561b..35150035a 100644 --- a/website/docs/usage/projects.md +++ b/website/docs/usage/projects.md @@ -758,7 +758,7 @@ and [`dvc repro`](https://dvc.org/doc/command-reference/repro) to reproduce the workflow or individual commands. ```cli -$ python -m spacy project dvc [workflow_name] +$ python -m spacy project dvc [project_dir] [workflow_name] ``` From aac9a58c2935768c7751b8db7043e7c073362c90 Mon Sep 17 00:00:00 2001 From: Madeesh Kannan Date: Fri, 9 Sep 2022 10:46:01 +0200 Subject: [PATCH 004/161] Add docs for the `spacy.models_and_pipes_with_nvtx_range.v1` callback (#11463) * Add docs for the `spacy.models_and_pipes_with_nvtx_range.v1` callback * Add `new` tag --- website/docs/api/top-level.md | 21 +++++++++++++++++++++ 1 file changed, 21 insertions(+) diff --git a/website/docs/api/top-level.md b/website/docs/api/top-level.md index 220b2d6e9..bc53fc868 100644 --- a/website/docs/api/top-level.md +++ b/website/docs/api/top-level.md @@ -887,6 +887,27 @@ backprop passes. | `backprop_color` | Color identifier for backpropagation passes. Defaults to `-1`. ~~int~~ | | **CREATES** | A function that takes the current `nlp` and wraps forward/backprop passes in NVTX ranges. ~~Callable[[Language], Language]~~ | +### spacy.models_and_pipes_with_nvtx_range.v1 {#models_and_pipes_with_nvtx_range tag="registered function" new="3.4"} + +> #### Example config +> +> ```ini +> [nlp] +> after_pipeline_creation = {"@callbacks":"spacy.models_and_pipes_with_nvtx_range.v1"} +> ``` + +Recursively wrap both the models and methods of each pipe using +[NVTX](https://nvidia.github.io/NVTX/) range markers. By default, the following +methods are wrapped: `pipe`, `predict`, `set_annotations`, `update`, `rehearse`, +`get_loss`, `initialize`, `begin_update`, `finish_update`, `update`. + +| Name | Description | +| --------------------------- | --------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `forward_color` | Color identifier for model forward passes. Defaults to `-1`. ~~int~~ | +| `backprop_color` | Color identifier for model backpropagation passes. Defaults to `-1`. ~~int~~ | +| `additional_pipe_functions` | Additional pipeline methods to wrap. Keys are pipeline names and values are lists of method identifiers. Defaults to `None`. ~~Optional[Dict[str, List[str]]]~~ | +| **CREATES** | A function that takes the current `nlp` and wraps pipe models and methods in NVTX ranges. ~~Callable[[Language], Language]~~ | + ## Training data and alignment {#gold source="spacy/training"} ### training.offsets_to_biluo_tags {#offsets_to_biluo_tags tag="function"} From 0c72c6bb2c04677654ffeda2a706e3df3a58b3cc Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 9 Sep 2022 11:21:17 +0200 Subject: [PATCH 005/161] Auto-format code with black (#11468) Co-authored-by: explosion-bot --- spacy/cli/info.py | 1 + 1 file changed, 1 insertion(+) diff --git a/spacy/cli/info.py b/spacy/cli/info.py index e6ac4270f..974bc0f4e 100644 --- a/spacy/cli/info.py +++ b/spacy/cli/info.py @@ -147,6 +147,7 @@ def info_installed_model_url(model: str) -> Optional[str]: # something else, like no file or invalid JSON return None + def info_model_url(model: str) -> Dict[str, Any]: """Return the download URL for the latest version of a pipeline.""" version = get_latest_version(model) From 8a86a35eab45a69d795c2950da61058047d1a516 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Fri, 9 Sep 2022 15:10:04 +0200 Subject: [PATCH 006/161] Remove has_letters in config template (#11465) Due to problems with the javascript conversion in the website quickstart, remove the `has_letters` setting to simplify generating `attrs` for the default `tok2vec`. Additionally reduce `PREFIX` as in the trained pipelines. --- spacy/cli/templates/quickstart_training.jinja | 7 +------ .../cli/templates/quickstart_training_recommendations.yml | 1 - 2 files changed, 1 insertion(+), 7 deletions(-) diff --git a/spacy/cli/templates/quickstart_training.jinja b/spacy/cli/templates/quickstart_training.jinja index ae11dcafc..58864883a 100644 --- a/spacy/cli/templates/quickstart_training.jinja +++ b/spacy/cli/templates/quickstart_training.jinja @@ -271,13 +271,8 @@ factory = "tok2vec" [components.tok2vec.model.embed] @architectures = "spacy.MultiHashEmbed.v2" width = ${components.tok2vec.model.encode.width} -{% if has_letters -%} attrs = ["NORM", "PREFIX", "SUFFIX", "SHAPE"] -rows = [5000, 2500, 2500, 2500] -{% else -%} -attrs = ["ORTH", "SHAPE"] -rows = [5000, 2500] -{% endif -%} +rows = [5000, 1000, 2500, 2500] include_static_vectors = {{ "true" if optimize == "accuracy" else "false" }} [components.tok2vec.model.encode] diff --git a/spacy/cli/templates/quickstart_training_recommendations.yml b/spacy/cli/templates/quickstart_training_recommendations.yml index a7bf9b74a..27945e27a 100644 --- a/spacy/cli/templates/quickstart_training_recommendations.yml +++ b/spacy/cli/templates/quickstart_training_recommendations.yml @@ -271,4 +271,3 @@ zh: accuracy: name: bert-base-chinese size_factor: 3 - has_letters: false From 6b83fee58db27cee70ef8d893cbbf7470db4e242 Mon Sep 17 00:00:00 2001 From: kadarakos Date: Fri, 9 Sep 2022 17:17:10 +0200 Subject: [PATCH 007/161] Assets message (#11458) * new error message when 'project run assets' * new error message when 'project run assets' * Update spacy/cli/project/run.py Co-authored-by: Sofie Van Landeghem Co-authored-by: Sofie Van Landeghem --- spacy/cli/project/run.py | 2 ++ 1 file changed, 2 insertions(+) diff --git a/spacy/cli/project/run.py b/spacy/cli/project/run.py index 734803bc4..d42d95465 100644 --- a/spacy/cli/project/run.py +++ b/spacy/cli/project/run.py @@ -195,6 +195,8 @@ def validate_subcommand( msg.fail(f"No commands or workflows defined in {PROJECT_FILE}", exits=1) if subcommand not in commands and subcommand not in workflows: help_msg = [] + if subcommand in ["assets", "asset"]: + help_msg.append("Did you mean to run: python -m spacy project assets?") if commands: help_msg.append(f"Available commands: {', '.join(commands)}") if workflows: From 0ec9a696e60933807c189c7be22623a81a840289 Mon Sep 17 00:00:00 2001 From: Madeesh Kannan Date: Mon, 12 Sep 2022 14:55:41 +0200 Subject: [PATCH 008/161] Fix config validation failures caused by NVTX pipeline wrappers (#11460) * Enable Cython<->Python bindings for `Pipe` and `TrainablePipe` methods * `pipes_with_nvtx_range`: Skip hooking methods whose signature cannot be ascertained When loading pipelines from a config file, the arguments passed to individual pipeline components is validated by `pydantic` during init. For this, the validation model attempts to parse the function signature of the component's c'tor/entry point so that it can check if all mandatory parameters are present in the config file. When using the `models_and_pipes_with_nvtx_range` as a `after_pipeline_creation` callback, the methods of all pipeline components get replaced by a NVTX range wrapper **before** the above-mentioned validation takes place. This can be problematic for components that are implemented as Cython extension types - if the extension type is not compiled with Python bindings for its methods, they will have no signatures at runtime. This resulted in `pydantic` matching the *wrapper's* parameters with the those in the config and raising errors. To avoid this, we now skip applying the wrapper to any (Cython) methods that do not have signatures. --- spacy/ml/callbacks.py | 7 +++++-- spacy/pipeline/pipe.pyx | 2 +- spacy/pipeline/trainable_pipe.pyx | 2 +- 3 files changed, 7 insertions(+), 4 deletions(-) diff --git a/spacy/ml/callbacks.py b/spacy/ml/callbacks.py index 18290b947..3b60ec2ab 100644 --- a/spacy/ml/callbacks.py +++ b/spacy/ml/callbacks.py @@ -89,11 +89,14 @@ def pipes_with_nvtx_range( types.MethodType(nvtx_range_wrapper_for_pipe_method, pipe), func ) - # Try to preserve the original function signature. + # We need to preserve the original function signature so that + # the original parameters are passed to pydantic for validation downstream. try: wrapped_func.__signature__ = inspect.signature(func) # type: ignore except: - pass + # Can fail for Cython methods that do not have bindings. + warnings.warn(Warnings.W122.format(method=name, pipe=pipe.name)) + continue try: setattr( diff --git a/spacy/pipeline/pipe.pyx b/spacy/pipeline/pipe.pyx index 4e3ae1cf0..8407acc45 100644 --- a/spacy/pipeline/pipe.pyx +++ b/spacy/pipeline/pipe.pyx @@ -1,4 +1,4 @@ -# cython: infer_types=True, profile=True +# cython: infer_types=True, profile=True, binding=True from typing import Optional, Tuple, Iterable, Iterator, Callable, Union, Dict import srsly import warnings diff --git a/spacy/pipeline/trainable_pipe.pyx b/spacy/pipeline/trainable_pipe.pyx index 76b0733cf..3f0507d4b 100644 --- a/spacy/pipeline/trainable_pipe.pyx +++ b/spacy/pipeline/trainable_pipe.pyx @@ -1,4 +1,4 @@ -# cython: infer_types=True, profile=True +# cython: infer_types=True, profile=True, binding=True from typing import Iterable, Iterator, Optional, Dict, Tuple, Callable import srsly from thinc.api import set_dropout_rate, Model, Optimizer From cc10a27c59a3e5fe3c2d08667534fcbf22908f06 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Mon, 12 Sep 2022 15:36:48 +0200 Subject: [PATCH 009/161] Prevent tok2vec to broadcast to listeners when predicting (#11385) * replicate bug with tok2vec in annotating components * add overfitting test with a frozen tok2vec * remove broadcast from predict and check doc.tensor instead * remove broadcast * proper error * slight rephrase of documentation --- spacy/errors.py | 2 + spacy/pipeline/tok2vec.py | 20 ++++--- spacy/tests/pipeline/test_tok2vec.py | 81 ++++++++++++++++++++++++++++ website/docs/usage/training.md | 2 +- 4 files changed, 98 insertions(+), 7 deletions(-) diff --git a/spacy/errors.py b/spacy/errors.py index e2201284f..7e63dc76c 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -538,6 +538,8 @@ class Errors(metaclass=ErrorsWithCodes): E199 = ("Unable to merge 0-length span at `doc[{start}:{end}]`.") E200 = ("Can't set {attr} from Span.") E202 = ("Unsupported {name} mode '{mode}'. Supported modes: {modes}.") + E203 = ("If the {name} embedding layer is not updated " + "during training, make sure to include it in 'annotating components'") # New errors added in v3.x E853 = ("Unsupported component factory name '{name}'. The character '.' is " diff --git a/spacy/pipeline/tok2vec.py b/spacy/pipeline/tok2vec.py index 2e3dde3cb..c742aaeaa 100644 --- a/spacy/pipeline/tok2vec.py +++ b/spacy/pipeline/tok2vec.py @@ -123,9 +123,6 @@ class Tok2Vec(TrainablePipe): width = self.model.get_dim("nO") return [self.model.ops.alloc((0, width)) for doc in docs] tokvecs = self.model.predict(docs) - batch_id = Tok2VecListener.get_batch_id(docs) - for listener in self.listeners: - listener.receive(batch_id, tokvecs, _empty_backprop) return tokvecs def set_annotations(self, docs: Sequence[Doc], tokvecses) -> None: @@ -286,8 +283,19 @@ class Tok2VecListener(Model): def forward(model: Tok2VecListener, inputs, is_train: bool): """Supply the outputs from the upstream Tok2Vec component.""" if is_train: - model.verify_inputs(inputs) - return model._outputs, model._backprop + # This might occur during training when the tok2vec layer is frozen / hasn't been updated. + # In that case, it should be set to "annotating" so we can retrieve the embeddings from the doc. + if model._batch_id is None: + outputs = [] + for doc in inputs: + if doc.tensor.size == 0: + raise ValueError(Errors.E203.format(name="tok2vec")) + else: + outputs.append(doc.tensor) + return outputs, _empty_backprop + else: + model.verify_inputs(inputs) + return model._outputs, model._backprop else: # This is pretty grim, but it's hard to do better :(. # It's hard to avoid relying on the doc.tensor attribute, because the @@ -306,7 +314,7 @@ def forward(model: Tok2VecListener, inputs, is_train: bool): outputs.append(model.ops.alloc2f(len(doc), width)) else: outputs.append(doc.tensor) - return outputs, lambda dX: [] + return outputs, _empty_backprop def _empty_backprop(dX): # for pickling diff --git a/spacy/tests/pipeline/test_tok2vec.py b/spacy/tests/pipeline/test_tok2vec.py index 64faf133d..659274db9 100644 --- a/spacy/tests/pipeline/test_tok2vec.py +++ b/spacy/tests/pipeline/test_tok2vec.py @@ -230,6 +230,87 @@ def test_tok2vec_listener_callback(): assert get_dX(Y) is not None +def test_tok2vec_listener_overfitting(): + """ Test that a pipeline with a listener properly overfits, even if 'tok2vec' is in the annotating components """ + orig_config = Config().from_str(cfg_string) + nlp = util.load_model_from_config(orig_config, auto_fill=True, validate=True) + train_examples = [] + for t in TRAIN_DATA: + train_examples.append(Example.from_dict(nlp.make_doc(t[0]), t[1])) + optimizer = nlp.initialize(get_examples=lambda: train_examples) + + for i in range(50): + losses = {} + nlp.update(train_examples, sgd=optimizer, losses=losses, annotates=["tok2vec"]) + assert losses["tagger"] < 0.00001 + + # test the trained model + test_text = "I like blue eggs" + doc = nlp(test_text) + assert doc[0].tag_ == "N" + assert doc[1].tag_ == "V" + assert doc[2].tag_ == "J" + assert doc[3].tag_ == "N" + + # Also test the results are still the same after IO + with make_tempdir() as tmp_dir: + nlp.to_disk(tmp_dir) + nlp2 = util.load_model_from_path(tmp_dir) + doc2 = nlp2(test_text) + assert doc2[0].tag_ == "N" + assert doc2[1].tag_ == "V" + assert doc2[2].tag_ == "J" + assert doc2[3].tag_ == "N" + + +def test_tok2vec_frozen_not_annotating(): + """ Test that a pipeline with a frozen tok2vec raises an error when the tok2vec is not annotating """ + orig_config = Config().from_str(cfg_string) + nlp = util.load_model_from_config(orig_config, auto_fill=True, validate=True) + train_examples = [] + for t in TRAIN_DATA: + train_examples.append(Example.from_dict(nlp.make_doc(t[0]), t[1])) + optimizer = nlp.initialize(get_examples=lambda: train_examples) + + for i in range(2): + losses = {} + with pytest.raises(ValueError, match=r"the tok2vec embedding layer is not updated"): + nlp.update(train_examples, sgd=optimizer, losses=losses, exclude=["tok2vec"]) + + +def test_tok2vec_frozen_overfitting(): + """ Test that a pipeline with a frozen & annotating tok2vec can still overfit """ + orig_config = Config().from_str(cfg_string) + nlp = util.load_model_from_config(orig_config, auto_fill=True, validate=True) + train_examples = [] + for t in TRAIN_DATA: + train_examples.append(Example.from_dict(nlp.make_doc(t[0]), t[1])) + optimizer = nlp.initialize(get_examples=lambda: train_examples) + + for i in range(100): + losses = {} + nlp.update(train_examples, sgd=optimizer, losses=losses, exclude=["tok2vec"], annotates=["tok2vec"]) + assert losses["tagger"] < 0.0001 + + # test the trained model + test_text = "I like blue eggs" + doc = nlp(test_text) + assert doc[0].tag_ == "N" + assert doc[1].tag_ == "V" + assert doc[2].tag_ == "J" + assert doc[3].tag_ == "N" + + # Also test the results are still the same after IO + with make_tempdir() as tmp_dir: + nlp.to_disk(tmp_dir) + nlp2 = util.load_model_from_path(tmp_dir) + doc2 = nlp2(test_text) + assert doc2[0].tag_ == "N" + assert doc2[1].tag_ == "V" + assert doc2[2].tag_ == "J" + assert doc2[3].tag_ == "N" + + def test_replace_listeners(): orig_config = Config().from_str(cfg_string) nlp = util.load_model_from_config(orig_config, auto_fill=True, validate=True) diff --git a/website/docs/usage/training.md b/website/docs/usage/training.md index 5e064b269..27a8bbca7 100644 --- a/website/docs/usage/training.md +++ b/website/docs/usage/training.md @@ -480,7 +480,7 @@ as-is. They are also excluded when calling > parse. So the evaluation results should always reflect what your pipeline will > produce at runtime. If you want a frozen component to run (without updating) > during training as well, so that downstream components can use its -> **predictions**, you can add it to the list of +> **predictions**, you should add it to the list of > [`annotating_components`](/usage/training#annotating-components). ```ini From 6be6913ba5aaa7aa35deb1a9fcd4418d93824b24 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Tue, 13 Sep 2022 09:04:53 +0200 Subject: [PATCH 010/161] Update cupy extras (#11279) * Update cupy extras: * Extend to v11 * Add `cupy-cuda11x` and `cupy-wheel` * Update quickstart to use `cupy-wheel` for CUDA 10.2+ * Rename cuda-wheel to cuda-autodetect, remove repeated CUDA in menu --- setup.cfg | 36 +++++++++++++---------- website/src/widgets/quickstart-install.js | 12 ++------ 2 files changed, 22 insertions(+), 26 deletions(-) diff --git a/setup.cfg b/setup.cfg index 5fd820a96..2dc5e7042 100644 --- a/setup.cfg +++ b/setup.cfg @@ -76,37 +76,41 @@ transformers = ray = spacy_ray>=0.1.0,<1.0.0 cuda = - cupy>=5.0.0b4,<11.0.0 + cupy>=5.0.0b4,<12.0.0 cuda80 = - cupy-cuda80>=5.0.0b4,<11.0.0 + cupy-cuda80>=5.0.0b4,<12.0.0 cuda90 = - cupy-cuda90>=5.0.0b4,<11.0.0 + cupy-cuda90>=5.0.0b4,<12.0.0 cuda91 = - cupy-cuda91>=5.0.0b4,<11.0.0 + cupy-cuda91>=5.0.0b4,<12.0.0 cuda92 = - cupy-cuda92>=5.0.0b4,<11.0.0 + cupy-cuda92>=5.0.0b4,<12.0.0 cuda100 = - cupy-cuda100>=5.0.0b4,<11.0.0 + cupy-cuda100>=5.0.0b4,<12.0.0 cuda101 = - cupy-cuda101>=5.0.0b4,<11.0.0 + cupy-cuda101>=5.0.0b4,<12.0.0 cuda102 = - cupy-cuda102>=5.0.0b4,<11.0.0 + cupy-cuda102>=5.0.0b4,<12.0.0 cuda110 = - cupy-cuda110>=5.0.0b4,<11.0.0 + cupy-cuda110>=5.0.0b4,<12.0.0 cuda111 = - cupy-cuda111>=5.0.0b4,<11.0.0 + cupy-cuda111>=5.0.0b4,<12.0.0 cuda112 = - cupy-cuda112>=5.0.0b4,<11.0.0 + cupy-cuda112>=5.0.0b4,<12.0.0 cuda113 = - cupy-cuda113>=5.0.0b4,<11.0.0 + cupy-cuda113>=5.0.0b4,<12.0.0 cuda114 = - cupy-cuda114>=5.0.0b4,<11.0.0 + cupy-cuda114>=5.0.0b4,<12.0.0 cuda115 = - cupy-cuda115>=5.0.0b4,<11.0.0 + cupy-cuda115>=5.0.0b4,<12.0.0 cuda116 = - cupy-cuda116>=5.0.0b4,<11.0.0 + cupy-cuda116>=5.0.0b4,<12.0.0 cuda117 = - cupy-cuda117>=5.0.0b4,<11.0.0 + cupy-cuda117>=5.0.0b4,<12.0.0 +cuda11x = + cupy-cuda11x>=11.0.0,<12.0.0 +cuda-autodetect = + cupy-wheel>=11.0.0,<12.0.0 apple = thinc-apple-ops>=0.1.0.dev0,<1.0.0 # Language tokenizers with external dependencies diff --git a/website/src/widgets/quickstart-install.js b/website/src/widgets/quickstart-install.js index 61c0678dd..0d2186acb 100644 --- a/website/src/widgets/quickstart-install.js +++ b/website/src/widgets/quickstart-install.js @@ -9,7 +9,7 @@ const DEFAULT_PLATFORM = 'x86' const DEFAULT_MODELS = ['en'] const DEFAULT_OPT = 'efficiency' const DEFAULT_HARDWARE = 'cpu' -const DEFAULT_CUDA = 'cuda113' +const DEFAULT_CUDA = 'cuda-autodetect' const CUDA = { '8.0': 'cuda80', '9.0': 'cuda90', @@ -17,15 +17,7 @@ const CUDA = { '9.2': 'cuda92', '10.0': 'cuda100', '10.1': 'cuda101', - '10.2': 'cuda102', - '11.0': 'cuda110', - '11.1': 'cuda111', - '11.2': 'cuda112', - '11.3': 'cuda113', - '11.4': 'cuda114', - '11.5': 'cuda115', - '11.6': 'cuda116', - '11.7': 'cuda117', + '10.2, 11.0+': 'cuda-autodetect', } const LANG_EXTRAS = ['ja'] // only for languages with models From 3f0c3ad7d30d493cd017b6bb41b174d991bbcdc1 Mon Sep 17 00:00:00 2001 From: Richard Hudson Date: Wed, 14 Sep 2022 09:36:55 +0200 Subject: [PATCH 011/161] Correct alignment example and documentation (#11491) * Correct example and documentation * Added altered example.md * Changes based on review + apply prettier * Remote unnecessary 'the' Co-authored-by: Madeesh Kannan Co-authored-by: Madeesh Kannan --- website/docs/api/example.md | 16 ++++++++++------ website/docs/usage/linguistic-features.md | 10 +++++----- 2 files changed, 15 insertions(+), 11 deletions(-) diff --git a/website/docs/api/example.md b/website/docs/api/example.md index ca9d3c056..0228e8935 100644 --- a/website/docs/api/example.md +++ b/website/docs/api/example.md @@ -286,10 +286,14 @@ Calculate alignment tables between two tokenizations. ### Alignment attributes {#alignment-attributes"} -| Name | Description | -| ----- | --------------------------------------------------------------------- | -| `x2y` | The `Ragged` object holding the alignment from `x` to `y`. ~~Ragged~~ | -| `y2x` | The `Ragged` object holding the alignment from `y` to `x`. ~~Ragged~~ | +Alignment attributes are managed using `AlignmentArray`, which is a +simplified version of Thinc's [Ragged](https://thinc.ai/docs/api-types#ragged) +type that only supports the `data` and `length` attributes. + +| Name | Description | +| ----- | ------------------------------------------------------------------------------------- | +| `x2y` | The `AlignmentArray` object holding the alignment from `x` to `y`. ~~AlignmentArray~~ | +| `y2x` | The `AlignmentArray` object holding the alignment from `y` to `x`. ~~AlignmentArray~~ | @@ -309,10 +313,10 @@ tokenizations add up to the same string. For example, you'll be able to align > spacy_tokens = ["obama", "'s", "podcast"] > alignment = Alignment.from_strings(bert_tokens, spacy_tokens) > a2b = alignment.x2y -> assert list(a2b.dataXd) == [0, 1, 1, 2] +> assert list(a2b.data) == [0, 1, 1, 2] > ``` > -> If `a2b.dataXd[1] == a2b.dataXd[2] == 1`, that means that `A[1]` (`"'"`) and +> If `a2b.data[1] == a2b.data[2] == 1`, that means that `A[1]` (`"'"`) and > `A[2]` (`"s"`) both align to `B[1]` (`"'s"`). ### Alignment.from_strings {#classmethod tag="function"} diff --git a/website/docs/usage/linguistic-features.md b/website/docs/usage/linguistic-features.md index 82472c67e..099678c40 100644 --- a/website/docs/usage/linguistic-features.md +++ b/website/docs/usage/linguistic-features.md @@ -1422,9 +1422,9 @@ other_tokens = ["i", "listened", "to", "obama", "'", "s", "podcasts", "."] spacy_tokens = ["i", "listened", "to", "obama", "'s", "podcasts", "."] align = Alignment.from_strings(other_tokens, spacy_tokens) print(f"a -> b, lengths: {align.x2y.lengths}") # array([1, 1, 1, 1, 1, 1, 1, 1]) -print(f"a -> b, mapping: {align.x2y.dataXd}") # array([0, 1, 2, 3, 4, 4, 5, 6]) : two tokens both refer to "'s" +print(f"a -> b, mapping: {align.x2y.data}") # array([0, 1, 2, 3, 4, 4, 5, 6]) : two tokens both refer to "'s" print(f"b -> a, lengths: {align.y2x.lengths}") # array([1, 1, 1, 1, 2, 1, 1]) : the token "'s" refers to two tokens -print(f"b -> a, mappings: {align.y2x.dataXd}") # array([0, 1, 2, 3, 4, 5, 6, 7]) +print(f"b -> a, mappings: {align.y2x.data}") # array([0, 1, 2, 3, 4, 5, 6, 7]) ``` Here are some insights from the alignment information generated in the example @@ -1433,10 +1433,10 @@ above: - The one-to-one mappings for the first four tokens are identical, which means they map to each other. This makes sense because they're also identical in the input: `"i"`, `"listened"`, `"to"` and `"obama"`. -- The value of `x2y.dataXd[6]` is `5`, which means that `other_tokens[6]` +- The value of `x2y.data[6]` is `5`, which means that `other_tokens[6]` (`"podcasts"`) aligns to `spacy_tokens[5]` (also `"podcasts"`). -- `x2y.dataXd[4]` and `x2y.dataXd[5]` are both `4`, which means that both tokens - 4 and 5 of `other_tokens` (`"'"` and `"s"`) align to token 4 of `spacy_tokens` +- `x2y.data[4]` and `x2y.data[5]` are both `4`, which means that both tokens 4 + and 5 of `other_tokens` (`"'"` and `"s"`) align to token 4 of `spacy_tokens` (`"'s"`). From 7c98245c0c0f9c6c0c4a523c0bf1a75690e58620 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Wed, 14 Sep 2022 17:05:22 +0200 Subject: [PATCH 012/161] Add levenshtein from polyleven (#11418) Add a simple levenshtein distance function using the implementation from the polyleven library as `spacy.matcher.levenshtein`. --- .gitignore | 1 + licenses/3rd_party_licenses.txt | 31 ++ setup.py | 11 + spacy/matcher/__init__.py | 3 +- spacy/matcher/levenshtein.pyx | 15 + spacy/matcher/polyleven.c | 384 ++++++++++++++++++++++++ spacy/tests/matcher/test_levenshtein.py | 36 +++ 7 files changed, 480 insertions(+), 1 deletion(-) create mode 100644 spacy/matcher/levenshtein.pyx create mode 100644 spacy/matcher/polyleven.c create mode 100644 spacy/tests/matcher/test_levenshtein.py diff --git a/.gitignore b/.gitignore index ac72f2bbf..ac333f958 100644 --- a/.gitignore +++ b/.gitignore @@ -24,6 +24,7 @@ quickstart-training-generator.js cythonize.json spacy/*.html *.cpp +*.c *.so # Vim / VSCode / editors diff --git a/licenses/3rd_party_licenses.txt b/licenses/3rd_party_licenses.txt index d58da9c4a..851e09585 100644 --- a/licenses/3rd_party_licenses.txt +++ b/licenses/3rd_party_licenses.txt @@ -127,3 +127,34 @@ distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. + + +polyleven +--------- + +* Files: spacy/matcher/polyleven.c + +MIT License + +Copyright (c) 2021 Fujimoto Seiji +Copyright (c) 2021 Max Bachmann +Copyright (c) 2022 Nick Mazuk +Copyright (c) 2022 Michael Weiss + +Permission is hereby granted, free of charge, to any person obtaining a copy +of this software and associated documentation files (the "Software"), to deal +in the Software without restriction, including without limitation the rights +to use, copy, modify, merge, publish, distribute, sublicense, and/or sell +copies of the Software, and to permit persons to whom the Software is +furnished to do so, subject to the following conditions: + +The above copyright notice and this permission notice shall be included in all +copies or substantial portions of the Software. + +THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR +IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, +FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE +AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER +LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, +OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE +SOFTWARE. diff --git a/setup.py b/setup.py index ec1bd35fa..c4138aa93 100755 --- a/setup.py +++ b/setup.py @@ -205,6 +205,17 @@ def setup_package(): get_python_inc(plat_specific=True), ] ext_modules = [] + ext_modules.append( + Extension( + "spacy.matcher.levenshtein", + [ + "spacy/matcher/levenshtein.pyx", + "spacy/matcher/polyleven.c", + ], + language="c", + include_dirs=include_dirs, + ) + ) for name in MOD_NAMES: mod_path = name.replace(".", "/") + ".pyx" ext = Extension( diff --git a/spacy/matcher/__init__.py b/spacy/matcher/__init__.py index 286844787..a4f164847 100644 --- a/spacy/matcher/__init__.py +++ b/spacy/matcher/__init__.py @@ -1,5 +1,6 @@ from .matcher import Matcher from .phrasematcher import PhraseMatcher from .dependencymatcher import DependencyMatcher +from .levenshtein import levenshtein -__all__ = ["Matcher", "PhraseMatcher", "DependencyMatcher"] +__all__ = ["Matcher", "PhraseMatcher", "DependencyMatcher", "levenshtein"] diff --git a/spacy/matcher/levenshtein.pyx b/spacy/matcher/levenshtein.pyx new file mode 100644 index 000000000..8463d913d --- /dev/null +++ b/spacy/matcher/levenshtein.pyx @@ -0,0 +1,15 @@ +# cython: profile=True, binding=True, infer_types=True +from cpython.object cimport PyObject +from libc.stdint cimport int64_t + +from typing import Optional + + +cdef extern from "polyleven.c": + int64_t polyleven(PyObject *o1, PyObject *o2, int64_t k) + + +cpdef int64_t levenshtein(a: str, b: str, k: Optional[int] = None): + if k is None: + k = -1 + return polyleven(a, b, k) diff --git a/spacy/matcher/polyleven.c b/spacy/matcher/polyleven.c new file mode 100644 index 000000000..2f2b8826c --- /dev/null +++ b/spacy/matcher/polyleven.c @@ -0,0 +1,384 @@ +/* + * Adapted from Polyleven (https://ceptord.net/) + * + * Source: https://github.com/fujimotos/polyleven/blob/c3f95a080626c5652f0151a2e449963288ccae84/polyleven.c + * + * Copyright (c) 2021 Fujimoto Seiji + * Copyright (c) 2021 Max Bachmann + * Copyright (c) 2022 Nick Mazuk + * Copyright (c) 2022 Michael Weiss + * + * Permission is hereby granted, free of charge, to any person obtaining a copy + * of this software and associated documentation files (the "Software"), to deal + * in the Software without restriction, including without limitation the rights + * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell + * copies of the Software, and to permit persons to whom the Software is + * furnished to do so, subject to the following conditions: + * + * The above copyright notice and this permission notice shall be included in all + * copies or substantial portions of the Software. + * + * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR + * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, + * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE + * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER + * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, + * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE + * SOFTWARE. + */ + +#include +#include + +#define MIN(a,b) ((a) < (b) ? (a) : (b)) +#define MAX(a,b) ((a) > (b) ? (a) : (b)) +#define CDIV(a,b) ((a) / (b) + ((a) % (b) > 0)) +#define BIT(i,n) (((i) >> (n)) & 1) +#define FLIP(i,n) ((i) ^ ((uint64_t) 1 << (n))) +#define ISASCII(kd) ((kd) == PyUnicode_1BYTE_KIND) + +/* + * Bare bone of PyUnicode + */ +struct strbuf { + void *ptr; + int kind; + int64_t len; +}; + +static void strbuf_init(struct strbuf *s, PyObject *o) +{ + s->ptr = PyUnicode_DATA(o); + s->kind = PyUnicode_KIND(o); + s->len = PyUnicode_GET_LENGTH(o); +} + +#define strbuf_read(s, i) PyUnicode_READ((s)->kind, (s)->ptr, (i)) + +/* + * An encoded mbleven model table. + * + * Each 8-bit integer represents an edit sequence, with using two + * bits for a single operation. + * + * 01 = DELETE, 10 = INSERT, 11 = REPLACE + * + * For example, 13 is '1101' in binary notation, so it means + * DELETE + REPLACE. + */ +static const uint8_t MBLEVEN_MATRIX[] = { + 3, 0, 0, 0, 0, 0, 0, 0, + 1, 0, 0, 0, 0, 0, 0, 0, + 15, 9, 6, 0, 0, 0, 0, 0, + 13, 7, 0, 0, 0, 0, 0, 0, + 5, 0, 0, 0, 0, 0, 0, 0, + 63, 39, 45, 57, 54, 30, 27, 0, + 61, 55, 31, 37, 25, 22, 0, 0, + 53, 29, 23, 0, 0, 0, 0, 0, + 21, 0, 0, 0, 0, 0, 0, 0, +}; + +#define MBLEVEN_MATRIX_GET(k, d) ((((k) + (k) * (k)) / 2 - 1) + (d)) * 8 + +static int64_t mbleven_ascii(char *s1, int64_t len1, + char *s2, int64_t len2, int k) +{ + int pos; + uint8_t m; + int64_t i, j, c, r; + + pos = MBLEVEN_MATRIX_GET(k, len1 - len2); + r = k + 1; + + while (MBLEVEN_MATRIX[pos]) { + m = MBLEVEN_MATRIX[pos++]; + i = j = c = 0; + while (i < len1 && j < len2) { + if (s1[i] != s2[j]) { + c++; + if (!m) break; + if (m & 1) i++; + if (m & 2) j++; + m >>= 2; + } else { + i++; + j++; + } + } + c += (len1 - i) + (len2 - j); + r = MIN(r, c); + if (r < 2) { + return r; + } + } + return r; +} + +static int64_t mbleven(PyObject *o1, PyObject *o2, int64_t k) +{ + int pos; + uint8_t m; + int64_t i, j, c, r; + struct strbuf s1, s2; + + strbuf_init(&s1, o1); + strbuf_init(&s2, o2); + + if (s1.len < s2.len) + return mbleven(o2, o1, k); + + if (k > 3) + return -1; + + if (k < s1.len - s2.len) + return k + 1; + + if (ISASCII(s1.kind) && ISASCII(s2.kind)) + return mbleven_ascii(s1.ptr, s1.len, s2.ptr, s2.len, k); + + pos = MBLEVEN_MATRIX_GET(k, s1.len - s2.len); + r = k + 1; + + while (MBLEVEN_MATRIX[pos]) { + m = MBLEVEN_MATRIX[pos++]; + i = j = c = 0; + while (i < s1.len && j < s2.len) { + if (strbuf_read(&s1, i) != strbuf_read(&s2, j)) { + c++; + if (!m) break; + if (m & 1) i++; + if (m & 2) j++; + m >>= 2; + } else { + i++; + j++; + } + } + c += (s1.len - i) + (s2.len - j); + r = MIN(r, c); + if (r < 2) { + return r; + } + } + return r; +} + +/* + * Data structure to store Peq (equality bit-vector). + */ +struct blockmap_entry { + uint32_t key[128]; + uint64_t val[128]; +}; + +struct blockmap { + int64_t nr; + struct blockmap_entry *list; +}; + +#define blockmap_key(c) ((c) | 0x80000000U) +#define blockmap_hash(c) ((c) % 128) + +static int blockmap_init(struct blockmap *map, struct strbuf *s) +{ + int64_t i; + struct blockmap_entry *be; + uint32_t c, k; + uint8_t h; + + map->nr = CDIV(s->len, 64); + map->list = calloc(1, map->nr * sizeof(struct blockmap_entry)); + if (map->list == NULL) { + PyErr_NoMemory(); + return -1; + } + + for (i = 0; i < s->len; i++) { + be = &(map->list[i / 64]); + c = strbuf_read(s, i); + h = blockmap_hash(c); + k = blockmap_key(c); + + while (be->key[h] && be->key[h] != k) + h = blockmap_hash(h + 1); + be->key[h] = k; + be->val[h] |= (uint64_t) 1 << (i % 64); + } + return 0; +} + +static void blockmap_clear(struct blockmap *map) +{ + if (map->list) + free(map->list); + map->list = NULL; + map->nr = 0; +} + +static uint64_t blockmap_get(struct blockmap *map, int block, uint32_t c) +{ + struct blockmap_entry *be; + uint8_t h; + uint32_t k; + + h = blockmap_hash(c); + k = blockmap_key(c); + + be = &(map->list[block]); + while (be->key[h] && be->key[h] != k) + h = blockmap_hash(h + 1); + return be->key[h] == k ? be->val[h] : 0; +} + +/* + * Myers' bit-parallel algorithm + * + * See: G. Myers. "A fast bit-vector algorithm for approximate string + * matching based on dynamic programming." Journal of the ACM, 1999. + */ +static int64_t myers1999_block(struct strbuf *s1, struct strbuf *s2, + struct blockmap *map) +{ + uint64_t Eq, Xv, Xh, Ph, Mh, Pv, Mv, Last; + uint64_t *Mhc, *Phc; + int64_t i, b, hsize, vsize, Score; + uint8_t Pb, Mb; + + hsize = CDIV(s1->len, 64); + vsize = CDIV(s2->len, 64); + Score = s2->len; + + Phc = malloc(hsize * 2 * sizeof(uint64_t)); + if (Phc == NULL) { + PyErr_NoMemory(); + return -1; + } + Mhc = Phc + hsize; + memset(Phc, -1, hsize * sizeof(uint64_t)); + memset(Mhc, 0, hsize * sizeof(uint64_t)); + Last = (uint64_t)1 << ((s2->len - 1) % 64); + + for (b = 0; b < vsize; b++) { + Mv = 0; + Pv = (uint64_t) -1; + Score = s2->len; + + for (i = 0; i < s1->len; i++) { + Eq = blockmap_get(map, b, strbuf_read(s1, i)); + + Pb = BIT(Phc[i / 64], i % 64); + Mb = BIT(Mhc[i / 64], i % 64); + + Xv = Eq | Mv; + Xh = ((((Eq | Mb) & Pv) + Pv) ^ Pv) | Eq | Mb; + + Ph = Mv | ~ (Xh | Pv); + Mh = Pv & Xh; + + if (Ph & Last) Score++; + if (Mh & Last) Score--; + + if ((Ph >> 63) ^ Pb) + Phc[i / 64] = FLIP(Phc[i / 64], i % 64); + + if ((Mh >> 63) ^ Mb) + Mhc[i / 64] = FLIP(Mhc[i / 64], i % 64); + + Ph = (Ph << 1) | Pb; + Mh = (Mh << 1) | Mb; + + Pv = Mh | ~ (Xv | Ph); + Mv = Ph & Xv; + } + } + free(Phc); + return Score; +} + +static int64_t myers1999_simple(uint8_t *s1, int64_t len1, uint8_t *s2, int64_t len2) +{ + uint64_t Peq[256]; + uint64_t Eq, Xv, Xh, Ph, Mh, Pv, Mv, Last; + int64_t i; + int64_t Score = len2; + + memset(Peq, 0, sizeof(Peq)); + + for (i = 0; i < len2; i++) + Peq[s2[i]] |= (uint64_t) 1 << i; + + Mv = 0; + Pv = (uint64_t) -1; + Last = (uint64_t) 1 << (len2 - 1); + + for (i = 0; i < len1; i++) { + Eq = Peq[s1[i]]; + + Xv = Eq | Mv; + Xh = (((Eq & Pv) + Pv) ^ Pv) | Eq; + + Ph = Mv | ~ (Xh | Pv); + Mh = Pv & Xh; + + if (Ph & Last) Score++; + if (Mh & Last) Score--; + + Ph = (Ph << 1) | 1; + Mh = (Mh << 1); + + Pv = Mh | ~ (Xv | Ph); + Mv = Ph & Xv; + } + return Score; +} + +static int64_t myers1999(PyObject *o1, PyObject *o2) +{ + struct strbuf s1, s2; + struct blockmap map; + int64_t ret; + + strbuf_init(&s1, o1); + strbuf_init(&s2, o2); + + if (s1.len < s2.len) + return myers1999(o2, o1); + + if (ISASCII(s1.kind) && ISASCII(s2.kind) && s2.len < 65) + return myers1999_simple(s1.ptr, s1.len, s2.ptr, s2.len); + + if (blockmap_init(&map, &s2)) + return -1; + + ret = myers1999_block(&s1, &s2, &map); + blockmap_clear(&map); + return ret; +} + +/* + * Interface functions + */ +static int64_t polyleven(PyObject *o1, PyObject *o2, int64_t k) +{ + int64_t len1, len2; + + len1 = PyUnicode_GET_LENGTH(o1); + len2 = PyUnicode_GET_LENGTH(o2); + + if (len1 < len2) + return polyleven(o2, o1, k); + + if (k == 0) + return PyUnicode_Compare(o1, o2) ? 1 : 0; + + if (0 < k && k < len1 - len2) + return k + 1; + + if (len2 == 0) + return len1; + + if (0 < k && k < 4) + return mbleven(o1, o2, k); + + return myers1999(o1, o2); +} diff --git a/spacy/tests/matcher/test_levenshtein.py b/spacy/tests/matcher/test_levenshtein.py new file mode 100644 index 000000000..6c7793f63 --- /dev/null +++ b/spacy/tests/matcher/test_levenshtein.py @@ -0,0 +1,36 @@ +import pytest +from spacy.matcher import levenshtein + + +# empty string plus 10 random ASCII, 10 random unicode, and 2 random long tests +# from polyleven +@pytest.mark.parametrize( + "dist,a,b", + [ + (0, "", ""), + (4, "bbcb", "caba"), + (3, "abcb", "cacc"), + (3, "aa", "ccc"), + (1, "cca", "ccac"), + (1, "aba", "aa"), + (4, "bcbb", "abac"), + (3, "acbc", "bba"), + (3, "cbba", "a"), + (2, "bcc", "ba"), + (4, "aaa", "ccbb"), + (3, "うあい", "いいうい"), + (2, "あううい", "うあい"), + (3, "いういい", "うううあ"), + (2, "うい", "あいあ"), + (2, "いあい", "いう"), + (1, "いい", "あいい"), + (3, "あうあ", "いいああ"), + (4, "いあうう", "ううああ"), + (3, "いあいい", "ういああ"), + (3, "いいああ", "ううあう"), + (166,"TCTGGGCACGGATTCGTCAGATTCCATGTCCATATTTGAGGCTCTTGCAGGCAAAATTTGGGCATGTGAACTCCTTATAGTCCCCGTGC","ATATGGATTGGGGGCATTCAAAGATACGGTTTCCCTTTCTTCAGTTTCGCGCGGCGCACGTCCGGGTGCGAGCCAGTTCGTCTTACTCACATTGTCGACTTCACGAATCGCGCATGATGTGCTTAGCCTGTACTTACGAACGAACTTTCGGTCCAAATACATTCTATCAACACCGAGGTATCCGTGCCACACGCCGAAGCTCGACCGTGTTCGTTGAGAGGTGGAAATGGTAAAAGATGAACATAGTC"), + (111,"GGTTCGGCCGAATTCATAGAGCGTGGTAGTCGACGGTATCCCGCCTGGTAGGGGCCCCTTCTACCTAGCGGAAGTTTGTCAGTACTCTATAACACGAGGGCCTCTCACACCCTAGATCGTCCAGCCACTCGAAGATCGCAGCACCCTTACAGAAAGGCATTAATGTTTCTCCTAGCACTTGTGCAATGGTGAAGGAGTGATG","CGTAACACTTCGCGCTACTGGGCTGCAACGTCTTGGGCATACATGCAAGATTATCTAATGCAAGCTTGAGCCCCGCTTGCGGAATTTCCCTAATCGGGGTCCCTTCCTGTTACGATAAGGACGCGTGCACT"), + ], +) +def test_levenshtein(dist, a, b): + assert levenshtein(a, b) == dist From ca1ad67458d96562ab28d03892e926908cb583e1 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Thu, 15 Sep 2022 15:51:19 +0200 Subject: [PATCH 013/161] disable mypy run for Python 3.10 (#11508) --- .github/azure-steps.yml | 1 + 1 file changed, 1 insertion(+) diff --git a/.github/azure-steps.yml b/.github/azure-steps.yml index 18224ba8c..c7722391f 100644 --- a/.github/azure-steps.yml +++ b/.github/azure-steps.yml @@ -27,6 +27,7 @@ steps: - script: python -m mypy spacy displayName: 'Run mypy' + condition: ne(variables['python_version'], '3.10') - task: DeleteFiles@1 inputs: From 0509f908743afc86a185346ca6cb2e4789041732 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Thu, 15 Sep 2022 17:29:42 +0200 Subject: [PATCH 014/161] add dot (#11500) --- spacy/errors.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/errors.py b/spacy/errors.py index 5ee1476c2..f55b378e9 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -707,7 +707,7 @@ class Errors(metaclass=ErrorsWithCodes): "need to modify the pipeline, use the built-in methods like " "`nlp.add_pipe`, `nlp.remove_pipe`, `nlp.disable_pipe` or " "`nlp.enable_pipe` instead.") - E927 = ("Can't write to frozen list Maybe you're trying to modify a computed " + E927 = ("Can't write to frozen list. Maybe you're trying to modify a computed " "property or default function argument?") E928 = ("A KnowledgeBase can only be serialized to/from from a directory, " "but the provided argument {loc} points to a file.") From d5c8498f2f8c26fdfb1f18aafeeebbe94e6126bb Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Thu, 15 Sep 2022 17:41:25 +0200 Subject: [PATCH 015/161] disable mypy run for Python 3.10 (#11508) (#11511) --- .github/azure-steps.yml | 1 + 1 file changed, 1 insertion(+) diff --git a/.github/azure-steps.yml b/.github/azure-steps.yml index 18224ba8c..c7722391f 100644 --- a/.github/azure-steps.yml +++ b/.github/azure-steps.yml @@ -27,6 +27,7 @@ steps: - script: python -m mypy spacy displayName: 'Run mypy' + condition: ne(variables['python_version'], '3.10') - task: DeleteFiles@1 inputs: From df0b815c2382f572a127e4a35dba30cf1fa9fe45 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Fri, 16 Sep 2022 09:26:33 +0200 Subject: [PATCH 016/161] more explicit Example constructor example (#11489) * make constructor example for Example more explicit * shorten example and add spaces --- website/docs/api/example.md | 12 +++++++----- 1 file changed, 7 insertions(+), 5 deletions(-) diff --git a/website/docs/api/example.md b/website/docs/api/example.md index 0228e8935..63768d58f 100644 --- a/website/docs/api/example.md +++ b/website/docs/api/example.md @@ -23,11 +23,13 @@ both documents. > ```python > from spacy.tokens import Doc > from spacy.training import Example -> -> words = ["hello", "world", "!"] -> spaces = [True, False, False] -> predicted = Doc(nlp.vocab, words=words, spaces=spaces) -> reference = parse_gold_doc(my_data) +> pred_words = ["Apply", "some", "sunscreen"] +> pred_spaces = [True, True, False] +> gold_words = ["Apply", "some", "sun", "screen"] +> gold_spaces = [True, True, False, False] +> gold_tags = ["VERB", "DET", "NOUN", "NOUN"] +> predicted = Doc(nlp.vocab, words=pred_words, spaces=pred_spaces) +> reference = Doc(nlp.vocab, words=gold_words, spaces=gold_spaces, tags=gold_tags) > example = Example(predicted, reference) > ``` From 279358be63a6f32c49c2c89d4657a5239f238d9e Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 16 Sep 2022 11:50:19 +0200 Subject: [PATCH 017/161] Auto-format code with black (#11513) Co-authored-by: explosion-bot --- spacy/tests/matcher/test_levenshtein.py | 12 ++++++++++-- 1 file changed, 10 insertions(+), 2 deletions(-) diff --git a/spacy/tests/matcher/test_levenshtein.py b/spacy/tests/matcher/test_levenshtein.py index 6c7793f63..d30e36132 100644 --- a/spacy/tests/matcher/test_levenshtein.py +++ b/spacy/tests/matcher/test_levenshtein.py @@ -28,8 +28,16 @@ from spacy.matcher import levenshtein (4, "いあうう", "ううああ"), (3, "いあいい", "ういああ"), (3, "いいああ", "ううあう"), - (166,"TCTGGGCACGGATTCGTCAGATTCCATGTCCATATTTGAGGCTCTTGCAGGCAAAATTTGGGCATGTGAACTCCTTATAGTCCCCGTGC","ATATGGATTGGGGGCATTCAAAGATACGGTTTCCCTTTCTTCAGTTTCGCGCGGCGCACGTCCGGGTGCGAGCCAGTTCGTCTTACTCACATTGTCGACTTCACGAATCGCGCATGATGTGCTTAGCCTGTACTTACGAACGAACTTTCGGTCCAAATACATTCTATCAACACCGAGGTATCCGTGCCACACGCCGAAGCTCGACCGTGTTCGTTGAGAGGTGGAAATGGTAAAAGATGAACATAGTC"), - (111,"GGTTCGGCCGAATTCATAGAGCGTGGTAGTCGACGGTATCCCGCCTGGTAGGGGCCCCTTCTACCTAGCGGAAGTTTGTCAGTACTCTATAACACGAGGGCCTCTCACACCCTAGATCGTCCAGCCACTCGAAGATCGCAGCACCCTTACAGAAAGGCATTAATGTTTCTCCTAGCACTTGTGCAATGGTGAAGGAGTGATG","CGTAACACTTCGCGCTACTGGGCTGCAACGTCTTGGGCATACATGCAAGATTATCTAATGCAAGCTTGAGCCCCGCTTGCGGAATTTCCCTAATCGGGGTCCCTTCCTGTTACGATAAGGACGCGTGCACT"), + ( + 166, + "TCTGGGCACGGATTCGTCAGATTCCATGTCCATATTTGAGGCTCTTGCAGGCAAAATTTGGGCATGTGAACTCCTTATAGTCCCCGTGC", + "ATATGGATTGGGGGCATTCAAAGATACGGTTTCCCTTTCTTCAGTTTCGCGCGGCGCACGTCCGGGTGCGAGCCAGTTCGTCTTACTCACATTGTCGACTTCACGAATCGCGCATGATGTGCTTAGCCTGTACTTACGAACGAACTTTCGGTCCAAATACATTCTATCAACACCGAGGTATCCGTGCCACACGCCGAAGCTCGACCGTGTTCGTTGAGAGGTGGAAATGGTAAAAGATGAACATAGTC", + ), + ( + 111, + "GGTTCGGCCGAATTCATAGAGCGTGGTAGTCGACGGTATCCCGCCTGGTAGGGGCCCCTTCTACCTAGCGGAAGTTTGTCAGTACTCTATAACACGAGGGCCTCTCACACCCTAGATCGTCCAGCCACTCGAAGATCGCAGCACCCTTACAGAAAGGCATTAATGTTTCTCCTAGCACTTGTGCAATGGTGAAGGAGTGATG", + "CGTAACACTTCGCGCTACTGGGCTGCAACGTCTTGGGCATACATGCAAGATTATCTAATGCAAGCTTGAGCCCCGCTTGCGGAATTTCCCTAATCGGGGTCCCTTCCTGTTACGATAAGGACGCGTGCACT", + ), ], ) def test_levenshtein(dist, a, b): From af9b01ef97d934a8601aff46d8341fdaf78b88df Mon Sep 17 00:00:00 2001 From: Raphael Mitsch Date: Fri, 16 Sep 2022 16:54:31 +0200 Subject: [PATCH 018/161] Add dependency check to project step runs (#11226) * Add dependency check to project step running. * Fix dependency mismatch warning. * Remove newline. * Add types-setuptools to setup.cfg. * Move types-setuptools to test requirements. Move warnings into _validate_requirements(). Handle file reading in project_run(). * Remove newline formatting for output of package conflicts. * Show full version conflict message instead of just package name. * Update spacy/cli/project/run.py Co-authored-by: Adriane Boyd * Fix typo. * Re-add rephrasing of message for conflicting packages. Remove requirements path redundancy. * Update spacy/cli/project/run.py Co-authored-by: Adriane Boyd * Update spacy/cli/project/run.py Co-authored-by: Adriane Boyd * Print unified message for requirement conflicts and missing requirements. * Update spacy/cli/project/run.py Co-authored-by: Adriane Boyd * Fix warning message. * Print conflict/missing messages individually. * Print conflict/missing messages individually. * Add check_requirements setting in project.yml to disable requirements check. * Update website/docs/usage/projects.md Co-authored-by: Adriane Boyd * Update website/docs/usage/projects.md Co-authored-by: Adriane Boyd * Update description of project.yml structure in projects.md. * Update website/docs/usage/projects.md Co-authored-by: Sofie Van Landeghem * Prettify projects docs. Co-authored-by: Adriane Boyd Co-authored-by: Sofie Van Landeghem --- requirements.txt | 1 + spacy/cli/project/run.py | 40 +++++++++++++++++++++++++++++++++- website/docs/usage/projects.md | 35 ++++++++++++++++++----------- 3 files changed, 62 insertions(+), 14 deletions(-) diff --git a/requirements.txt b/requirements.txt index 3e8501b2f..e45fde787 100644 --- a/requirements.txt +++ b/requirements.txt @@ -33,6 +33,7 @@ hypothesis>=3.27.0,<7.0.0 mypy>=0.910,<0.970; platform_machine!='aarch64' types-dataclasses>=0.1.3; python_version < "3.7" types-mock>=0.1.1 +types-setuptools>=57.0.0 types-requests types-setuptools>=57.0.0 black>=22.0,<23.0 diff --git a/spacy/cli/project/run.py b/spacy/cli/project/run.py index d42d95465..ebab7471e 100644 --- a/spacy/cli/project/run.py +++ b/spacy/cli/project/run.py @@ -1,5 +1,8 @@ -from typing import Optional, List, Dict, Sequence, Any, Iterable +from typing import Optional, List, Dict, Sequence, Any, Iterable, Tuple +import os.path from pathlib import Path + +import pkg_resources from wasabi import msg from wasabi.util import locale_escape import sys @@ -71,6 +74,12 @@ def project_run( commands = {cmd["name"]: cmd for cmd in config.get("commands", [])} workflows = config.get("workflows", {}) validate_subcommand(list(commands.keys()), list(workflows.keys()), subcommand) + + req_path = project_dir / "requirements.txt" + if config.get("check_requirements", True) and os.path.exists(req_path): + with req_path.open() as requirements_file: + _check_requirements([req.replace("\n", "") for req in requirements_file]) + if subcommand in workflows: msg.info(f"Running workflow '{subcommand}'") for cmd in workflows[subcommand]: @@ -310,3 +319,32 @@ def get_fileinfo(project_dir: Path, paths: List[str]) -> List[Dict[str, Optional md5 = get_checksum(file_path) if file_path.exists() else None data.append({"path": path, "md5": md5}) return data + + +def _check_requirements(requirements: List[str]) -> Tuple[bool, bool]: + """Checks whether requirements are installed and free of version conflicts. + requirements (List[str]): List of requirements. + RETURNS (Tuple[bool, bool]): Whether (1) any packages couldn't be imported, (2) any packages with version conflicts + exist. + """ + + failed_pkgs_msgs: List[str] = [] + conflicting_pkgs_msgs: List[str] = [] + + for req in requirements: + try: + pkg_resources.require(req) + except pkg_resources.DistributionNotFound as dnf: + failed_pkgs_msgs.append(dnf.report()) + except pkg_resources.VersionConflict as vc: + conflicting_pkgs_msgs.append(vc.report()) + + if len(failed_pkgs_msgs) or len(conflicting_pkgs_msgs): + msg.warn( + title="Missing requirements or requirement conflicts detected. Make sure your Python environment is set up " + "correctly and you installed all requirements specified in your project's requirements.txt: " + ) + for pgk_msg in failed_pkgs_msgs + conflicting_pkgs_msgs: + msg.text(pgk_msg) + + return len(failed_pkgs_msgs) > 0, len(conflicting_pkgs_msgs) > 0 diff --git a/website/docs/usage/projects.md b/website/docs/usage/projects.md index 35150035a..4797bbfe3 100644 --- a/website/docs/usage/projects.md +++ b/website/docs/usage/projects.md @@ -148,6 +148,13 @@ skipped. You can also set `--force` to force re-running a command, or `--dry` to perform a "dry run" and see what would happen (without actually running the script). +Since spaCy v3.4.2, `spacy projects run` checks your installed dependencies to +verify that your environment is properly set up and aligns with the project's +`requirements.txt`, if there is one. If missing or conflicting dependencies are +detected, a corresponding warning is displayed. If you'd like to disable the +dependency check, set `check_requirements: false` in your project's +`project.yml`. + ### 4. Run a workflow {#run-workfow} > #### project.yml @@ -226,26 +233,28 @@ pipelines. ```yaml %%GITHUB_PROJECTS/pipelines/tagger_parser_ud/project.yml ``` + > #### Tip: Overriding variables on the CLI > -> If you want to override one or more variables on the CLI and are not already specifying a -> project directory, you need to add `.` as a placeholder: +> If you want to override one or more variables on the CLI and are not already +> specifying a project directory, you need to add `.` as a placeholder: > > ``` > python -m spacy project run test . --vars.foo bar > ``` -| Section | Description | -| --------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | -| `title` | An optional project title used in `--help` message and [auto-generated docs](#custom-docs). | -| `description` | An optional project description used in [auto-generated docs](#custom-docs). | -| `vars` | A dictionary of variables that can be referenced in paths, URLs and scripts and overriden on the CLI, just like [`config.cfg` variables](/usage/training#config-interpolation). For example, `${vars.name}` will use the value of the variable `name`. Variables need to be defined in the section `vars`, but can be a nested dict, so you're able to reference `${vars.model.name}`. | -| `env` | A dictionary of variables, mapped to the names of environment variables that will be read in when running the project. For example, `${env.name}` will use the value of the environment variable defined as `name`. | -| `directories` | An optional list of [directories](#project-files) that should be created in the project for assets, training outputs, metrics etc. spaCy will make sure that these directories always exist. | -| `assets` | A list of assets that can be fetched with the [`project assets`](/api/cli#project-assets) command. `url` defines a URL or local path, `dest` is the destination file relative to the project directory, and an optional `checksum` ensures that an error is raised if the file's checksum doesn't match. Instead of `url`, you can also provide a `git` block with the keys `repo`, `branch` and `path`, to download from a Git repo. | -| `workflows` | A dictionary of workflow names, mapped to a list of command names, to execute in order. Workflows can be run with the [`project run`](/api/cli#project-run) command. | -| `commands` | A list of named commands. A command can define an optional help message (shown in the CLI when the user adds `--help`) and the `script`, a list of commands to run. The `deps` and `outputs` let you define the created file the command depends on and produces, respectively. This lets spaCy determine whether a command needs to be re-run because its dependencies or outputs changed. Commands can be run as part of a workflow, or separately with the [`project run`](/api/cli#project-run) command. | -| `spacy_version` | Optional spaCy version range like `>=3.0.0,<3.1.0` that the project is compatible with. If it's loaded with an incompatible version, an error is raised when the project is loaded. | +| Section | Description | +| --------------------------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | +| `title` | An optional project title used in `--help` message and [auto-generated docs](#custom-docs). | +| `description` | An optional project description used in [auto-generated docs](#custom-docs). | +| `vars` | A dictionary of variables that can be referenced in paths, URLs and scripts and overriden on the CLI, just like [`config.cfg` variables](/usage/training#config-interpolation). For example, `${vars.name}` will use the value of the variable `name`. Variables need to be defined in the section `vars`, but can be a nested dict, so you're able to reference `${vars.model.name}`. | +| `env` | A dictionary of variables, mapped to the names of environment variables that will be read in when running the project. For example, `${env.name}` will use the value of the environment variable defined as `name`. | +| `directories` | An optional list of [directories](#project-files) that should be created in the project for assets, training outputs, metrics etc. spaCy will make sure that these directories always exist. | +| `assets` | A list of assets that can be fetched with the [`project assets`](/api/cli#project-assets) command. `url` defines a URL or local path, `dest` is the destination file relative to the project directory, and an optional `checksum` ensures that an error is raised if the file's checksum doesn't match. Instead of `url`, you can also provide a `git` block with the keys `repo`, `branch` and `path`, to download from a Git repo. | +| `workflows` | A dictionary of workflow names, mapped to a list of command names, to execute in order. Workflows can be run with the [`project run`](/api/cli#project-run) command. | +| `commands` | A list of named commands. A command can define an optional help message (shown in the CLI when the user adds `--help`) and the `script`, a list of commands to run. The `deps` and `outputs` let you define the created file the command depends on and produces, respectively. This lets spaCy determine whether a command needs to be re-run because its dependencies or outputs changed. Commands can be run as part of a workflow, or separately with the [`project run`](/api/cli#project-run) command. | +| `spacy_version` | Optional spaCy version range like `>=3.0.0,<3.1.0` that the project is compatible with. If it's loaded with an incompatible version, an error is raised when the project is loaded. | +| `check_requirements` 3.4.2 | A flag determining whether to verify that the installed dependencies align with the project's `requirements.txt`. Defaults to `true`. | ### Data assets {#data-assets} From f40d2fac29678111ec600eb7def9d58b174f14a2 Mon Sep 17 00:00:00 2001 From: Basile Dura Date: Fri, 23 Sep 2022 13:18:51 +0200 Subject: [PATCH 019/161] fix: remove duplicate v3.2 (#11530) --- website/meta/sidebars.json | 1 - 1 file changed, 1 deletion(-) diff --git a/website/meta/sidebars.json b/website/meta/sidebars.json index 1b743636c..06fce7742 100644 --- a/website/meta/sidebars.json +++ b/website/meta/sidebars.json @@ -12,7 +12,6 @@ { "text": "New in v3.0", "url": "/usage/v3" }, { "text": "New in v3.1", "url": "/usage/v3-1" }, { "text": "New in v3.2", "url": "/usage/v3-2" }, - { "text": "New in v3.2", "url": "/usage/v3-2" }, { "text": "New in v3.3", "url": "/usage/v3-3" }, { "text": "New in v3.4", "url": "/usage/v3-4" } ] From 6f692a06d54d53f702def1a2ca20a649b7a1b644 Mon Sep 17 00:00:00 2001 From: Richard Hudson Date: Mon, 26 Sep 2022 15:58:21 +0200 Subject: [PATCH 020/161] Remove side effects from Doc.__init__() (#11506) * Remove side effects from Doc.__init__() * Changes based on review comment * Readd test * Change interface of Doc.__init__() * Simplify test Co-authored-by: Adriane Boyd * Update doc.md Co-authored-by: Adriane Boyd --- spacy/tests/doc/test_doc_api.py | 15 +++++++++++++++ spacy/tokens/doc.pyi | 2 +- spacy/tokens/doc.pyx | 12 ++++++------ website/docs/api/doc.md | 30 +++++++++++++++--------------- 4 files changed, 37 insertions(+), 22 deletions(-) diff --git a/spacy/tests/doc/test_doc_api.py b/spacy/tests/doc/test_doc_api.py index a64ab2ba8..38003dea9 100644 --- a/spacy/tests/doc/test_doc_api.py +++ b/spacy/tests/doc/test_doc_api.py @@ -82,6 +82,21 @@ def test_issue2396(en_vocab): assert (span.get_lca_matrix() == matrix).all() +@pytest.mark.issue(11499) +def test_init_args_unmodified(en_vocab): + words = ["A", "sentence"] + ents = ["B-TYPE1", ""] + sent_starts = [True, False] + Doc( + vocab=en_vocab, + words=words, + ents=ents, + sent_starts=sent_starts, + ) + assert ents == ["B-TYPE1", ""] + assert sent_starts == [True, False] + + @pytest.mark.parametrize("text", ["-0.23", "+123,456", "±1"]) @pytest.mark.parametrize("lang_cls", [English, MultiLanguage]) @pytest.mark.issue(2782) diff --git a/spacy/tokens/doc.pyi b/spacy/tokens/doc.pyi index a40fa74aa..f0cdaee87 100644 --- a/spacy/tokens/doc.pyi +++ b/spacy/tokens/doc.pyi @@ -72,7 +72,7 @@ class Doc: lemmas: Optional[List[str]] = ..., heads: Optional[List[int]] = ..., deps: Optional[List[str]] = ..., - sent_starts: Optional[List[Union[bool, None]]] = ..., + sent_starts: Optional[List[Union[bool, int, None]]] = ..., ents: Optional[List[str]] = ..., ) -> None: ... @property diff --git a/spacy/tokens/doc.pyx b/spacy/tokens/doc.pyx index 7ba9a3341..d7d2fd8e6 100644 --- a/spacy/tokens/doc.pyx +++ b/spacy/tokens/doc.pyx @@ -217,9 +217,9 @@ cdef class Doc: head in the doc. Defaults to None. deps (Optional[List[str]]): A list of unicode strings, of the same length as words, to assign as token.dep. Defaults to None. - sent_starts (Optional[List[Union[bool, None]]]): A list of values, of - the same length as words, to assign as token.is_sent_start. Will be - overridden by heads if heads is provided. Defaults to None. + sent_starts (Optional[List[Union[bool, int, None]]]): A list of values, + of the same length as words, to assign as token.is_sent_start. Will + be overridden by heads if heads is provided. Defaults to None. ents (Optional[List[str]]): A list of unicode strings, of the same length as words, as IOB tags to assign as token.ent_iob and token.ent_type. Defaults to None. @@ -285,6 +285,7 @@ cdef class Doc: heads = [0] * len(deps) if heads and not deps: raise ValueError(Errors.E1017) + sent_starts = list(sent_starts) if sent_starts is not None else None if sent_starts is not None: for i in range(len(sent_starts)): if sent_starts[i] is True: @@ -300,12 +301,11 @@ cdef class Doc: ent_iobs = None ent_types = None if ents is not None: + ents = [ent if ent != "" else None for ent in ents] iob_strings = Token.iob_strings() # make valid IOB2 out of IOB1 or IOB2 for i, ent in enumerate(ents): - if ent is "": - ents[i] = None - elif ent is not None and not isinstance(ent, str): + if ent is not None and not isinstance(ent, str): raise ValueError(Errors.E177.format(tag=ent)) if i < len(ents) - 1: # OI -> OB diff --git a/website/docs/api/doc.md b/website/docs/api/doc.md index f97f4ad83..f97ed4547 100644 --- a/website/docs/api/doc.md +++ b/website/docs/api/doc.md @@ -31,21 +31,21 @@ Construct a `Doc` object. The most common way to get a `Doc` object is via the > doc = Doc(nlp.vocab, words=words, spaces=spaces) > ``` -| Name | Description | -| ---------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `vocab` | A storage container for lexical types. ~~Vocab~~ | -| `words` | A list of strings or integer hash values to add to the document as words. ~~Optional[List[Union[str,int]]]~~ | -| `spaces` | A list of boolean values indicating whether each word has a subsequent space. Must have the same length as `words`, if specified. Defaults to a sequence of `True`. ~~Optional[List[bool]]~~ | -| _keyword-only_ | | -| `user\_data` | Optional extra data to attach to the Doc. ~~Dict~~ | -| `tags` 3 | A list of strings, of the same length as `words`, to assign as `token.tag` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | -| `pos` 3 | A list of strings, of the same length as `words`, to assign as `token.pos` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | -| `morphs` 3 | A list of strings, of the same length as `words`, to assign as `token.morph` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | -| `lemmas` 3 | A list of strings, of the same length as `words`, to assign as `token.lemma` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | -| `heads` 3 | A list of values, of the same length as `words`, to assign as the head for each word. Head indices are the absolute position of the head in the `Doc`. Defaults to `None`. ~~Optional[List[int]]~~ | -| `deps` 3 | A list of strings, of the same length as `words`, to assign as `token.dep` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | -| `sent_starts` 3 | A list of values, of the same length as `words`, to assign as `token.is_sent_start`. Will be overridden by heads if `heads` is provided. Defaults to `None`. ~~Optional[List[Optional[bool]]]~~ | -| `ents` 3 | A list of strings, of the same length of `words`, to assign the token-based IOB tag. Defaults to `None`. ~~Optional[List[str]]~~ | +| Name | Description | +| ---------------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `vocab` | A storage container for lexical types. ~~Vocab~~ | +| `words` | A list of strings or integer hash values to add to the document as words. ~~Optional[List[Union[str,int]]]~~ | +| `spaces` | A list of boolean values indicating whether each word has a subsequent space. Must have the same length as `words`, if specified. Defaults to a sequence of `True`. ~~Optional[List[bool]]~~ | +| _keyword-only_ | | +| `user\_data` | Optional extra data to attach to the Doc. ~~Dict~~ | +| `tags` 3 | A list of strings, of the same length as `words`, to assign as `token.tag` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | +| `pos` 3 | A list of strings, of the same length as `words`, to assign as `token.pos` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | +| `morphs` 3 | A list of strings, of the same length as `words`, to assign as `token.morph` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | +| `lemmas` 3 | A list of strings, of the same length as `words`, to assign as `token.lemma` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | +| `heads` 3 | A list of values, of the same length as `words`, to assign as the head for each word. Head indices are the absolute position of the head in the `Doc`. Defaults to `None`. ~~Optional[List[int]]~~ | +| `deps` 3 | A list of strings, of the same length as `words`, to assign as `token.dep` for each word. Defaults to `None`. ~~Optional[List[str]]~~ | +| `sent_starts` 3 | A list of values, of the same length as `words`, to assign as `token.is_sent_start`. Will be overridden by heads if `heads` is provided. Defaults to `None`. ~~Optional[List[Union[bool, int, None]]]~~ | +| `ents` 3 | A list of strings, of the same length of `words`, to assign the token-based IOB tag. Defaults to `None`. ~~Optional[List[str]]~~ | ## Doc.\_\_getitem\_\_ {#getitem tag="method"} From 936a5f0506d5a117aeae000481560e1fc0031036 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Tue, 27 Sep 2022 15:25:24 +0900 Subject: [PATCH 021/161] Fix English pipeline names in 3.4 release notes (#11542) --- website/docs/usage/v3-4.md | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/website/docs/usage/v3-4.md b/website/docs/usage/v3-4.md index 7cc4570d5..597fc3cc8 100644 --- a/website/docs/usage/v3-4.md +++ b/website/docs/usage/v3-4.md @@ -65,10 +65,10 @@ The English CNN pipelines have new word vectors: | Package | Model Version | TAG | Parser LAS | NER F | | ----------------------------------------------- | ------------- | ---: | ---------: | ----: | -| [`en_core_news_md`](/models/en#en_core_news_md) | v3.3.0 | 97.3 | 90.1 | 84.6 | -| [`en_core_news_md`](/models/en#en_core_news_lg) | v3.4.0 | 97.2 | 90.3 | 85.5 | -| [`en_core_news_lg`](/models/en#en_core_news_md) | v3.3.0 | 97.4 | 90.1 | 85.3 | -| [`en_core_news_lg`](/models/en#en_core_news_lg) | v3.4.0 | 97.3 | 90.2 | 85.6 | +| [`en_core_web_md`](/models/en#en_core_web_md) | v3.3.0 | 97.3 | 90.1 | 84.6 | +| [`en_core_web_md`](/models/en#en_core_web_lg) | v3.4.0 | 97.2 | 90.3 | 85.5 | +| [`en_core_web_lg`](/models/en#en_core_web_md) | v3.3.0 | 97.4 | 90.1 | 85.3 | +| [`en_core_web_lg`](/models/en#en_core_web_lg) | v3.4.0 | 97.3 | 90.2 | 85.6 | ## Notes about upgrading from v3.3 {#upgrading} From 877671e09a0a72ca20ccbbcd65d7073f588cd320 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Tue, 27 Sep 2022 10:16:51 +0200 Subject: [PATCH 022/161] Preserve missing entity annotation in augmenters (#11540) Preserve both `-` and `O` annotation in augmenters rather than relying on `Example.to_dict`'s default support for one option outside of labeled entity spans. This is intended as a temporary workaround for augmenters for v3.4.x. The behavior of `Example` and related IOB utils could be improved in the general case for v3.5. --- spacy/tests/training/test_augmenters.py | 7 +++++-- spacy/training/augment.py | 14 +++++++++++++- spacy/training/iob_utils.py | 8 ++++++++ 3 files changed, 26 insertions(+), 3 deletions(-) diff --git a/spacy/tests/training/test_augmenters.py b/spacy/tests/training/test_augmenters.py index e3639c5da..35860a199 100644 --- a/spacy/tests/training/test_augmenters.py +++ b/spacy/tests/training/test_augmenters.py @@ -31,7 +31,7 @@ def doc(nlp): words = ["Sarah", "'s", "sister", "flew", "to", "Silicon", "Valley", "via", "London", "."] tags = ["NNP", "POS", "NN", "VBD", "IN", "NNP", "NNP", "IN", "NNP", "."] pos = ["PROPN", "PART", "NOUN", "VERB", "ADP", "PROPN", "PROPN", "ADP", "PROPN", "PUNCT"] - ents = ["B-PERSON", "I-PERSON", "O", "O", "O", "B-LOC", "I-LOC", "O", "B-GPE", "O"] + ents = ["B-PERSON", "I-PERSON", "O", "", "O", "B-LOC", "I-LOC", "O", "B-GPE", "O"] cats = {"TRAVEL": 1.0, "BAKING": 0.0} # fmt: on doc = Doc(nlp.vocab, words=words, tags=tags, pos=pos, ents=ents) @@ -106,6 +106,7 @@ def test_lowercase_augmenter(nlp, doc): assert [(e.start, e.end, e.label) for e in eg.reference.ents] == ents for ref_ent, orig_ent in zip(eg.reference.ents, doc.ents): assert ref_ent.text == orig_ent.text.lower() + assert [t.ent_iob for t in doc] == [t.ent_iob for t in eg.reference] assert [t.pos_ for t in eg.reference] == [t.pos_ for t in doc] # check that augmentation works when lowercasing leads to different @@ -166,7 +167,7 @@ def test_make_whitespace_variant(nlp): lemmas = ["they", "fly", "to", "New", "York", "City", ".", "\n", "then", "they", "drive", "to", "Washington", ",", "D.C."] heads = [1, 1, 1, 4, 5, 2, 1, 10, 10, 10, 10, 10, 11, 12, 12] deps = ["nsubj", "ROOT", "prep", "compound", "compound", "pobj", "punct", "dep", "advmod", "nsubj", "ROOT", "prep", "pobj", "punct", "appos"] - ents = ["O", "O", "O", "B-GPE", "I-GPE", "I-GPE", "O", "O", "O", "O", "O", "O", "B-GPE", "O", "B-GPE"] + ents = ["O", "", "O", "B-GPE", "I-GPE", "I-GPE", "O", "O", "O", "O", "O", "O", "B-GPE", "O", "B-GPE"] # fmt: on doc = Doc( nlp.vocab, @@ -215,6 +216,8 @@ def test_make_whitespace_variant(nlp): assert mod_ex2.reference[j].head.i == j - 1 # entities are well-formed assert len(doc.ents) == len(mod_ex.reference.ents) + # there is one token with missing entity information + assert any(t.ent_iob == 0 for t in mod_ex.reference) for ent in mod_ex.reference.ents: assert not ent[0].is_space assert not ent[-1].is_space diff --git a/spacy/training/augment.py b/spacy/training/augment.py index 55d780ba4..2fe8c24fb 100644 --- a/spacy/training/augment.py +++ b/spacy/training/augment.py @@ -6,7 +6,7 @@ from functools import partial from ..util import registry from .example import Example -from .iob_utils import split_bilu_label +from .iob_utils import split_bilu_label, _doc_to_biluo_tags_with_partial if TYPE_CHECKING: from ..language import Language # noqa: F401 @@ -62,6 +62,9 @@ def combined_augmenter( if orth_variants and random.random() < orth_level: raw_text = example.text orig_dict = example.to_dict() + orig_dict["doc_annotation"]["entities"] = _doc_to_biluo_tags_with_partial( + example.reference + ) variant_text, variant_token_annot = make_orth_variants( nlp, raw_text, @@ -128,6 +131,9 @@ def lower_casing_augmenter( def make_lowercase_variant(nlp: "Language", example: Example): example_dict = example.to_dict() + example_dict["doc_annotation"]["entities"] = _doc_to_biluo_tags_with_partial( + example.reference + ) doc = nlp.make_doc(example.text.lower()) example_dict["token_annotation"]["ORTH"] = [t.lower_ for t in example.reference] return example.from_dict(doc, example_dict) @@ -146,6 +152,9 @@ def orth_variants_augmenter( else: raw_text = example.text orig_dict = example.to_dict() + orig_dict["doc_annotation"]["entities"] = _doc_to_biluo_tags_with_partial( + example.reference + ) variant_text, variant_token_annot = make_orth_variants( nlp, raw_text, @@ -248,6 +257,9 @@ def make_whitespace_variant( RETURNS (Example): Example with one additional space token. """ example_dict = example.to_dict() + example_dict["doc_annotation"]["entities"] = _doc_to_biluo_tags_with_partial( + example.reference + ) doc_dict = example_dict.get("doc_annotation", {}) token_dict = example_dict.get("token_annotation", {}) # returned unmodified if: diff --git a/spacy/training/iob_utils.py b/spacy/training/iob_utils.py index 61f83a1c3..0d4d246b0 100644 --- a/spacy/training/iob_utils.py +++ b/spacy/training/iob_utils.py @@ -60,6 +60,14 @@ def doc_to_biluo_tags(doc: Doc, missing: str = "O"): ) +def _doc_to_biluo_tags_with_partial(doc: Doc) -> List[str]: + ents = doc_to_biluo_tags(doc, missing="-") + for i, token in enumerate(doc): + if token.ent_iob == 2: + ents[i] = "O" + return ents + + def offsets_to_biluo_tags( doc: Doc, entities: Iterable[Tuple[int, int, Union[str, int]]], missing: str = "O" ) -> List[str]: From a44b7d4622108a42ddb95b62b642df6f142a3450 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Tue, 27 Sep 2022 18:11:23 +0900 Subject: [PATCH 023/161] Add experimental coref docs (#11291) * Add experimental coref docs * Docs cleanup * Apply suggestions from code review Co-authored-by: Sofie Van Landeghem * Apply changes from code review * Fix prettier formatting It seems a period after a number made this think it was a list? * Update docs on examples for initialize * Add docs for coref scorers * Remove 3.4 notes from coref There won't be a "new" tag until it's in core. * Add docs for span cleaner * Fix docs * Fix docs to match spacy-experimental These weren't properly updated when the code was moved out of spacy core. * More doc fixes * Formatting * Update architectures * Fix links * Fix another link Co-authored-by: Sofie Van Landeghem Co-authored-by: svlandeg --- website/docs/api/architectures.md | 92 ++++++- website/docs/api/coref.md | 353 ++++++++++++++++++++++++ website/docs/api/pipeline-functions.md | 33 +++ website/docs/api/scorer.md | 59 ++++ website/docs/api/span-resolver.md | 356 +++++++++++++++++++++++++ website/meta/sidebars.json | 2 + 6 files changed, 889 insertions(+), 6 deletions(-) create mode 100644 website/docs/api/coref.md create mode 100644 website/docs/api/span-resolver.md diff --git a/website/docs/api/architectures.md b/website/docs/api/architectures.md index 2537faff6..4c5447f75 100644 --- a/website/docs/api/architectures.md +++ b/website/docs/api/architectures.md @@ -11,6 +11,7 @@ menu: - ['Text Classification', 'textcat'] - ['Span Classification', 'spancat'] - ['Entity Linking', 'entitylinker'] + - ['Coreference', 'coref-architectures'] --- A **model architecture** is a function that wires up a @@ -587,8 +588,8 @@ consists of either two or three subnetworks: run once for each batch. - **lower**: Construct a feature-specific vector for each `(token, feature)` pair. This is also run once for each batch. Constructing the state - representation is then a matter of summing the component features and - applying the non-linearity. + representation is then a matter of summing the component features and applying + the non-linearity. - **upper** (optional): A feed-forward network that predicts scores from the state representation. If not present, the output from the lower model is used as action scores directly. @@ -628,8 +629,8 @@ same signature, but the `use_upper` argument was `True` by default. > ``` Build a tagger model, using a provided token-to-vector component. The tagger -model adds a linear layer with softmax activation to predict scores given -the token vectors. +model adds a linear layer with softmax activation to predict scores given the +token vectors. | Name | Description | | ----------- | ------------------------------------------------------------------------------------------ | @@ -920,5 +921,84 @@ A function that reads an existing `KnowledgeBase` from file. A function that takes as input a [`KnowledgeBase`](/api/kb) and a [`Span`](/api/span) object denoting a named entity, and returns a list of plausible [`Candidate`](/api/kb/#candidate) objects. The default -`CandidateGenerator` uses the text of a mention to find its potential -aliases in the `KnowledgeBase`. Note that this function is case-dependent. +`CandidateGenerator` uses the text of a mention to find its potential aliases in +the `KnowledgeBase`. Note that this function is case-dependent. + +## Coreference {#coref-architectures tag="experimental"} + +A [`CoreferenceResolver`](/api/coref) component identifies tokens that refer to +the same entity. A [`SpanResolver`](/api/span-resolver) component infers spans +from single tokens. Together these components can be used to reproduce +traditional coreference models. You can also omit the `SpanResolver` if working +with only token-level clusters is acceptable. + +### spacy-experimental.Coref.v1 {#Coref tag="experimental"} + +> #### Example Config +> +> ```ini +> +> [model] +> @architectures = "spacy-experimental.Coref.v1" +> distance_embedding_size = 20 +> dropout = 0.3 +> hidden_size = 1024 +> depth = 2 +> antecedent_limit = 50 +> antecedent_batch_size = 512 +> +> [model.tok2vec] +> @architectures = "spacy-transformers.TransformerListener.v1" +> grad_factor = 1.0 +> upstream = "transformer" +> pooling = {"@layers":"reduce_mean.v1"} +> ``` + +The `Coref` model architecture is a Thinc `Model`. + +| Name | Description | +| ------------------------- | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `tok2vec` | The [`tok2vec`](#tok2vec) layer of the model. ~~Model~~ | +| `distance_embedding_size` | A representation of the distance between candidates. ~~int~~ | +| `dropout` | The dropout to use internally. Unlike some Thinc models, this has separate dropout for the internal PyTorch layers. ~~float~~ | +| `hidden_size` | Size of the main internal layers. ~~int~~ | +| `depth` | Depth of the internal network. ~~int~~ | +| `antecedent_limit` | How many candidate antecedents to keep after rough scoring. This has a significant effect on memory usage. Typical values would be 50 to 200, or higher for very long documents. ~~int~~ | +| `antecedent_batch_size` | Internal batch size. ~~int~~ | +| **CREATES** | The model using the architecture. ~~Model[List[Doc], Floats2d]~~ | + +### spacy-experimental.SpanResolver.v1 {#SpanResolver tag="experimental"} + +> #### Example Config +> +> ```ini +> +> [model] +> @architectures = "spacy-experimental.SpanResolver.v1" +> hidden_size = 1024 +> distance_embedding_size = 64 +> conv_channels = 4 +> window_size = 1 +> max_distance = 128 +> prefix = "coref_head_clusters" +> +> [model.tok2vec] +> @architectures = "spacy-transformers.TransformerListener.v1" +> grad_factor = 1.0 +> upstream = "transformer" +> pooling = {"@layers":"reduce_mean.v1"} +> ``` + +The `SpanResolver` model architecture is a Thinc `Model`. Note that +`MentionClusters` is `List[List[Tuple[int, int]]]`. + +| Name | Description | +| ------------------------- | -------------------------------------------------------------------------------------------------------------------- | +| `tok2vec` | The [`tok2vec`](#tok2vec) layer of the model. ~~Model~~ | +| `hidden_size` | Size of the main internal layers. ~~int~~ | +| `distance_embedding_size` | A representation of the distance between two candidates. ~~int~~ | +| `conv_channels` | The number of channels in the internal CNN. ~~int~~ | +| `window_size` | The number of neighboring tokens to consider in the internal CNN. `1` means consider one token on each side. ~~int~~ | +| `max_distance` | The longest possible length of a predicted span. ~~int~~ | +| `prefix` | The prefix that indicates spans to use for input data. ~~string~~ | +| **CREATES** | The model using the architecture. ~~Model[List[Doc], List[MentionClusters]]~~ | diff --git a/website/docs/api/coref.md b/website/docs/api/coref.md new file mode 100644 index 000000000..8f54422d6 --- /dev/null +++ b/website/docs/api/coref.md @@ -0,0 +1,353 @@ +--- +title: CoreferenceResolver +tag: class,experimental +source: spacy-experimental/coref/coref_component.py +teaser: 'Pipeline component for word-level coreference resolution' +api_base_class: /api/pipe +api_string_name: coref +api_trainable: true +--- + +> #### Installation +> +> ```bash +> $ pip install -U spacy-experimental +> ``` + + + +This component is not yet integrated into spaCy core, and is available via the +extension package +[`spacy-experimental`](https://github.com/explosion/spacy-experimental) starting +in version 0.6.0. It exposes the component via +[entry points](/usage/saving-loading/#entry-points), so if you have the package +installed, using `factory = "experimental_coref"` in your +[training config](/usage/training#config) or +`nlp.add_pipe("experimental_coref")` will work out-of-the-box. + + + +A `CoreferenceResolver` component groups tokens into clusters that refer to the +same thing. Clusters are represented as SpanGroups that start with a prefix +(`coref_clusters` by default). + +A `CoreferenceResolver` component can be paired with a +[`SpanResolver`](/api/span-resolver) to expand single tokens to spans. + +## Assigned Attributes {#assigned-attributes} + +Predictions will be saved to `Doc.spans` as a [`SpanGroup`](/api/spangroup). The +span key will be a prefix plus a serial number referring to the coreference +cluster, starting from zero. + +The span key prefix defaults to `"coref_clusters"`, but can be passed as a +parameter. + +| Location | Value | +| ------------------------------------------ | ------------------------------------------------------------------------------------------------------- | +| `Doc.spans[prefix + "_" + cluster_number]` | One coreference cluster, represented as single-token spans. Cluster numbers start from 1. ~~SpanGroup~~ | + +## Config and implementation {#config} + +The default config is defined by the pipeline component factory and describes +how the component should be configured. You can override its settings via the +`config` argument on [`nlp.add_pipe`](/api/language#add_pipe) or in your +[`config.cfg` for training](/usage/training#config). See the +[model architectures](/api/architectures#coref-architectures) documentation for +details on the architectures and their arguments and hyperparameters. + +> #### Example +> +> ```python +> from spacy_experimental.coref.coref_component import DEFAULT_COREF_MODEL +> from spacy_experimental.coref.coref_util import DEFAULT_CLUSTER_PREFIX +> config={ +> "model": DEFAULT_COREF_MODEL, +> "span_cluster_prefix": DEFAULT_CLUSTER_PREFIX, +> }, +> nlp.add_pipe("experimental_coref", config=config) +> ``` + +| Setting | Description | +| --------------------- | ---------------------------------------------------------------------------------------------------------------------------------------- | +| `model` | The [`Model`](https://thinc.ai/docs/api-model) powering the pipeline component. Defaults to [Coref](/api/architectures#Coref). ~~Model~~ | +| `span_cluster_prefix` | The prefix for the keys for clusters saved to `doc.spans`. Defaults to `coref_clusters`. ~~str~~ | + +## CoreferenceResolver.\_\_init\_\_ {#init tag="method"} + +> #### Example +> +> ```python +> # Construction via add_pipe with default model +> coref = nlp.add_pipe("experimental_coref") +> +> # Construction via add_pipe with custom model +> config = {"model": {"@architectures": "my_coref.v1"}} +> coref = nlp.add_pipe("experimental_coref", config=config) +> +> # Construction from class +> from spacy_experimental.coref.coref_component import CoreferenceResolver +> coref = CoreferenceResolver(nlp.vocab, model) +> ``` + +Create a new pipeline instance. In your application, you would normally use a +shortcut for this and instantiate the component using its string name and +[`nlp.add_pipe`](/api/language#add_pipe). + +| Name | Description | +| --------------------- | --------------------------------------------------------------------------------------------------- | +| `vocab` | The shared vocabulary. ~~Vocab~~ | +| `model` | The [`Model`](https://thinc.ai/docs/api-model) powering the pipeline component. ~~Model~~ | +| `name` | String name of the component instance. Used to add entries to the `losses` during training. ~~str~~ | +| _keyword-only_ | | +| `span_cluster_prefix` | The prefix for the key for saving clusters of spans. ~~bool~~ | + +## CoreferenceResolver.\_\_call\_\_ {#call tag="method"} + +Apply the pipe to one document. The document is modified in place and returned. +This usually happens under the hood when the `nlp` object is called on a text +and all pipeline components are applied to the `Doc` in order. Both +[`__call__`](/api/coref#call) and [`pipe`](/api/coref#pipe) delegate to the +[`predict`](/api/coref#predict) and +[`set_annotations`](/api/coref#set_annotations) methods. + +> #### Example +> +> ```python +> doc = nlp("This is a sentence.") +> coref = nlp.add_pipe("experimental_coref") +> # This usually happens under the hood +> processed = coref(doc) +> ``` + +| Name | Description | +| ----------- | -------------------------------- | +| `doc` | The document to process. ~~Doc~~ | +| **RETURNS** | The processed document. ~~Doc~~ | + +## CoreferenceResolver.pipe {#pipe tag="method"} + +Apply the pipe to a stream of documents. This usually happens under the hood +when the `nlp` object is called on a text and all pipeline components are +applied to the `Doc` in order. Both [`__call__`](/api/coref#call) and +[`pipe`](/api/coref#pipe) delegate to the [`predict`](/api/coref#predict) and +[`set_annotations`](/api/coref#set_annotations) methods. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> for doc in coref.pipe(docs, batch_size=50): +> pass +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------- | +| `stream` | A stream of documents. ~~Iterable[Doc]~~ | +| _keyword-only_ | | +| `batch_size` | The number of documents to buffer. Defaults to `128`. ~~int~~ | +| **YIELDS** | The processed documents in order. ~~Doc~~ | + +## CoreferenceResolver.initialize {#initialize tag="method"} + +Initialize the component for training. `get_examples` should be a function that +returns an iterable of [`Example`](/api/example) objects. **At least one example +should be supplied.** The data examples are used to **initialize the model** of +the component and can either be the full training data or a representative +sample. Initialization includes validating the network, +[inferring missing shapes](https://thinc.ai/docs/usage-models#validation) and +setting up the label scheme based on the data. This method is typically called +by [`Language.initialize`](/api/language#initialize). + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> coref.initialize(lambda: examples, nlp=nlp) +> ``` + +| Name | Description | +| -------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `get_examples` | Function that returns gold-standard annotations in the form of [`Example`](/api/example) objects. Must contain at least one `Example`. ~~Callable[[], Iterable[Example]]~~ | +| _keyword-only_ | | +| `nlp` | The current `nlp` object. Defaults to `None`. ~~Optional[Language]~~ | + +## CoreferenceResolver.predict {#predict tag="method"} + +Apply the component's model to a batch of [`Doc`](/api/doc) objects, without +modifying them. Clusters are returned as a list of `MentionClusters`, one for +each input `Doc`. A `MentionClusters` instance is just a list of lists of pairs +of `int`s, where each item corresponds to a cluster, and the `int`s correspond +to token indices. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> clusters = coref.predict([doc1, doc2]) +> ``` + +| Name | Description | +| ----------- | ---------------------------------------------------------------------------- | +| `docs` | The documents to predict. ~~Iterable[Doc]~~ | +| **RETURNS** | The predicted coreference clusters for the `docs`. ~~List[MentionClusters]~~ | + +## CoreferenceResolver.set_annotations {#set_annotations tag="method"} + +Modify a batch of documents, saving coreference clusters in `Doc.spans`. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> clusters = coref.predict([doc1, doc2]) +> coref.set_annotations([doc1, doc2], clusters) +> ``` + +| Name | Description | +| ---------- | ---------------------------------------------------------------------------- | +| `docs` | The documents to modify. ~~Iterable[Doc]~~ | +| `clusters` | The predicted coreference clusters for the `docs`. ~~List[MentionClusters]~~ | + +## CoreferenceResolver.update {#update tag="method"} + +Learn from a batch of [`Example`](/api/example) objects. Delegates to +[`predict`](/api/coref#predict). + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> optimizer = nlp.initialize() +> losses = coref.update(examples, sgd=optimizer) +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------------------------------------ | +| `examples` | A batch of [`Example`](/api/example) objects to learn from. ~~Iterable[Example]~~ | +| _keyword-only_ | | +| `drop` | The dropout rate. ~~float~~ | +| `sgd` | An optimizer. Will be created via [`create_optimizer`](#create_optimizer) if not set. ~~Optional[Optimizer]~~ | +| `losses` | Optional record of the loss during training. Updated using the component name as the key. ~~Optional[Dict[str, float]]~~ | +| **RETURNS** | The updated `losses` dictionary. ~~Dict[str, float]~~ | + +## CoreferenceResolver.create_optimizer {#create_optimizer tag="method"} + +Create an optimizer for the pipeline component. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> optimizer = coref.create_optimizer() +> ``` + +| Name | Description | +| ----------- | ---------------------------- | +| **RETURNS** | The optimizer. ~~Optimizer~~ | + +## CoreferenceResolver.use_params {#use_params tag="method, contextmanager"} + +Modify the pipe's model, to use the given parameter values. At the end of the +context, the original parameters are restored. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> with coref.use_params(optimizer.averages): +> coref.to_disk("/best_model") +> ``` + +| Name | Description | +| -------- | -------------------------------------------------- | +| `params` | The parameter values to use in the model. ~~dict~~ | + +## CoreferenceResolver.to_disk {#to_disk tag="method"} + +Serialize the pipe to disk. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> coref.to_disk("/path/to/coref") +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------------------------------------------------------ | +| `path` | A path to a directory, which will be created if it doesn't exist. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | + +## CoreferenceResolver.from_disk {#from_disk tag="method"} + +Load the pipe from disk. Modifies the object in place and returns it. + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> coref.from_disk("/path/to/coref") +> ``` + +| Name | Description | +| -------------- | ----------------------------------------------------------------------------------------------- | +| `path` | A path to a directory. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | +| **RETURNS** | The modified `CoreferenceResolver` object. ~~CoreferenceResolver~~ | + +## CoreferenceResolver.to_bytes {#to_bytes tag="method"} + +> #### Example +> +> ```python +> coref = nlp.add_pipe("experimental_coref") +> coref_bytes = coref.to_bytes() +> ``` + +Serialize the pipe to a bytestring, including the `KnowledgeBase`. + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------- | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | +| **RETURNS** | The serialized form of the `CoreferenceResolver` object. ~~bytes~~ | + +## CoreferenceResolver.from_bytes {#from_bytes tag="method"} + +Load the pipe from a bytestring. Modifies the object in place and returns it. + +> #### Example +> +> ```python +> coref_bytes = coref.to_bytes() +> coref = nlp.add_pipe("experimental_coref") +> coref.from_bytes(coref_bytes) +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------- | +| `bytes_data` | The data to load from. ~~bytes~~ | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | +| **RETURNS** | The `CoreferenceResolver` object. ~~CoreferenceResolver~~ | + +## Serialization fields {#serialization-fields} + +During serialization, spaCy will export several data fields used to restore +different aspects of the object. If needed, you can exclude them from +serialization by passing in the string names via the `exclude` argument. + +> #### Example +> +> ```python +> data = coref.to_disk("/path", exclude=["vocab"]) +> ``` + +| Name | Description | +| ------- | -------------------------------------------------------------- | +| `vocab` | The shared [`Vocab`](/api/vocab). | +| `cfg` | The config file. You usually don't want to exclude this. | +| `model` | The binary model data. You usually don't want to exclude this. | diff --git a/website/docs/api/pipeline-functions.md b/website/docs/api/pipeline-functions.md index 1b7017ca7..070292782 100644 --- a/website/docs/api/pipeline-functions.md +++ b/website/docs/api/pipeline-functions.md @@ -153,3 +153,36 @@ whole pipeline has run. | `attrs` | A dict of the `Doc` attributes and the values to set them to. Defaults to `{"tensor": None, "_.trf_data": None}` to clean up after `tok2vec` and `transformer` components. ~~dict~~ | | `silent` | If `False`, show warnings if attributes aren't found or can't be set. Defaults to `True`. ~~bool~~ | | **RETURNS** | The modified `Doc` with the modified attributes. ~~Doc~~ | + +## span_cleaner {#span_cleaner tag="function,experimental"} + +Remove `SpanGroup`s from `doc.spans` based on a key prefix. This is used to +clean up after the [`CoreferenceResolver`](/api/coref) when it's paired with a +[`SpanResolver`](/api/span-resolver). + + + +This pipeline function is not yet integrated into spaCy core, and is available +via the extension package +[`spacy-experimental`](https://github.com/explosion/spacy-experimental) starting +in version 0.6.0. It exposes the component via +[entry points](/usage/saving-loading/#entry-points), so if you have the package +installed, using `factory = "span_cleaner"` in your +[training config](/usage/training#config) or `nlp.add_pipe("span_cleaner")` will +work out-of-the-box. + + + +> #### Example +> +> ```python +> config = {"prefix": "coref_head_clusters"} +> nlp.add_pipe("span_cleaner", config=config) +> doc = nlp("text") +> assert "coref_head_clusters_1" not in doc.spans +> ``` + +| Setting | Description | +| ----------- | ------------------------------------------------------------------------------------------------------------------------- | +| `prefix` | A prefix to check `SpanGroup` keys for. Any matching groups will be removed. Defaults to `"coref_head_clusters"`. ~~str~~ | +| **RETURNS** | The modified `Doc` with any matching spans removed. ~~Doc~~ | diff --git a/website/docs/api/scorer.md b/website/docs/api/scorer.md index 8dbe3b276..ca3462aa9 100644 --- a/website/docs/api/scorer.md +++ b/website/docs/api/scorer.md @@ -270,3 +270,62 @@ Compute micro-PRF and per-entity PRF scores. | Name | Description | | ---------- | ------------------------------------------------------------------------------------------------------------------- | | `examples` | The `Example` objects holding both the predictions and the correct gold-standard annotations. ~~Iterable[Example]~~ | + +## score_coref_clusters {#score_coref_clusters tag="experimental"} + +Returns LEA ([Moosavi and Strube, 2016](https://aclanthology.org/P16-1060/)) PRF +scores for coreference clusters. + + + +Note this scoring function is not yet included in spaCy core - for details, see +the [CoreferenceResolver](/api/coref) docs. + + + +> #### Example +> +> ```python +> scores = score_coref_clusters( +> examples, +> span_cluster_prefix="coref_clusters", +> ) +> print(scores["coref_f"]) +> ``` + +| Name | Description | +| --------------------- | ------------------------------------------------------------------------------------------------------------------- | +| `examples` | The `Example` objects holding both the predictions and the correct gold-standard annotations. ~~Iterable[Example]~~ | +| _keyword-only_ | | +| `span_cluster_prefix` | The prefix used for spans representing coreference clusters. ~~str~~ | +| **RETURNS** | A dictionary containing the scores. ~~Dict[str, Optional[float]]~~ | + +## score_span_predictions {#score_span_predictions tag="experimental"} + +Return accuracy for reconstructions of spans from single tokens. Only exactly +correct predictions are counted as correct, there is no partial credit for near +answers. Used by the [SpanResolver](/api/span-resolver). + + + +Note this scoring function is not yet included in spaCy core - for details, see +the [SpanResolver](/api/span-resolver) docs. + + + +> #### Example +> +> ```python +> scores = score_span_predictions( +> examples, +> output_prefix="coref_clusters", +> ) +> print(scores["span_coref_clusters_accuracy"]) +> ``` + +| Name | Description | +| --------------- | ------------------------------------------------------------------------------------------------------------------- | +| `examples` | The `Example` objects holding both the predictions and the correct gold-standard annotations. ~~Iterable[Example]~~ | +| _keyword-only_ | | +| `output_prefix` | The prefix used for spans representing the final predicted spans. ~~str~~ | +| **RETURNS** | A dictionary containing the scores. ~~Dict[str, Optional[float]]~~ | diff --git a/website/docs/api/span-resolver.md b/website/docs/api/span-resolver.md new file mode 100644 index 000000000..3e992cd03 --- /dev/null +++ b/website/docs/api/span-resolver.md @@ -0,0 +1,356 @@ +--- +title: SpanResolver +tag: class,experimental +source: spacy-experimental/coref/span_resolver_component.py +teaser: 'Pipeline component for resolving tokens into spans' +api_base_class: /api/pipe +api_string_name: span_resolver +api_trainable: true +--- + +> #### Installation +> +> ```bash +> $ pip install -U spacy-experimental +> ``` + + + +This component not yet integrated into spaCy core, and is available via the +extension package +[`spacy-experimental`](https://github.com/explosion/spacy-experimental) starting +in version 0.6.0. It exposes the component via +[entry points](/usage/saving-loading/#entry-points), so if you have the package +installed, using `factory = "experimental_span_resolver"` in your +[training config](/usage/training#config) or +`nlp.add_pipe("experimental_span_resolver")` will work out-of-the-box. + + + +A `SpanResolver` component takes in tokens (represented as `Span` objects of +length 1) and resolves them into `Span` objects of arbitrary length. The initial +use case is as a post-processing step on word-level +[coreference resolution](/api/coref). The input and output keys used to store +`Span` objects are configurable. + +## Assigned Attributes {#assigned-attributes} + +Predictions will be saved to `Doc.spans` as [`SpanGroup`s](/api/spangroup). + +Input token spans will be read in using an input prefix, by default +`"coref_head_clusters"`, and output spans will be saved using an output prefix +(default `"coref_clusters"`) plus a serial number starting from one. The +prefixes are configurable. + +| Location | Value | +| ------------------------------------------------- | ------------------------------------------------------------------------- | +| `Doc.spans[output_prefix + "_" + cluster_number]` | One group of predicted spans. Cluster number starts from 1. ~~SpanGroup~~ | + +## Config and implementation {#config} + +The default config is defined by the pipeline component factory and describes +how the component should be configured. You can override its settings via the +`config` argument on [`nlp.add_pipe`](/api/language#add_pipe) or in your +[`config.cfg` for training](/usage/training#config). See the +[model architectures](/api/architectures#coref-architectures) documentation for +details on the architectures and their arguments and hyperparameters. + +> #### Example +> +> ```python +> from spacy_experimental.coref.span_resolver_component import DEFAULT_SPAN_RESOLVER_MODEL +> from spacy_experimental.coref.coref_util import DEFAULT_CLUSTER_PREFIX, DEFAULT_CLUSTER_HEAD_PREFIX +> config={ +> "model": DEFAULT_SPAN_RESOLVER_MODEL, +> "input_prefix": DEFAULT_CLUSTER_HEAD_PREFIX, +> "output_prefix": DEFAULT_CLUSTER_PREFIX, +> }, +> nlp.add_pipe("experimental_span_resolver", config=config) +> ``` + +| Setting | Description | +| --------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------ | +| `model` | The [`Model`](https://thinc.ai/docs/api-model) powering the pipeline component. Defaults to [SpanResolver](/api/architectures#SpanResolver). ~~Model~~ | +| `input_prefix` | The prefix to use for input `SpanGroup`s. Defaults to `coref_head_clusters`. ~~str~~ | +| `output_prefix` | The prefix for predicted `SpanGroup`s. Defaults to `coref_clusters`. ~~str~~ | + +## SpanResolver.\_\_init\_\_ {#init tag="method"} + +> #### Example +> +> ```python +> # Construction via add_pipe with default model +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> +> # Construction via add_pipe with custom model +> config = {"model": {"@architectures": "my_span_resolver.v1"}} +> span_resolver = nlp.add_pipe("experimental_span_resolver", config=config) +> +> # Construction from class +> from spacy_experimental.coref.span_resolver_component import SpanResolver +> span_resolver = SpanResolver(nlp.vocab, model) +> ``` + +Create a new pipeline instance. In your application, you would normally use a +shortcut for this and instantiate the component using its string name and +[`nlp.add_pipe`](/api/language#add_pipe). + +| Name | Description | +| --------------- | --------------------------------------------------------------------------------------------------- | +| `vocab` | The shared vocabulary. ~~Vocab~~ | +| `model` | The [`Model`](https://thinc.ai/docs/api-model) powering the pipeline component. ~~Model~~ | +| `name` | String name of the component instance. Used to add entries to the `losses` during training. ~~str~~ | +| _keyword-only_ | | +| `input_prefix` | The prefix to use for input `SpanGroup`s. Defaults to `coref_head_clusters`. ~~str~~ | +| `output_prefix` | The prefix for predicted `SpanGroup`s. Defaults to `coref_clusters`. ~~str~~ | + +## SpanResolver.\_\_call\_\_ {#call tag="method"} + +Apply the pipe to one document. The document is modified in place and returned. +This usually happens under the hood when the `nlp` object is called on a text +and all pipeline components are applied to the `Doc` in order. Both +[`__call__`](#call) and [`pipe`](#pipe) delegate to the [`predict`](#predict) +and [`set_annotations`](#set_annotations) methods. + +> #### Example +> +> ```python +> doc = nlp("This is a sentence.") +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> # This usually happens under the hood +> processed = span_resolver(doc) +> ``` + +| Name | Description | +| ----------- | -------------------------------- | +| `doc` | The document to process. ~~Doc~~ | +| **RETURNS** | The processed document. ~~Doc~~ | + +## SpanResolver.pipe {#pipe tag="method"} + +Apply the pipe to a stream of documents. This usually happens under the hood +when the `nlp` object is called on a text and all pipeline components are +applied to the `Doc` in order. Both [`__call__`](/api/span-resolver#call) and +[`pipe`](/api/span-resolver#pipe) delegate to the +[`predict`](/api/span-resolver#predict) and +[`set_annotations`](/api/span-resolver#set_annotations) methods. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> for doc in span_resolver.pipe(docs, batch_size=50): +> pass +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------- | +| `stream` | A stream of documents. ~~Iterable[Doc]~~ | +| _keyword-only_ | | +| `batch_size` | The number of documents to buffer. Defaults to `128`. ~~int~~ | +| **YIELDS** | The processed documents in order. ~~Doc~~ | + +## SpanResolver.initialize {#initialize tag="method"} + +Initialize the component for training. `get_examples` should be a function that +returns an iterable of [`Example`](/api/example) objects. **At least one example +should be supplied.** The data examples are used to **initialize the model** of +the component and can either be the full training data or a representative +sample. Initialization includes validating the network, +[inferring missing shapes](https://thinc.ai/docs/usage-models#validation) and +setting up the label scheme based on the data. This method is typically called +by [`Language.initialize`](/api/language#initialize). + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> span_resolver.initialize(lambda: examples, nlp=nlp) +> ``` + +| Name | Description | +| -------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `get_examples` | Function that returns gold-standard annotations in the form of [`Example`](/api/example) objects. Must contain at least one `Example`. ~~Callable[[], Iterable[Example]]~~ | +| _keyword-only_ | | +| `nlp` | The current `nlp` object. Defaults to `None`. ~~Optional[Language]~~ | + +## SpanResolver.predict {#predict tag="method"} + +Apply the component's model to a batch of [`Doc`](/api/doc) objects, without +modifying them. Predictions are returned as a list of `MentionClusters`, one for +each input `Doc`. A `MentionClusters` instance is just a list of lists of pairs +of `int`s, where each item corresponds to an input `SpanGroup`, and the `int`s +correspond to token indices. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> spans = span_resolver.predict([doc1, doc2]) +> ``` + +| Name | Description | +| ----------- | ------------------------------------------------------------- | +| `docs` | The documents to predict. ~~Iterable[Doc]~~ | +| **RETURNS** | The predicted spans for the `Doc`s. ~~List[MentionClusters]~~ | + +## SpanResolver.set_annotations {#set_annotations tag="method"} + +Modify a batch of documents, saving predictions using the output prefix in +`Doc.spans`. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> spans = span_resolver.predict([doc1, doc2]) +> span_resolver.set_annotations([doc1, doc2], spans) +> ``` + +| Name | Description | +| ------- | ------------------------------------------------------------- | +| `docs` | The documents to modify. ~~Iterable[Doc]~~ | +| `spans` | The predicted spans for the `docs`. ~~List[MentionClusters]~~ | + +## SpanResolver.update {#update tag="method"} + +Learn from a batch of [`Example`](/api/example) objects. Delegates to +[`predict`](/api/span-resolver#predict). + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> optimizer = nlp.initialize() +> losses = span_resolver.update(examples, sgd=optimizer) +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------------------------------------ | +| `examples` | A batch of [`Example`](/api/example) objects to learn from. ~~Iterable[Example]~~ | +| _keyword-only_ | | +| `drop` | The dropout rate. ~~float~~ | +| `sgd` | An optimizer. Will be created via [`create_optimizer`](#create_optimizer) if not set. ~~Optional[Optimizer]~~ | +| `losses` | Optional record of the loss during training. Updated using the component name as the key. ~~Optional[Dict[str, float]]~~ | +| **RETURNS** | The updated `losses` dictionary. ~~Dict[str, float]~~ | + +## SpanResolver.create_optimizer {#create_optimizer tag="method"} + +Create an optimizer for the pipeline component. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> optimizer = span_resolver.create_optimizer() +> ``` + +| Name | Description | +| ----------- | ---------------------------- | +| **RETURNS** | The optimizer. ~~Optimizer~~ | + +## SpanResolver.use_params {#use_params tag="method, contextmanager"} + +Modify the pipe's model, to use the given parameter values. At the end of the +context, the original parameters are restored. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> with span_resolver.use_params(optimizer.averages): +> span_resolver.to_disk("/best_model") +> ``` + +| Name | Description | +| -------- | -------------------------------------------------- | +| `params` | The parameter values to use in the model. ~~dict~~ | + +## SpanResolver.to_disk {#to_disk tag="method"} + +Serialize the pipe to disk. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> span_resolver.to_disk("/path/to/span_resolver") +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------------------------------------------------------ | +| `path` | A path to a directory, which will be created if it doesn't exist. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | + +## SpanResolver.from_disk {#from_disk tag="method"} + +Load the pipe from disk. Modifies the object in place and returns it. + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> span_resolver.from_disk("/path/to/span_resolver") +> ``` + +| Name | Description | +| -------------- | ----------------------------------------------------------------------------------------------- | +| `path` | A path to a directory. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | +| **RETURNS** | The modified `SpanResolver` object. ~~SpanResolver~~ | + +## SpanResolver.to_bytes {#to_bytes tag="method"} + +> #### Example +> +> ```python +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> span_resolver_bytes = span_resolver.to_bytes() +> ``` + +Serialize the pipe to a bytestring. + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------- | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | +| **RETURNS** | The serialized form of the `SpanResolver` object. ~~bytes~~ | + +## SpanResolver.from_bytes {#from_bytes tag="method"} + +Load the pipe from a bytestring. Modifies the object in place and returns it. + +> #### Example +> +> ```python +> span_resolver_bytes = span_resolver.to_bytes() +> span_resolver = nlp.add_pipe("experimental_span_resolver") +> span_resolver.from_bytes(span_resolver_bytes) +> ``` + +| Name | Description | +| -------------- | ------------------------------------------------------------------------------------------- | +| `bytes_data` | The data to load from. ~~bytes~~ | +| _keyword-only_ | | +| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ | +| **RETURNS** | The `SpanResolver` object. ~~SpanResolver~~ | + +## Serialization fields {#serialization-fields} + +During serialization, spaCy will export several data fields used to restore +different aspects of the object. If needed, you can exclude them from +serialization by passing in the string names via the `exclude` argument. + +> #### Example +> +> ```python +> data = span_resolver.to_disk("/path", exclude=["vocab"]) +> ``` + +| Name | Description | +| ------- | -------------------------------------------------------------- | +| `vocab` | The shared [`Vocab`](/api/vocab). | +| `cfg` | The config file. You usually don't want to exclude this. | +| `model` | The binary model data. You usually don't want to exclude this. | diff --git a/website/meta/sidebars.json b/website/meta/sidebars.json index 06fce7742..2d8745d77 100644 --- a/website/meta/sidebars.json +++ b/website/meta/sidebars.json @@ -94,6 +94,7 @@ "label": "Pipeline", "items": [ { "text": "AttributeRuler", "url": "/api/attributeruler" }, + { "text": "CoreferenceResolver", "url": "/api/coref" }, { "text": "DependencyParser", "url": "/api/dependencyparser" }, { "text": "EditTreeLemmatizer", "url": "/api/edittreelemmatizer" }, { "text": "EntityLinker", "url": "/api/entitylinker" }, @@ -104,6 +105,7 @@ { "text": "SentenceRecognizer", "url": "/api/sentencerecognizer" }, { "text": "Sentencizer", "url": "/api/sentencizer" }, { "text": "SpanCategorizer", "url": "/api/spancategorizer" }, + { "text": "SpanResolver", "url": "/api/span-resolver" }, { "text": "SpanRuler", "url": "/api/spanruler" }, { "text": "Tagger", "url": "/api/tagger" }, { "text": "TextCategorizer", "url": "/api/textcategorizer" }, From 3e8bc1272f95c89e0aa9e5a19f51e286a7934ffa Mon Sep 17 00:00:00 2001 From: Jacobo Myerston <43222279+jmyerston@users.noreply.github.com> Date: Tue, 27 Sep 2022 02:38:56 -0700 Subject: [PATCH 024/161] add punctuation to grc (#11426) * add punctuation to grc Add support for special editorial punctuation that is common in ancient Greek texts. Ancient Greek texts, as found in digital and print form, have been largely edited by scholars. Restorations and improvements are normally marked with special characters that need to be handled properly by the tokenizer. * add unit tests * simplify regex * move generic quotes to char classes * rename unit test * fix regex Co-authored-by: Adriane Boyd Co-authored-by: svlandeg Co-authored-by: Sofie Van Landeghem Co-authored-by: Adriane Boyd --- spacy/lang/char_classes.py | 2 +- spacy/lang/grc/__init__.py | 4 +++ spacy/lang/grc/punctuation.py | 46 ++++++++++++++++++++++++++ spacy/tests/lang/grc/test_tokenizer.py | 18 ++++++++++ 4 files changed, 69 insertions(+), 1 deletion(-) create mode 100644 spacy/lang/grc/punctuation.py create mode 100644 spacy/tests/lang/grc/test_tokenizer.py diff --git a/spacy/lang/char_classes.py b/spacy/lang/char_classes.py index 1d204c46c..37c58c85f 100644 --- a/spacy/lang/char_classes.py +++ b/spacy/lang/char_classes.py @@ -280,7 +280,7 @@ _currency = ( _punct = ( r"… …… , : ; \! \? ¿ ؟ ¡ \( \) \[ \] \{ \} < > _ # \* & 。 ? ! , 、 ; : ~ · । ، ۔ ؛ ٪" ) -_quotes = r'\' " ” “ ` ‘ ´ ’ ‚ , „ » « 「 」 『 』 ( ) 〔 〕 【 】 《 》 〈 〉' +_quotes = r'\' " ” “ ` ‘ ´ ’ ‚ , „ » « 「 」 『 』 ( ) 〔 〕 【 】 《 》 〈 〉 〈 〉 ⟦ ⟧' _hyphens = "- – — -- --- —— ~" # Various symbols like dingbats, but also emoji diff --git a/spacy/lang/grc/__init__.py b/spacy/lang/grc/__init__.py index e83f0c5a5..019b3802e 100644 --- a/spacy/lang/grc/__init__.py +++ b/spacy/lang/grc/__init__.py @@ -1,11 +1,15 @@ from .tokenizer_exceptions import TOKENIZER_EXCEPTIONS from .stop_words import STOP_WORDS from .lex_attrs import LEX_ATTRS +from .punctuation import TOKENIZER_PREFIXES, TOKENIZER_SUFFIXES, TOKENIZER_INFIXES from ...language import Language, BaseDefaults class AncientGreekDefaults(BaseDefaults): tokenizer_exceptions = TOKENIZER_EXCEPTIONS + prefixes = TOKENIZER_PREFIXES + suffixes = TOKENIZER_SUFFIXES + infixes = TOKENIZER_INFIXES lex_attr_getters = LEX_ATTRS stop_words = STOP_WORDS diff --git a/spacy/lang/grc/punctuation.py b/spacy/lang/grc/punctuation.py new file mode 100644 index 000000000..8f3589e9a --- /dev/null +++ b/spacy/lang/grc/punctuation.py @@ -0,0 +1,46 @@ +from ..char_classes import LIST_PUNCT, LIST_ELLIPSES, LIST_QUOTES, LIST_CURRENCY +from ..char_classes import LIST_ICONS, ALPHA_LOWER, ALPHA_UPPER, ALPHA, HYPHENS +from ..char_classes import CONCAT_QUOTES + +_prefixes = ( + [ + "†", + "⸏", + ] + + LIST_PUNCT + + LIST_ELLIPSES + + LIST_QUOTES + + LIST_CURRENCY + + LIST_ICONS +) + +_suffixes = ( + LIST_PUNCT + + LIST_ELLIPSES + + LIST_QUOTES + + LIST_ICONS + + [ + "†", + "⸎", + r"(?<=[\u1F00-\u1FFF\u0370-\u03FF])[\-\.⸏]", + ] +) + +_infixes = ( + LIST_ELLIPSES + + LIST_ICONS + + [ + r"(?<=[0-9])[+\-\*^](?=[0-9-])", + r"(?<=[{al}{q}])\.(?=[{au}{q}])".format( + al=ALPHA_LOWER, au=ALPHA_UPPER, q=CONCAT_QUOTES + ), + r"(?<=[{a}]),(?=[{a}])".format(a=ALPHA), + r"(?<=[{a}0-9])(?:{h})(?=[{a}])".format(a=ALPHA, h=HYPHENS), + r"(?<=[{a}0-9])[:<>=/](?=[{a}])".format(a=ALPHA), + r"(?<=[\u1F00-\u1FFF\u0370-\u03FF])—", + ] +) + +TOKENIZER_PREFIXES = _prefixes +TOKENIZER_SUFFIXES = _suffixes +TOKENIZER_INFIXES = _infixes diff --git a/spacy/tests/lang/grc/test_tokenizer.py b/spacy/tests/lang/grc/test_tokenizer.py new file mode 100644 index 000000000..3df5b546b --- /dev/null +++ b/spacy/tests/lang/grc/test_tokenizer.py @@ -0,0 +1,18 @@ +import pytest + + +# fmt: off +GRC_TOKEN_EXCEPTION_TESTS = [ + ("τὸ 〈τῆς〉 φιλοσοφίας ἔργον ἔνιοί φασιν ἀπὸ ⟦βαρβάρων⟧ ἄρξαι.", ["τὸ", "〈", "τῆς", "〉", "φιλοσοφίας", "ἔργον", "ἔνιοί", "φασιν", "ἀπὸ", "⟦", "βαρβάρων", "⟧", "ἄρξαι", "."]), + ("τὴν δὲ τῶν Αἰγυπτίων φιλοσοφίαν εἶναι τοιαύτην περί τε †θεῶν† καὶ ὑπὲρ δικαιοσύνης.", ["τὴν", "δὲ", "τῶν", "Αἰγυπτίων", "φιλοσοφίαν", "εἶναι", "τοιαύτην", "περί", "τε", "†", "θεῶν", "†", "καὶ", "ὑπὲρ", "δικαιοσύνης", "."]), + ("⸏πόσις δ' Ἐρεχθεύς ἐστί μοι σεσωσμένος⸏", ["⸏", "πόσις", "δ'", "Ἐρεχθεύς", "ἐστί", "μοι", "σεσωσμένος", "⸏"]), + ("⸏ὔπνον ἴδωμεν⸎", ["⸏", "ὔπνον", "ἴδωμεν", "⸎"]), +] +# fmt: on + + +@pytest.mark.parametrize("text,expected_tokens", GRC_TOKEN_EXCEPTION_TESTS) +def test_grc_tokenizer(grc_tokenizer, text, expected_tokens): + tokens = grc_tokenizer(text) + token_list = [token.text for token in tokens if not token.is_space] + assert expected_tokens == token_list From 9557b0fb01612f5b32823dfc52cae71af37f0bd8 Mon Sep 17 00:00:00 2001 From: Taniguchi Yasufumi Date: Tue, 27 Sep 2022 21:11:50 +0900 Subject: [PATCH 025/161] Add spacy-partial-tagger to spaCy Universe (#11538) --- website/meta/universe.json | 14 ++++++++++++++ 1 file changed, 14 insertions(+) diff --git a/website/meta/universe.json b/website/meta/universe.json index 9145855c6..9ec0d6c0e 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -3984,7 +3984,21 @@ }, "category": ["pipeline"], "tags": ["interpretation", "ja"] + }, + { + "id": "spacy-partial-tagger", + "title": "spaCy - Partial Tagger", + "slogan": "Sequence Tagger for Partially Annotated Dataset in spaCy", + "description": "This is a library to build a CRF tagger with a partially annotated dataset in spaCy. You can build your own tagger only from dictionary.", + "github": "doccano/spacy-partial-tagger", + "pip": "spacy-partial-tagger", + "category": ["pipeline", "training"], + "author": "Yasufumi Taniguchi", + "author_links": { + "github": "yasufumy" + } } + ], "categories": [ From aea16719be04d4d6ab889cd20fe0e323b2c7ffee Mon Sep 17 00:00:00 2001 From: Raphael Mitsch Date: Tue, 27 Sep 2022 14:22:36 +0200 Subject: [PATCH 026/161] Simplify and clarify enable/disable behavior of spacy.load() (#11459) * Change enable/disable behavior so that arguments take precedence over config options. Extend error message on conflict. Add warning message in case of overwriting config option with arguments. * Fix tests in test_serialize_pipeline.py to reflect changes to handling of enable/disable. * Fix type issue. * Move comment. * Move comment. * Issue UserWarning instead of printing wasabi message. Adjust test. * Added pytest.warns(UserWarning) for expected warning to fix tests. * Update warning message. * Move type handling out of fetch_pipes_status(). * Add global variable for default value. Use id() to determine whether used values are default value. * Fix default value for disable. * Rename DEFAULT_PIPE_STATUS to _DEFAULT_EMPTY_PIPES. --- spacy/__init__.py | 6 +- spacy/errors.py | 7 ++- spacy/language.py | 59 ++++++++++++------- spacy/tests/pipeline/test_pipe_methods.py | 33 +++++++++-- .../serialize/test_serialize_pipeline.py | 7 ++- spacy/util.py | 23 ++++---- 6 files changed, 92 insertions(+), 43 deletions(-) diff --git a/spacy/__init__.py b/spacy/__init__.py index d60f46b96..c3568bc5c 100644 --- a/spacy/__init__.py +++ b/spacy/__init__.py @@ -31,9 +31,9 @@ def load( name: Union[str, Path], *, vocab: Union[Vocab, bool] = True, - disable: Union[str, Iterable[str]] = util.SimpleFrozenList(), - enable: Union[str, Iterable[str]] = util.SimpleFrozenList(), - exclude: Union[str, Iterable[str]] = util.SimpleFrozenList(), + disable: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES, + enable: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES, + exclude: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES, config: Union[Dict[str, Any], Config] = util.SimpleFrozenDict(), ) -> Language: """Load a spaCy model from an installed package or a local path. diff --git a/spacy/errors.py b/spacy/errors.py index f55b378e9..c035f684d 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -212,6 +212,8 @@ class Warnings(metaclass=ErrorsWithCodes): W121 = ("Attempting to trace non-existent method '{method}' in pipe '{pipe}'") W122 = ("Couldn't trace method '{method}' in pipe '{pipe}'. This can happen if the pipe class " "is a Cython extension type.") + W123 = ("Argument {arg} with value {arg_value} is used instead of {config_value} as specified in the config. Be " + "aware that this might affect other components in your pipeline.") class Errors(metaclass=ErrorsWithCodes): @@ -937,8 +939,9 @@ class Errors(metaclass=ErrorsWithCodes): E1040 = ("Doc.from_json requires all tokens to have the same attributes. " "Some tokens do not contain annotation for: {partial_attrs}") E1041 = ("Expected a string, Doc, or bytes as input, but got: {type}") - E1042 = ("Function was called with `{arg1}`={arg1_values} and " - "`{arg2}`={arg2_values} but these arguments are conflicting.") + E1042 = ("`enable={enable}` and `disable={disable}` are inconsistent with each other.\nIf you only passed " + "one of `enable` or `disable`, the other argument is specified in your pipeline's configuration.\nIn that " + "case pass an empty list for the previously not specified argument to avoid this error.") E1043 = ("Expected None or a value in range [{range_start}, {range_end}] for entity linker threshold, but got " "{value}.") diff --git a/spacy/language.py b/spacy/language.py index 34a06e576..d391f15ab 100644 --- a/spacy/language.py +++ b/spacy/language.py @@ -1,4 +1,4 @@ -from typing import Iterator, Optional, Any, Dict, Callable, Iterable, Collection +from typing import Iterator, Optional, Any, Dict, Callable, Iterable from typing import Union, Tuple, List, Set, Pattern, Sequence from typing import NoReturn, TYPE_CHECKING, TypeVar, cast, overload @@ -10,6 +10,7 @@ from contextlib import contextmanager from copy import deepcopy from pathlib import Path import warnings + from thinc.api import get_current_ops, Config, CupyOps, Optimizer import srsly import multiprocessing as mp @@ -24,7 +25,7 @@ from .pipe_analysis import validate_attrs, analyze_pipes, print_pipe_analysis from .training import Example, validate_examples from .training.initialize import init_vocab, init_tok2vec from .scorer import Scorer -from .util import registry, SimpleFrozenList, _pipe, raise_error +from .util import registry, SimpleFrozenList, _pipe, raise_error, _DEFAULT_EMPTY_PIPES from .util import SimpleFrozenDict, combine_score_weights, CONFIG_SECTION_ORDER from .util import warn_if_jupyter_cupy from .lang.tokenizer_exceptions import URL_MATCH, BASE_EXCEPTIONS @@ -1698,9 +1699,9 @@ class Language: config: Union[Dict[str, Any], Config] = {}, *, vocab: Union[Vocab, bool] = True, - disable: Union[str, Iterable[str]] = SimpleFrozenList(), - enable: Union[str, Iterable[str]] = SimpleFrozenList(), - exclude: Union[str, Iterable[str]] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, meta: Dict[str, Any] = SimpleFrozenDict(), auto_fill: bool = True, validate: bool = True, @@ -1727,12 +1728,6 @@ class Language: DOCS: https://spacy.io/api/language#from_config """ - if isinstance(disable, str): - disable = [disable] - if isinstance(enable, str): - enable = [enable] - if isinstance(exclude, str): - exclude = [exclude] if auto_fill: config = Config( cls.default_config, section_order=CONFIG_SECTION_ORDER @@ -1877,9 +1872,38 @@ class Language: nlp.vocab.from_bytes(vocab_b) # Resolve disabled/enabled settings. + if isinstance(disable, str): + disable = [disable] + if isinstance(enable, str): + enable = [enable] + if isinstance(exclude, str): + exclude = [exclude] + + def fetch_pipes_status(value: Iterable[str], key: str) -> Iterable[str]: + """Fetch value for `enable` or `disable` w.r.t. the specified config and passed arguments passed to + .load(). If both arguments and config specified values for this field, the passed arguments take precedence + and a warning is printed. + value (Iterable[str]): Passed value for `enable` or `disable`. + key (str): Key for field in config (either "enabled" or "disabled"). + RETURN (Iterable[str]): + """ + # We assume that no argument was passed if the value is the specified default value. + if id(value) == id(_DEFAULT_EMPTY_PIPES): + return config["nlp"].get(key, []) + else: + if len(config["nlp"].get(key, [])): + warnings.warn( + Warnings.W123.format( + arg=key[:-1], + arg_value=value, + config_value=config["nlp"][key], + ) + ) + return value + disabled_pipes = cls._resolve_component_status( - [*config["nlp"]["disabled"], *disable], - [*config["nlp"].get("enabled", []), *enable], + fetch_pipes_status(disable, "disabled"), + fetch_pipes_status(enable, "enabled"), config["nlp"]["pipeline"], ) nlp._disabled = set(p for p in disabled_pipes if p not in exclude) @@ -2064,14 +2088,7 @@ class Language: pipe_name for pipe_name in pipe_names if pipe_name not in enable ] if disable and disable != to_disable: - raise ValueError( - Errors.E1042.format( - arg1="enable", - arg2="disable", - arg1_values=enable, - arg2_values=disable, - ) - ) + raise ValueError(Errors.E1042.format(enable=enable, disable=disable)) return tuple(to_disable) diff --git a/spacy/tests/pipeline/test_pipe_methods.py b/spacy/tests/pipeline/test_pipe_methods.py index b946061f6..14a7a36e5 100644 --- a/spacy/tests/pipeline/test_pipe_methods.py +++ b/spacy/tests/pipeline/test_pipe_methods.py @@ -605,10 +605,35 @@ def test_update_with_annotates(): assert results[component] == "" -def test_load_disable_enable() -> None: - """ - Tests spacy.load() with dis-/enabling components. - """ +@pytest.mark.issue(11443) +def test_enable_disable_conflict_with_config(): + """Test conflict between enable/disable w.r.t. `nlp.disabled` set in the config.""" + nlp = English() + nlp.add_pipe("tagger") + nlp.add_pipe("senter") + nlp.add_pipe("sentencizer") + + with make_tempdir() as tmp_dir: + nlp.to_disk(tmp_dir) + # Expected to fail, as config and arguments conflict. + with pytest.raises(ValueError): + spacy.load( + tmp_dir, enable=["tagger"], config={"nlp": {"disabled": ["senter"]}} + ) + # Expected to succeed without warning due to the lack of a conflicting config option. + spacy.load(tmp_dir, enable=["tagger"]) + # Expected to succeed with a warning, as disable=[] should override the config setting. + with pytest.warns(UserWarning): + spacy.load( + tmp_dir, + enable=["tagger"], + disable=[], + config={"nlp": {"disabled": ["senter"]}}, + ) + + +def test_load_disable_enable(): + """Tests spacy.load() with dis-/enabling components.""" base_nlp = English() for pipe in ("sentencizer", "tagger", "parser"): diff --git a/spacy/tests/serialize/test_serialize_pipeline.py b/spacy/tests/serialize/test_serialize_pipeline.py index 9fcf18e2d..b948bb76c 100644 --- a/spacy/tests/serialize/test_serialize_pipeline.py +++ b/spacy/tests/serialize/test_serialize_pipeline.py @@ -404,10 +404,11 @@ def test_serialize_pipeline_disable_enable(): assert nlp3.component_names == ["ner", "tagger"] with make_tempdir() as d: nlp3.to_disk(d) - nlp4 = spacy.load(d, disable=["ner"]) - assert nlp4.pipe_names == [] + with pytest.warns(UserWarning): + nlp4 = spacy.load(d, disable=["ner"]) + assert nlp4.pipe_names == ["tagger"] assert nlp4.component_names == ["ner", "tagger"] - assert nlp4.disabled == ["ner", "tagger"] + assert nlp4.disabled == ["ner"] with make_tempdir() as d: nlp.to_disk(d) nlp5 = spacy.load(d, exclude=["tagger"]) diff --git a/spacy/util.py b/spacy/util.py index 4e1a62d05..3034808ba 100644 --- a/spacy/util.py +++ b/spacy/util.py @@ -67,7 +67,6 @@ LEXEME_NORM_LANGS = ["cs", "da", "de", "el", "en", "id", "lb", "mk", "pt", "ru", CONFIG_SECTION_ORDER = ["paths", "variables", "system", "nlp", "components", "corpora", "training", "pretraining", "initialize"] # fmt: on - logger = logging.getLogger("spacy") logger_stream_handler = logging.StreamHandler() logger_stream_handler.setFormatter( @@ -394,13 +393,17 @@ def get_module_path(module: ModuleType) -> Path: return file_path.parent +# Default value for passed enable/disable values. +_DEFAULT_EMPTY_PIPES = SimpleFrozenList() + + def load_model( name: Union[str, Path], *, vocab: Union["Vocab", bool] = True, - disable: Union[str, Iterable[str]] = SimpleFrozenList(), - enable: Union[str, Iterable[str]] = SimpleFrozenList(), - exclude: Union[str, Iterable[str]] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, config: Union[Dict[str, Any], Config] = SimpleFrozenDict(), ) -> "Language": """Load a model from a package or data path. @@ -470,9 +473,9 @@ def load_model_from_path( *, meta: Optional[Dict[str, Any]] = None, vocab: Union["Vocab", bool] = True, - disable: Union[str, Iterable[str]] = SimpleFrozenList(), - enable: Union[str, Iterable[str]] = SimpleFrozenList(), - exclude: Union[str, Iterable[str]] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, config: Union[Dict[str, Any], Config] = SimpleFrozenDict(), ) -> "Language": """Load a model from a data directory path. Creates Language class with @@ -516,9 +519,9 @@ def load_model_from_config( *, meta: Dict[str, Any] = SimpleFrozenDict(), vocab: Union["Vocab", bool] = True, - disable: Union[str, Iterable[str]] = SimpleFrozenList(), - enable: Union[str, Iterable[str]] = SimpleFrozenList(), - exclude: Union[str, Iterable[str]] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, auto_fill: bool = False, validate: bool = True, ) -> "Language": From e794d4ae39b65aed341fa588ed4d473644aec672 Mon Sep 17 00:00:00 2001 From: Peter Baumgartner <5107405+pmbaumgartner@users.noreply.github.com> Date: Wed, 28 Sep 2022 11:16:05 -0400 Subject: [PATCH 027/161] `debug data` Spancat Table Improvements (#11504) * update * fix format function * pull out _format_number * format with black --- spacy/cli/_util.py | 9 +++++++++ spacy/cli/debug_data.py | 29 ++++++++++++++++++++++++----- 2 files changed, 33 insertions(+), 5 deletions(-) diff --git a/spacy/cli/_util.py b/spacy/cli/_util.py index ae43b991b..897964a88 100644 --- a/spacy/cli/_util.py +++ b/spacy/cli/_util.py @@ -573,3 +573,12 @@ def setup_gpu(use_gpu: int, silent=None) -> None: local_msg.info("Using CPU") if gpu_is_available(): local_msg.info("To switch to GPU 0, use the option: --gpu-id 0") + + +def _format_number(number: Union[int, float], ndigits: int = 2) -> str: + """Formats a number (float or int) rounding to `ndigits`, without truncating trailing 0s, + as happens with `round(number, ndigits)`""" + if isinstance(number, float): + return f"{number:.{ndigits}f}" + else: + return str(number) diff --git a/spacy/cli/debug_data.py b/spacy/cli/debug_data.py index bd05471b1..963d5b926 100644 --- a/spacy/cli/debug_data.py +++ b/spacy/cli/debug_data.py @@ -9,7 +9,7 @@ import typer import math from ._util import app, Arg, Opt, show_validation_error, parse_config_overrides -from ._util import import_code, debug_cli +from ._util import import_code, debug_cli, _format_number from ..training import Example, remove_bilu_prefix from ..training.initialize import get_sourced_components from ..schemas import ConfigSchemaTraining @@ -989,7 +989,8 @@ def _get_kl_divergence(p: Counter, q: Counter) -> float: def _format_span_row(span_data: List[Dict], labels: List[str]) -> List[Any]: """Compile into one list for easier reporting""" d = { - label: [label] + list(round(d[label], 2) for d in span_data) for label in labels + label: [label] + list(_format_number(d[label]) for d in span_data) + for label in labels } return list(d.values()) @@ -1004,6 +1005,10 @@ def _get_span_characteristics( label: _gmean(l) for label, l in compiled_gold["spans_length"][spans_key].items() } + spans_per_type = { + label: len(spans) + for label, spans in compiled_gold["spans_per_type"][spans_key].items() + } min_lengths = [min(l) for l in compiled_gold["spans_length"][spans_key].values()] max_lengths = [max(l) for l in compiled_gold["spans_length"][spans_key].values()] @@ -1031,6 +1036,7 @@ def _get_span_characteristics( return { "sd": span_distinctiveness, "bd": sb_distinctiveness, + "spans_per_type": spans_per_type, "lengths": span_length, "min_length": min(min_lengths), "max_length": max(max_lengths), @@ -1045,12 +1051,15 @@ def _get_span_characteristics( def _print_span_characteristics(span_characteristics: Dict[str, Any]): """Print all span characteristics into a table""" - headers = ("Span Type", "Length", "SD", "BD") + headers = ("Span Type", "Length", "SD", "BD", "N") + # Wasabi has this at 30 by default, but we might have some long labels + max_col = max(30, max(len(label) for label in span_characteristics["labels"])) # Prepare table data with all span characteristics table_data = [ span_characteristics["lengths"], span_characteristics["sd"], span_characteristics["bd"], + span_characteristics["spans_per_type"], ] table = _format_span_row( span_data=table_data, labels=span_characteristics["labels"] @@ -1061,8 +1070,18 @@ def _print_span_characteristics(span_characteristics: Dict[str, Any]): span_characteristics["avg_sd"], span_characteristics["avg_bd"], ] - footer = ["Wgt. Average"] + [str(round(f, 2)) for f in footer_data] - msg.table(table, footer=footer, header=headers, divider=True) + + footer = ( + ["Wgt. Average"] + ["{:.2f}".format(round(f, 2)) for f in footer_data] + ["-"] + ) + msg.table( + table, + footer=footer, + header=headers, + divider=True, + aligns=["l"] + ["r"] * (len(footer_data) + 1), + max_col=max_col, + ) def _get_spans_length_freq_dist( From 6d7630c5d372cda53b88a18b10bb893ce478d294 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Thu, 29 Sep 2022 10:44:06 +0200 Subject: [PATCH 028/161] Allow overriding spacy_version in spacy package meta (#11552) --- spacy/cli/package.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/cli/package.py b/spacy/cli/package.py index b8c8397b6..324c5d1bb 100644 --- a/spacy/cli/package.py +++ b/spacy/cli/package.py @@ -299,8 +299,8 @@ def get_meta( } nlp = util.load_model_from_path(Path(model_path)) meta.update(nlp.meta) - meta.update(existing_meta) meta["spacy_version"] = util.get_minor_version_range(about.__version__) + meta.update(existing_meta) meta["vectors"] = { "width": nlp.vocab.vectors_length, "vectors": len(nlp.vocab.vectors), From ba63f57f81441d049da52c5d398e5b226019a1a6 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Thu, 29 Sep 2022 18:50:29 +0900 Subject: [PATCH 029/161] Update docs to reflect Doc input to Language (#11555) --- website/docs/api/language.md | 10 ++++++++-- 1 file changed, 8 insertions(+), 2 deletions(-) diff --git a/website/docs/api/language.md b/website/docs/api/language.md index ed763e36a..767a7450a 100644 --- a/website/docs/api/language.md +++ b/website/docs/api/language.md @@ -164,6 +164,9 @@ examples, see the Apply the pipeline to some text. The text can span multiple sentences, and can contain arbitrary whitespace. Alignment into the original string is preserved. +Instead of text, a `Doc` can be passed as input, in which case tokenization is +skipped, but the rest of the pipeline is run. + > #### Example > > ```python @@ -173,7 +176,7 @@ contain arbitrary whitespace. Alignment into the original string is preserved. | Name | Description | | --------------- | ---------------------------------------------------------------------------------------------------------------------------------------------- | -| `text` | The text to be processed. ~~str~~ | +| `text` | The text to be processed, or a Doc. ~~Union[str, Doc]~~ | | _keyword-only_ | | | `disable` | Names of pipeline components to [disable](/usage/processing-pipelines#disabling). ~~List[str]~~ | | `component_cfg` | Optional dictionary of keyword arguments for components, keyed by component names. Defaults to `None`. ~~Optional[Dict[str, Dict[str, Any]]]~~ | @@ -184,6 +187,9 @@ contain arbitrary whitespace. Alignment into the original string is preserved. Process texts as a stream, and yield `Doc` objects in order. This is usually more efficient than processing texts one-by-one. +Instead of text, a `Doc` object can be passed as input. In this case +tokenization is skipped but the rest of the pipeline is run. + > #### Example > > ```python @@ -194,7 +200,7 @@ more efficient than processing texts one-by-one. | Name | Description | | ------------------------------------------ | ------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `texts` | A sequence of strings. ~~Iterable[str]~~ | +| `texts` | A sequence of strings (or `Doc` objects). ~~Iterable[Union[str, Doc]]~~ | | _keyword-only_ | | | `as_tuples` | If set to `True`, inputs should be a sequence of `(text, context)` tuples. Output will then be a sequence of `(doc, context)` tuples. Defaults to `False`. ~~bool~~ | | `batch_size` | The number of texts to buffer. ~~Optional[int]~~ | From bcda8bc1e720e999243d23ce620181fcad7e8e46 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Thu, 29 Sep 2022 14:24:40 +0200 Subject: [PATCH 030/161] update mypy to latest version (#11546) * update mypy and disable it for python 3.6 * ignoring mypy's type redefinition error --- .github/azure-steps.yml | 2 +- requirements.txt | 2 +- spacy/pipeline/entityruler.py | 5 ++--- 3 files changed, 4 insertions(+), 5 deletions(-) diff --git a/.github/azure-steps.yml b/.github/azure-steps.yml index c7722391f..9d57219ca 100644 --- a/.github/azure-steps.yml +++ b/.github/azure-steps.yml @@ -27,7 +27,7 @@ steps: - script: python -m mypy spacy displayName: 'Run mypy' - condition: ne(variables['python_version'], '3.10') + condition: ne(variables['python_version'], '3.6') - task: DeleteFiles@1 inputs: diff --git a/requirements.txt b/requirements.txt index e45fde787..446560c06 100644 --- a/requirements.txt +++ b/requirements.txt @@ -30,7 +30,7 @@ pytest-timeout>=1.3.0,<2.0.0 mock>=2.0.0,<3.0.0 flake8>=3.8.0,<3.10.0 hypothesis>=3.27.0,<7.0.0 -mypy>=0.910,<0.970; platform_machine!='aarch64' +mypy>=0.980,<0.990; platform_machine != "aarch64" and python_version >= "3.7" types-dataclasses>=0.1.3; python_version < "3.7" types-mock>=0.1.1 types-setuptools>=57.0.0 diff --git a/spacy/pipeline/entityruler.py b/spacy/pipeline/entityruler.py index 3cb1ca676..8154a077d 100644 --- a/spacy/pipeline/entityruler.py +++ b/spacy/pipeline/entityruler.py @@ -1,6 +1,5 @@ -import warnings from typing import Optional, Union, List, Dict, Tuple, Iterable, Any, Callable, Sequence -from typing import cast +import warnings from collections import defaultdict from pathlib import Path import srsly @@ -317,7 +316,7 @@ class EntityRuler(Pipe): phrase_pattern["id"] = ent_id phrase_patterns.append(phrase_pattern) for entry in token_patterns + phrase_patterns: # type: ignore[operator] - label = entry["label"] + label = entry["label"] # type: ignore if "id" in entry: ent_label = label label = self._create_label(label, entry["id"]) From ff9002b726cfdae083a9a0206e1ef615f19a6088 Mon Sep 17 00:00:00 2001 From: Gabriele Picco Date: Thu, 29 Sep 2022 16:34:44 +0100 Subject: [PATCH 031/161] Add Zshot Spacy plugin (#11557) * Add Zshot Spacy plugin Add Zshot (Zero and Few shot named entity & relationships recognition) Spacy plugin * Update website/meta/universe.json Co-authored-by: Adriane Boyd * Update website/meta/universe.json Co-authored-by: Adriane Boyd Co-authored-by: Adriane Boyd --- website/meta/universe.json | 57 ++++++++++++++++++++++++++++++++++++++ 1 file changed, 57 insertions(+) diff --git a/website/meta/universe.json b/website/meta/universe.json index 9ec0d6c0e..a6a1a0fc7 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -1,5 +1,62 @@ { "resources": [ + { + "id": "Zshot", + "title": "Zshot", + "slogan": "Zero and Few shot named entity & relationships recognition", + "github": "ibm/zshot", + "pip": "zshot", + "code_example": [ + "import spacy", + "from zshot import PipelineConfig, displacy", + "from zshot.linker import LinkerRegen", + "from zshot.mentions_extractor import MentionsExtractorSpacy", + "from zshot.utils.data_models import Entity", + "", + "nlp = spacy.load('en_core_web_sm')", + "# zero shot definition of entities", + "nlp_config = PipelineConfig(", + " mentions_extractor=MentionsExtractorSpacy(),", + " linker=LinkerRegen(),", + " entities=[", + " Entity(name='Paris',", + " description='Paris is located in northern central France, in a north-bending arc of the river Seine'),", + " Entity(name='IBM',", + " description='International Business Machines Corporation (IBM) is an American multinational technology corporation headquartered in Armonk, New York'),", + " Entity(name='New York', description='New York is a city in U.S. state'),", + " Entity(name='Florida', description='southeasternmost U.S. state'),", + " Entity(name='American',", + " description='American, something of, from, or related to the United States of America, commonly known as the United States or America'),", + " Entity(name='Chemical formula',", + " description='In chemistry, a chemical formula is a way of presenting information about the chemical proportions of atoms that constitute a particular chemical compound or molecul'),", + " Entity(name='Acetamide',", + " description='Acetamide (systematic name: ethanamide) is an organic compound with the formula CH3CONH2. It is the simplest amide derived from acetic acid. It finds some use as a plasticizer and as an industrial solvent.'),", + " Entity(name='Armonk',", + " description='Armonk is a hamlet and census-designated place (CDP) in the town of North Castle, located in Westchester County, New York, United States.'),", + " Entity(name='Acetic Acid',", + " description='Acetic acid, systematically named ethanoic acid, is an acidic, colourless liquid and organic compound with the chemical formula CH3COOH'),", + " Entity(name='Industrial solvent',", + " description='Acetamide (systematic name: ethanamide) is an organic compound with the formula CH3CONH2. It is the simplest amide derived from acetic acid. It finds some use as a plasticizer and as an industrial solvent.'),", + " ]", + ")", + "nlp.add_pipe('zshot', config=nlp_config, last=True)", + "", + "text = 'International Business Machines Corporation (IBM) is an American multinational technology corporation' \\", + " ' headquartered in Armonk, New York, with operations in over 171 countries.'", + "", + "doc = nlp(text)", + "displacy.serve(doc, style='ent')" + ], + "thumb": "https://ibm.github.io/zshot/img/graph.png", + "url": "https://ibm.github.io/zshot/", + "author": "IBM Research", + "author_links": { + "github": "ibm", + "twitter": "IBMResearch", + "website": "https://research.ibm.com/labs/ireland/" + }, + "category": ["scientific", "models", "research"] + }, { "id": "concepcy", "title": "concepCy", From 087cc74c6abdd43e04e4313cdcf292edf6187f4b Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Mon, 3 Oct 2022 18:53:21 +0900 Subject: [PATCH 032/161] Remove mention of 1.7 from issue template (#11570) It's rare to have anyone using v1 anymore, so this message is no longer helpful. --- .github/ISSUE_TEMPLATE/01_bugs.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/.github/ISSUE_TEMPLATE/01_bugs.md b/.github/ISSUE_TEMPLATE/01_bugs.md index 255a5241e..f0d0ba912 100644 --- a/.github/ISSUE_TEMPLATE/01_bugs.md +++ b/.github/ISSUE_TEMPLATE/01_bugs.md @@ -10,7 +10,7 @@ about: Use this template if you came across a bug or unexpected behaviour differ ## Your Environment - + * Operating System: * Python Version Used: * spaCy Version Used: From 70e21dfcad28b044903ba33b2b8831d925151b76 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Mon, 3 Oct 2022 13:04:03 +0200 Subject: [PATCH 033/161] PR to test importlib-metadata (#11569) * empty commit * restrict importlib-metadata to lower than 5.0.0 * restrict importlib-metadata also for validate CI step * set fixed version for CI * try flake8 5.0.4 in CI validation step * from importlib-metadata from requirements again --- azure-pipelines.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/azure-pipelines.yml b/azure-pipelines.yml index f475b7fdd..2f5201614 100644 --- a/azure-pipelines.yml +++ b/azure-pipelines.yml @@ -31,7 +31,7 @@ jobs: inputs: versionSpec: "3.7" - script: | - pip install flake8==3.9.2 + pip install flake8==5.0.4 python -m flake8 spacy --count --select=E901,E999,F821,F822,F823,W605 --show-source --statistics displayName: "flake8" From d4922f25fc182a51d71375a979f99cf27b08ecd9 Mon Sep 17 00:00:00 2001 From: svlandeg Date: Mon, 3 Oct 2022 14:41:15 +0200 Subject: [PATCH 034/161] fix test for EL activations with refactored KB --- spacy/tests/pipeline/test_entity_linker.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/tests/pipeline/test_entity_linker.py b/spacy/tests/pipeline/test_entity_linker.py index c03c7008a..a6baa1ff4 100644 --- a/spacy/tests/pipeline/test_entity_linker.py +++ b/spacy/tests/pipeline/test_entity_linker.py @@ -1214,7 +1214,7 @@ def test_save_activations(): # create artificial KB - assign same prior weight to the two russ cochran's # Q2146908 (Russ Cochran): American golfer # Q7381115 (Russ Cochran): publisher - mykb = KnowledgeBase(vocab, entity_vector_length=vector_length) + mykb = InMemoryLookupKB(vocab, entity_vector_length=vector_length) mykb.add_entity(entity="Q2146908", freq=12, entity_vector=[6, -4, 3]) mykb.add_entity(entity="Q7381115", freq=12, entity_vector=[9, 1, -7]) mykb.add_alias( From b187076a2dd0f034c1a8918c9b332711688b5dc2 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Mon, 3 Oct 2022 17:01:04 +0200 Subject: [PATCH 035/161] fix docs (#11573) --- website/docs/api/kb_in_memory.md | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/website/docs/api/kb_in_memory.md b/website/docs/api/kb_in_memory.md index c9ce624f0..9e3279e6a 100644 --- a/website/docs/api/kb_in_memory.md +++ b/website/docs/api/kb_in_memory.md @@ -21,9 +21,9 @@ Create the knowledge base. > #### Example > > ```python -> from spacy.kb import KnowledgeBase +> from spacy.kb import InMemoryLookupKB > vocab = nlp.vocab -> kb = KnowledgeBase(vocab=vocab, entity_vector_length=64) +> kb = InMemoryLookupKB(vocab=vocab, entity_vector_length=64) > ``` | Name | Description | From 8cd77dd54cfc89c2f67ca2412490ef9b49a98518 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Tue, 4 Oct 2022 11:23:04 +0200 Subject: [PATCH 036/161] Sync flake8 version across requirements (#11580) --- .pre-commit-config.yaml | 2 +- requirements.txt | 2 +- 2 files changed, 2 insertions(+), 2 deletions(-) diff --git a/.pre-commit-config.yaml b/.pre-commit-config.yaml index b959262e3..df59697b1 100644 --- a/.pre-commit-config.yaml +++ b/.pre-commit-config.yaml @@ -6,7 +6,7 @@ repos: language_version: python3.7 additional_dependencies: ['click==8.0.4'] - repo: https://gitlab.com/pycqa/flake8 - rev: 3.9.2 + rev: 5.0.4 hooks: - id: flake8 args: diff --git a/requirements.txt b/requirements.txt index 446560c06..14847ff21 100644 --- a/requirements.txt +++ b/requirements.txt @@ -28,7 +28,7 @@ cython>=0.25,<3.0 pytest>=5.2.0,!=7.1.0 pytest-timeout>=1.3.0,<2.0.0 mock>=2.0.0,<3.0.0 -flake8>=3.8.0,<3.10.0 +flake8>=3.8.0,<6.0.0 hypothesis>=3.27.0,<7.0.0 mypy>=0.980,<0.990; platform_machine != "aarch64" and python_version >= "3.7" types-dataclasses>=0.1.3; python_version < "3.7" From 446a3ecf34f3b0c139a326d7471b9b1b5346bcb0 Mon Sep 17 00:00:00 2001 From: Madeesh Kannan Date: Thu, 6 Oct 2022 10:51:06 +0200 Subject: [PATCH 037/161] `StringStore` refactoring (#11344) * `strings`: Remove unused `hash32_utf8` function * `strings`: Make `hash_utf8` and `decode_Utf8Str` private * `strings`: Reorganize private functions * 'strings': Raise error when non-string/-int types are passed to functions that don't accept them * `strings`: Add `items()` method, add type hints, remove unused methods, restrict inputs to specific types, reorganize methods * `Morphology`: Use `StringStore.items()` to enumerate features when pickling * `test_stringstore`: Update pre-Python 3 tests * Update `StringStore` docs * Fix `get_string_id` imports * Replace redundant test with tests for type checking * Rename `_retrieve_interned_str`, remove `.get` default arg * Add `get_string_id` to `strings.pyi` Remove `mypy` ignore directives from imports of the above * `strings.pyi`: Replace functions that consume `Union`-typed params with overloads * `strings.pyi`: Revert some function signatures * Update `SYMBOLS_BY_INT` lookups and error codes post-merge * Revert clobbered change introduced in a previous merge * Remove unnecessary type hint * Invert tuple order in `StringStore.items()` * Add test for `StringStore.items()` * Revert "`Morphology`: Use `StringStore.items()` to enumerate features when pickling" This reverts commit 1af9510ceb6b08cfdcfbf26df6896f26709fac0d. * Rename `keys` and `key_map` * Add `keys()` and `values()` * Add comment about the inverted key-value semantics in the API * Fix type hints * Implement `keys()`, `values()`, `items()` without generators * Fix type hints, remove unnecessary boxing * Update docs * Simplify `keys/values/items()` impl * `mypy` fix * Fix error message, doc fixes --- spacy/errors.py | 4 +- spacy/matcher/matcher.pyx | 2 +- spacy/strings.pxd | 21 +- spacy/strings.pyi | 23 +- spacy/strings.pyx | 426 +++++++++--------- spacy/tests/vocab_vectors/test_stringstore.py | 41 +- spacy/tokens/graph.pyx | 2 +- spacy/tokens/retokenizer.pyx | 2 +- website/docs/api/stringstore.md | 82 +++- 9 files changed, 339 insertions(+), 264 deletions(-) diff --git a/spacy/errors.py b/spacy/errors.py index 5fb59e2c5..856660106 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -252,7 +252,7 @@ class Errors(metaclass=ErrorsWithCodes): E012 = ("Cannot add pattern for zero tokens to matcher.\nKey: {key}") E016 = ("MultitaskObjective target should be function or one of: dep, " "tag, ent, dep_tag_offset, ent_tag.") - E017 = ("Can only add unicode or bytes. Got type: {value_type}") + E017 = ("Can only add 'str' inputs to StringStore. Got type: {value_type}") E018 = ("Can't retrieve string for hash '{hash_value}'. This usually " "refers to an issue with the `Vocab` or `StringStore`.") E019 = ("Can't create transition with unknown action ID: {action}. Action " @@ -955,6 +955,8 @@ class Errors(metaclass=ErrorsWithCodes): # v4 error strings E4000 = ("Expected a Doc as input, but got: '{type}'") + E4001 = ("Expected input to be one of the following types: ({expected_types}), " + "but got '{received_type}'") # Deprecated model shortcuts, only used in errors and warnings diff --git a/spacy/matcher/matcher.pyx b/spacy/matcher/matcher.pyx index 865e7594e..8bd05f25f 100644 --- a/spacy/matcher/matcher.pyx +++ b/spacy/matcher/matcher.pyx @@ -22,7 +22,7 @@ from ..attrs cimport ID, attr_id_t, NULL_ATTR, ORTH, POS, TAG, DEP, LEMMA, MORPH from ..schemas import validate_token_pattern from ..errors import Errors, MatchPatternError, Warnings -from ..strings import get_string_id +from ..strings cimport get_string_id from ..attrs import IDS diff --git a/spacy/strings.pxd b/spacy/strings.pxd index 5f03a9a28..0c1a30fe3 100644 --- a/spacy/strings.pxd +++ b/spacy/strings.pxd @@ -1,4 +1,4 @@ -from libc.stdint cimport int64_t +from libc.stdint cimport int64_t, uint32_t from libcpp.vector cimport vector from libcpp.set cimport set from cymem.cymem cimport Pool @@ -7,13 +7,6 @@ from murmurhash.mrmr cimport hash64 from .typedefs cimport attr_t, hash_t - -cpdef hash_t hash_string(str string) except 0 -cdef hash_t hash_utf8(char* utf8_string, int length) nogil - -cdef str decode_Utf8Str(const Utf8Str* string) - - ctypedef union Utf8Str: unsigned char[8] s unsigned char* p @@ -21,9 +14,13 @@ ctypedef union Utf8Str: cdef class StringStore: cdef Pool mem + cdef vector[hash_t] _keys + cdef PreshMap _map - cdef vector[hash_t] keys - cdef public PreshMap _map + cdef hash_t _intern_str(self, str string) + cdef Utf8Str* _allocate_str_repr(self, const unsigned char* chars, uint32_t length) except * + cdef str _decode_str_repr(self, const Utf8Str* string) - cdef const Utf8Str* intern_unicode(self, str py_string) - cdef const Utf8Str* _intern_utf8(self, char* utf8_string, int length, hash_t* precalculated_hash) + +cpdef hash_t hash_string(object string) except -1 +cpdef hash_t get_string_id(object string_or_hash) except -1 diff --git a/spacy/strings.pyi b/spacy/strings.pyi index b29389b9a..d9509ff57 100644 --- a/spacy/strings.pyi +++ b/spacy/strings.pyi @@ -1,21 +1,20 @@ -from typing import Optional, Iterable, Iterator, Union, Any, overload +from typing import List, Optional, Iterable, Iterator, Union, Any, Tuple, overload from pathlib import Path -def get_string_id(key: Union[str, int]) -> int: ... - class StringStore: - def __init__( - self, strings: Optional[Iterable[str]] = ..., freeze: bool = ... - ) -> None: ... + def __init__(self, strings: Optional[Iterable[str]]) -> None: ... @overload - def __getitem__(self, string_or_id: Union[bytes, str]) -> int: ... + def __getitem__(self, string_or_hash: str) -> int: ... @overload - def __getitem__(self, string_or_id: int) -> str: ... - def as_int(self, key: Union[bytes, str, int]) -> int: ... - def as_string(self, key: Union[bytes, str, int]) -> str: ... + def __getitem__(self, string_or_hash: int) -> str: ... + def as_int(self, string_or_hash: Union[str, int]) -> int: ... + def as_string(self, string_or_hash: Union[str, int]) -> str: ... def add(self, string: str) -> int: ... + def items(self) -> List[Tuple[str, int]]: ... + def keys(self) -> List[str]: ... + def values(self) -> List[int]: ... def __len__(self) -> int: ... - def __contains__(self, string: str) -> bool: ... + def __contains__(self, string_or_hash: Union[str, int]) -> bool: ... def __iter__(self) -> Iterator[str]: ... def __reduce__(self) -> Any: ... def to_disk(self, path: Union[str, Path]) -> None: ... @@ -23,3 +22,5 @@ class StringStore: def to_bytes(self, **kwargs: Any) -> bytes: ... def from_bytes(self, bytes_data: bytes, **kwargs: Any) -> StringStore: ... def _reset_and_load(self, strings: Iterable[str]) -> None: ... + +def get_string_id(string_or_hash: Union[str, int]) -> int: ... diff --git a/spacy/strings.pyx b/spacy/strings.pyx index e86682733..5a037eb9a 100644 --- a/spacy/strings.pyx +++ b/spacy/strings.pyx @@ -1,9 +1,10 @@ # cython: infer_types=True +from typing import Optional, Union, Iterable, Tuple, Callable, Any, List, Iterator cimport cython from libc.string cimport memcpy from libcpp.set cimport set from libc.stdint cimport uint32_t -from murmurhash.mrmr cimport hash64, hash32 +from murmurhash.mrmr cimport hash64 import srsly @@ -14,105 +15,13 @@ from .symbols import NAMES as SYMBOLS_BY_INT from .errors import Errors from . import util -# Not particularly elegant, but this is faster than `isinstance(key, numbers.Integral)` -cdef inline bint _try_coerce_to_hash(object key, hash_t* out_hash): - try: - out_hash[0] = key - return True - except: - return False - -def get_string_id(key): - """Get a string ID, handling the reserved symbols correctly. If the key is - already an ID, return it. - - This function optimises for convenience over performance, so shouldn't be - used in tight loops. - """ - cdef hash_t str_hash - if isinstance(key, str): - if len(key) == 0: - return 0 - - symbol = SYMBOLS_BY_STR.get(key, None) - if symbol is not None: - return symbol - else: - chars = key.encode("utf8") - return hash_utf8(chars, len(chars)) - elif _try_coerce_to_hash(key, &str_hash): - # Coerce the integral key to the expected primitive hash type. - # This ensures that custom/overloaded "primitive" data types - # such as those implemented by numpy are not inadvertently used - # downsteam (as these are internally implemented as custom PyObjects - # whose comparison operators can incur a significant overhead). - return str_hash - else: - # TODO: Raise an error instead - return key - - -cpdef hash_t hash_string(str string) except 0: - chars = string.encode("utf8") - return hash_utf8(chars, len(chars)) - - -cdef hash_t hash_utf8(char* utf8_string, int length) nogil: - return hash64(utf8_string, length, 1) - - -cdef uint32_t hash32_utf8(char* utf8_string, int length) nogil: - return hash32(utf8_string, length, 1) - - -cdef str decode_Utf8Str(const Utf8Str* string): - cdef int i, length - if string.s[0] < sizeof(string.s) and string.s[0] != 0: - return string.s[1:string.s[0]+1].decode("utf8") - elif string.p[0] < 255: - return string.p[1:string.p[0]+1].decode("utf8") - else: - i = 0 - length = 0 - while string.p[i] == 255: - i += 1 - length += 255 - length += string.p[i] - i += 1 - return string.p[i:length + i].decode("utf8") - - -cdef Utf8Str* _allocate(Pool mem, const unsigned char* chars, uint32_t length) except *: - cdef int n_length_bytes - cdef int i - cdef Utf8Str* string = mem.alloc(1, sizeof(Utf8Str)) - cdef uint32_t ulength = length - if length < sizeof(string.s): - string.s[0] = length - memcpy(&string.s[1], chars, length) - return string - elif length < 255: - string.p = mem.alloc(length + 1, sizeof(unsigned char)) - string.p[0] = length - memcpy(&string.p[1], chars, length) - return string - else: - i = 0 - n_length_bytes = (length // 255) + 1 - string.p = mem.alloc(length + n_length_bytes, sizeof(unsigned char)) - for i in range(n_length_bytes-1): - string.p[i] = 255 - string.p[n_length_bytes-1] = length % 255 - memcpy(&string.p[n_length_bytes], chars, length) - return string - cdef class StringStore: - """Look up strings by 64-bit hashes. + """Look up strings by 64-bit hashes. Implicitly handles reserved symbols. DOCS: https://spacy.io/api/stringstore """ - def __init__(self, strings=None, freeze=False): + def __init__(self, strings: Optional[Iterable[str]] = None): """Create the StringStore. strings (iterable): A sequence of unicode strings to add to the store. @@ -123,128 +32,127 @@ cdef class StringStore: for string in strings: self.add(string) - def __getitem__(self, object string_or_id): - """Retrieve a string from a given hash, or vice versa. + def __getitem__(self, string_or_hash: Union[str, int]) -> Union[str, int]: + """Retrieve a string from a given hash. If a string + is passed as the input, add it to the store and return + its hash. - string_or_id (bytes, str or uint64): The value to encode. - Returns (str / uint64): The value to be retrieved. + string_or_hash (int / str): The hash value to lookup or the string to store. + RETURNS (str / int): The stored string or the hash of the newly added string. """ - cdef hash_t str_hash - cdef Utf8Str* utf8str = NULL - - if isinstance(string_or_id, str): - if len(string_or_id) == 0: - return 0 - - # Return early if the string is found in the symbols LUT. - symbol = SYMBOLS_BY_STR.get(string_or_id, None) - if symbol is not None: - return symbol - else: - return hash_string(string_or_id) - elif isinstance(string_or_id, bytes): - return hash_utf8(string_or_id, len(string_or_id)) - elif _try_coerce_to_hash(string_or_id, &str_hash): - if str_hash == 0: - return "" - elif str_hash in SYMBOLS_BY_INT: - return SYMBOLS_BY_INT[str_hash] - else: - utf8str = self._map.get(str_hash) + if isinstance(string_or_hash, str): + return self.add(string_or_hash) else: - # TODO: Raise an error instead - utf8str = self._map.get(string_or_id) + return self._get_interned_str(string_or_hash) - if utf8str is NULL: - raise KeyError(Errors.E018.format(hash_value=string_or_id)) - else: - return decode_Utf8Str(utf8str) + def __contains__(self, string_or_hash: Union[str, int]) -> bool: + """Check whether a string or a hash is in the store. - def as_int(self, key): - """If key is an int, return it; otherwise, get the int value.""" - if not isinstance(key, str): - return key - else: - return self[key] - - def as_string(self, key): - """If key is a string, return it; otherwise, get the string value.""" - if isinstance(key, str): - return key - else: - return self[key] - - def add(self, string): - """Add a string to the StringStore. - - string (str): The string to add. - RETURNS (uint64): The string's hash value. - """ - cdef hash_t str_hash - if isinstance(string, str): - if string in SYMBOLS_BY_STR: - return SYMBOLS_BY_STR[string] - - string = string.encode("utf8") - str_hash = hash_utf8(string, len(string)) - self._intern_utf8(string, len(string), &str_hash) - elif isinstance(string, bytes): - if string in SYMBOLS_BY_STR: - return SYMBOLS_BY_STR[string] - str_hash = hash_utf8(string, len(string)) - self._intern_utf8(string, len(string), &str_hash) - else: - raise TypeError(Errors.E017.format(value_type=type(string))) - return str_hash - - def __len__(self): - """The number of strings in the store. - - RETURNS (int): The number of strings in the store. - """ - return self.keys.size() - - def __contains__(self, string_or_id not None): - """Check whether a string or ID is in the store. - - string_or_id (str or int): The string to check. + string (str / int): The string/hash to check. RETURNS (bool): Whether the store contains the string. """ - cdef hash_t str_hash - if isinstance(string_or_id, str): - if len(string_or_id) == 0: - return True - elif string_or_id in SYMBOLS_BY_STR: - return True - str_hash = hash_string(string_or_id) - elif _try_coerce_to_hash(string_or_id, &str_hash): - pass - else: - # TODO: Raise an error instead - return self._map.get(string_or_id) is not NULL - + cdef hash_t str_hash = get_string_id(string_or_hash) if str_hash in SYMBOLS_BY_INT: return True else: return self._map.get(str_hash) is not NULL - def __iter__(self): - """Iterate over the strings in the store, in order. + def __iter__(self) -> Iterator[str]: + """Iterate over the strings in the store in insertion order. - YIELDS (str): A string in the store. + RETURNS: An iterable collection of strings. """ - cdef int i - cdef hash_t key - for i in range(self.keys.size()): - key = self.keys[i] - utf8str = self._map.get(key) - yield decode_Utf8Str(utf8str) - # TODO: Iterate OOV here? + return iter(self.keys()) def __reduce__(self): strings = list(self) return (StringStore, (strings,), None, None, None) + def __len__(self) -> int: + """The number of strings in the store. + + RETURNS (int): The number of strings in the store. + """ + return self._keys.size() + + def add(self, string: str) -> int: + """Add a string to the StringStore. + + string (str): The string to add. + RETURNS (uint64): The string's hash value. + """ + if not isinstance(string, str): + raise TypeError(Errors.E017.format(value_type=type(string))) + + if string in SYMBOLS_BY_STR: + return SYMBOLS_BY_STR[string] + else: + return self._intern_str(string) + + def as_int(self, string_or_hash: Union[str, int]) -> str: + """If a hash value is passed as the input, return it as-is. If the input + is a string, return its corresponding hash. + + string_or_hash (str / int): The string to hash or a hash value. + RETURNS (int): The hash of the string or the input hash value. + """ + if isinstance(string_or_hash, int): + return string_or_hash + else: + return get_string_id(string_or_hash) + + def as_string(self, string_or_hash: Union[str, int]) -> str: + """If a string is passed as the input, return it as-is. If the input + is a hash value, return its corresponding string. + + string_or_hash (str / int): The hash value to lookup or a string. + RETURNS (str): The stored string or the input string. + """ + if isinstance(string_or_hash, str): + return string_or_hash + else: + return self._get_interned_str(string_or_hash) + + def items(self) -> List[Tuple[str, int]]: + """Iterate over the stored strings and their hashes in insertion order. + + RETURNS: A list of string-hash pairs. + """ + # Even though we internally store the hashes as keys and the strings as + # values, we invert the order in the public API to keep it consistent with + # the implementation of the `__iter__` method (where we wish to iterate over + # the strings in the store). + cdef int i + pairs = [None] * self._keys.size() + for i in range(self._keys.size()): + str_hash = self._keys[i] + utf8str = self._map.get(str_hash) + pairs[i] = (self._decode_str_repr(utf8str), str_hash) + return pairs + + def keys(self) -> List[str]: + """Iterate over the stored strings in insertion order. + + RETURNS: A list of strings. + """ + cdef int i + strings = [None] * self._keys.size() + for i in range(self._keys.size()): + utf8str = self._map.get(self._keys[i]) + strings[i] = self._decode_str_repr(utf8str) + return strings + + def values(self) -> List[int]: + """Iterate over the stored strings hashes in insertion order. + + RETURNS: A list of string hashs. + """ + cdef int i + hashes = [None] * self._keys.size() + for i in range(self._keys.size()): + hashes[i] = self._keys[i] + return hashes + def to_disk(self, path): """Save the current state to a directory. @@ -294,24 +202,122 @@ cdef class StringStore: def _reset_and_load(self, strings): self.mem = Pool() self._map = PreshMap() - self.keys.clear() + self._keys.clear() for string in strings: self.add(string) - cdef const Utf8Str* intern_unicode(self, str py_string): - # 0 means missing, but we don't bother offsetting the index. - cdef bytes byte_string = py_string.encode("utf8") - return self._intern_utf8(byte_string, len(byte_string), NULL) + def _get_interned_str(self, hash_value: int) -> str: + cdef hash_t str_hash + if not _try_coerce_to_hash(hash_value, &str_hash): + raise TypeError(Errors.E4001.format(expected_types="'int'", received_type=type(hash_value))) - @cython.final - cdef const Utf8Str* _intern_utf8(self, char* utf8_string, int length, hash_t* precalculated_hash): + # Handle reserved symbols and empty strings correctly. + if str_hash == 0: + return "" + + symbol = SYMBOLS_BY_INT.get(str_hash) + if symbol is not None: + return symbol + + utf8str = self._map.get(str_hash) + if utf8str is NULL: + raise KeyError(Errors.E018.format(hash_value=str_hash)) + else: + return self._decode_str_repr(utf8str) + + cdef hash_t _intern_str(self, str string): # TODO: This function's API/behaviour is an unholy mess... # 0 means missing, but we don't bother offsetting the index. - cdef hash_t key = precalculated_hash[0] if precalculated_hash is not NULL else hash_utf8(utf8_string, length) + chars = string.encode('utf-8') + cdef hash_t key = hash64(chars, len(chars), 1) cdef Utf8Str* value = self._map.get(key) if value is not NULL: - return value - value = _allocate(self.mem, utf8_string, length) + return key + + value = self._allocate_str_repr(chars, len(chars)) self._map.set(key, value) - self.keys.push_back(key) - return value + self._keys.push_back(key) + return key + + cdef Utf8Str* _allocate_str_repr(self, const unsigned char* chars, uint32_t length) except *: + cdef int n_length_bytes + cdef int i + cdef Utf8Str* string = self.mem.alloc(1, sizeof(Utf8Str)) + cdef uint32_t ulength = length + if length < sizeof(string.s): + string.s[0] = length + memcpy(&string.s[1], chars, length) + return string + elif length < 255: + string.p = self.mem.alloc(length + 1, sizeof(unsigned char)) + string.p[0] = length + memcpy(&string.p[1], chars, length) + return string + else: + i = 0 + n_length_bytes = (length // 255) + 1 + string.p = self.mem.alloc(length + n_length_bytes, sizeof(unsigned char)) + for i in range(n_length_bytes-1): + string.p[i] = 255 + string.p[n_length_bytes-1] = length % 255 + memcpy(&string.p[n_length_bytes], chars, length) + return string + + cdef str _decode_str_repr(self, const Utf8Str* string): + cdef int i, length + if string.s[0] < sizeof(string.s) and string.s[0] != 0: + return string.s[1:string.s[0]+1].decode('utf-8') + elif string.p[0] < 255: + return string.p[1:string.p[0]+1].decode('utf-8') + else: + i = 0 + length = 0 + while string.p[i] == 255: + i += 1 + length += 255 + length += string.p[i] + i += 1 + return string.p[i:length + i].decode('utf-8') + + +cpdef hash_t hash_string(object string) except -1: + if not isinstance(string, str): + raise TypeError(Errors.E4001.format(expected_types="'str'", received_type=type(string))) + + # Handle reserved symbols and empty strings correctly. + if len(string) == 0: + return 0 + + symbol = SYMBOLS_BY_STR.get(string) + if symbol is not None: + return symbol + + chars = string.encode('utf-8') + return hash64(chars, len(chars), 1) + + +cpdef hash_t get_string_id(object string_or_hash) except -1: + cdef hash_t str_hash + + try: + return hash_string(string_or_hash) + except: + if _try_coerce_to_hash(string_or_hash, &str_hash): + # Coerce the integral key to the expected primitive hash type. + # This ensures that custom/overloaded "primitive" data types + # such as those implemented by numpy are not inadvertently used + # downsteam (as these are internally implemented as custom PyObjects + # whose comparison operators can incur a significant overhead). + return str_hash + else: + raise TypeError(Errors.E4001.format(expected_types="'str','int'", received_type=type(string_or_hash))) + + +# Not particularly elegant, but this is faster than `isinstance(key, numbers.Integral)` +cdef inline bint _try_coerce_to_hash(object key, hash_t* out_hash): + try: + out_hash[0] = key + return True + except: + return False + diff --git a/spacy/tests/vocab_vectors/test_stringstore.py b/spacy/tests/vocab_vectors/test_stringstore.py index a0f8016af..f86c0f10d 100644 --- a/spacy/tests/vocab_vectors/test_stringstore.py +++ b/spacy/tests/vocab_vectors/test_stringstore.py @@ -24,6 +24,14 @@ def test_stringstore_from_api_docs(stringstore): stringstore.add("orange") all_strings = [s for s in stringstore] assert all_strings == ["apple", "orange"] + assert all_strings == list(stringstore.keys()) + all_strings_and_hashes = list(stringstore.items()) + assert all_strings_and_hashes == [ + ("apple", 8566208034543834098), + ("orange", 2208928596161743350), + ] + all_hashes = list(stringstore.values()) + assert all_hashes == [8566208034543834098, 2208928596161743350] banana_hash = stringstore.add("banana") assert len(stringstore) == 3 assert banana_hash == 2525716904149915114 @@ -31,12 +39,25 @@ def test_stringstore_from_api_docs(stringstore): assert stringstore["banana"] == banana_hash -@pytest.mark.parametrize("text1,text2,text3", [(b"Hello", b"goodbye", b"hello")]) -def test_stringstore_save_bytes(stringstore, text1, text2, text3): - key = stringstore.add(text1) - assert stringstore[text1] == key - assert stringstore[text2] != key - assert stringstore[text3] != key +@pytest.mark.parametrize( + "val_bytes,val_float,val_list,val_text,val_hash", + [(b"Hello", 1.1, ["abc"], "apple", 8566208034543834098)], +) +def test_stringstore_type_checking( + stringstore, val_bytes, val_float, val_list, val_text, val_hash +): + with pytest.raises(TypeError): + assert stringstore[val_bytes] + + with pytest.raises(TypeError): + stringstore.add(val_float) + + with pytest.raises(TypeError): + assert val_list not in stringstore + + key = stringstore.add(val_text) + assert val_hash == key + assert stringstore[val_hash] == val_text @pytest.mark.parametrize("text1,text2,text3", [("Hello", "goodbye", "hello")]) @@ -47,19 +68,19 @@ def test_stringstore_save_unicode(stringstore, text1, text2, text3): assert stringstore[text3] != key -@pytest.mark.parametrize("text", [b"A"]) +@pytest.mark.parametrize("text", ["A"]) def test_stringstore_retrieve_id(stringstore, text): key = stringstore.add(text) assert len(stringstore) == 1 - assert stringstore[key] == text.decode("utf8") + assert stringstore[key] == text with pytest.raises(KeyError): stringstore[20000] -@pytest.mark.parametrize("text1,text2", [(b"0123456789", b"A")]) +@pytest.mark.parametrize("text1,text2", [("0123456789", "A")]) def test_stringstore_med_string(stringstore, text1, text2): store = stringstore.add(text1) - assert stringstore[store] == text1.decode("utf8") + assert stringstore[store] == text1 stringstore.add(text2) assert stringstore[text1] == store diff --git a/spacy/tokens/graph.pyx b/spacy/tokens/graph.pyx index adc4d23c8..0ae0d94c7 100644 --- a/spacy/tokens/graph.pyx +++ b/spacy/tokens/graph.pyx @@ -12,7 +12,7 @@ from murmurhash.mrmr cimport hash64 from .. import Errors from ..typedefs cimport hash_t -from ..strings import get_string_id +from ..strings cimport get_string_id from ..structs cimport EdgeC, GraphC from .token import Token diff --git a/spacy/tokens/retokenizer.pyx b/spacy/tokens/retokenizer.pyx index 43e6d4aa7..29143bed3 100644 --- a/spacy/tokens/retokenizer.pyx +++ b/spacy/tokens/retokenizer.pyx @@ -18,7 +18,7 @@ from .underscore import is_writable_attr from ..attrs import intify_attrs from ..util import SimpleFrozenDict from ..errors import Errors -from ..strings import get_string_id +from ..strings cimport get_string_id cdef class Retokenizer: diff --git a/website/docs/api/stringstore.md b/website/docs/api/stringstore.md index cd414b1f0..b509659ef 100644 --- a/website/docs/api/stringstore.md +++ b/website/docs/api/stringstore.md @@ -40,7 +40,8 @@ Get the number of strings in the store. ## StringStore.\_\_getitem\_\_ {#getitem tag="method"} -Retrieve a string from a given hash, or vice versa. +Retrieve a string from a given hash. If a string is passed as the input, add it +to the store and return its hash. > #### Example > @@ -51,14 +52,14 @@ Retrieve a string from a given hash, or vice versa. > assert stringstore[apple_hash] == "apple" > ``` -| Name | Description | -| -------------- | ----------------------------------------------- | -| `string_or_id` | The value to encode. ~~Union[bytes, str, int]~~ | -| **RETURNS** | The value to be retrieved. ~~Union[str, int]~~ | +| Name | Description | +| ---------------- | ---------------------------------------------------------------------------- | +| `string_or_hash` | The hash value to lookup or the string to store. ~~Union[str, int]~~ | +| **RETURNS** | The stored string or the hash of the newly added string. ~~Union[str, int]~~ | ## StringStore.\_\_contains\_\_ {#contains tag="method"} -Check whether a string is in the store. +Check whether a string or a hash is in the store. > #### Example > @@ -68,15 +69,14 @@ Check whether a string is in the store. > assert not "cherry" in stringstore > ``` -| Name | Description | -| ----------- | ----------------------------------------------- | -| `string` | The string to check. ~~str~~ | -| **RETURNS** | Whether the store contains the string. ~~bool~~ | +| Name | Description | +| ---------------- | ------------------------------------------------------- | +| `string_or_hash` | The string or hash to check. ~~Union[str, int]~~ | +| **RETURNS** | Whether the store contains the string or hash. ~~bool~~ | ## StringStore.\_\_iter\_\_ {#iter tag="method"} -Iterate over the strings in the store, in order. Note that a newly initialized -store will always include an empty string `""` at position `0`. +Iterate over the stored strings in insertion order. > #### Example > @@ -86,11 +86,59 @@ store will always include an empty string `""` at position `0`. > assert all_strings == ["apple", "orange"] > ``` -| Name | Description | -| ---------- | ------------------------------ | -| **YIELDS** | A string in the store. ~~str~~ | +| Name | Description | +| ----------- | ------------------------------ | +| **RETURNS** | A string in the store. ~~str~~ | -## StringStore.add {#add tag="method" new="2"} +## StringStore.items {#iter tag="method" new="4"} + +Iterate over the stored string-hash pairs in insertion order. + +> #### Example +> +> ```python +> stringstore = StringStore(["apple", "orange"]) +> all_strings_and_hashes = stringstore.items() +> assert all_strings_and_hashes == [("apple", 8566208034543834098), ("orange", 2208928596161743350)] +> ``` + +| Name | Description | +| ----------- | ------------------------------------------------------ | +| **RETURNS** | A list of string-hash pairs. ~~List[Tuple[str, int]]~~ | + +## StringStore.keys {#iter tag="method" new="4"} + +Iterate over the stored strings in insertion order. + +> #### Example +> +> ```python +> stringstore = StringStore(["apple", "orange"]) +> all_strings = stringstore.keys() +> assert all_strings == ["apple", "orange"] +> ``` + +| Name | Description | +| ----------- | -------------------------------- | +| **RETURNS** | A list of strings. ~~List[str]~~ | + +## StringStore.values {#iter tag="method" new="4"} + +Iterate over the stored string hashes in insertion order. + +> #### Example +> +> ```python +> stringstore = StringStore(["apple", "orange"]) +> all_hashes = stringstore.values() +> assert all_hashes == [8566208034543834098, 2208928596161743350] +> ``` + +| Name | Description | +| ----------- | -------------------------------------- | +| **RETURNS** | A list of string hashes. ~~List[int]~~ | + +## StringStore.add {#add tag="method"} Add a string to the `StringStore`. @@ -110,7 +158,7 @@ Add a string to the `StringStore`. | `string` | The string to add. ~~str~~ | | **RETURNS** | The string's hash value. ~~int~~ | -## StringStore.to_disk {#to_disk tag="method" new="2"} +## StringStore.to_disk {#to_disk tag="method"} Save the current state to a directory. From ef74f8f5e447dec10ab69d2a7e94f0e09165db75 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Tue, 11 Oct 2022 14:15:22 +0200 Subject: [PATCH 038/161] Fix mypy error in edittree lemmatizer (#11612) * cleanup imports * try limiting Thinc to previous release * remove Model specification * fix code and revert Thinc constraint --- spacy/pipeline/edit_tree_lemmatizer.py | 5 ++--- 1 file changed, 2 insertions(+), 3 deletions(-) diff --git a/spacy/pipeline/edit_tree_lemmatizer.py b/spacy/pipeline/edit_tree_lemmatizer.py index b7d615f6d..7f6367c75 100644 --- a/spacy/pipeline/edit_tree_lemmatizer.py +++ b/spacy/pipeline/edit_tree_lemmatizer.py @@ -1,7 +1,6 @@ from typing import cast, Any, Callable, Dict, Iterable, List, Optional -from typing import Sequence, Tuple, Union +from typing import Tuple from collections import Counter -from copy import deepcopy from itertools import islice import numpy as np @@ -150,7 +149,7 @@ class EditTreeLemmatizer(TrainablePipe): # Handle cases where there are no tokens in any docs. n_labels = len(self.cfg["labels"]) guesses: List[Ints2d] = [ - self.model.ops.alloc((0, n_labels), dtype="i") for doc in docs + self.model.ops.alloc2i(0, n_labels, dtype="i") for _ in docs ] assert len(guesses) == n_docs return guesses From 29649589fc889a58c8b631d569d4ae378a10aa2b Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Tue, 11 Oct 2022 15:25:05 +0200 Subject: [PATCH 039/161] remove dtype (#11615) --- spacy/pipeline/edit_tree_lemmatizer.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/pipeline/edit_tree_lemmatizer.py b/spacy/pipeline/edit_tree_lemmatizer.py index 7f6367c75..76b0e0bc9 100644 --- a/spacy/pipeline/edit_tree_lemmatizer.py +++ b/spacy/pipeline/edit_tree_lemmatizer.py @@ -149,7 +149,7 @@ class EditTreeLemmatizer(TrainablePipe): # Handle cases where there are no tokens in any docs. n_labels = len(self.cfg["labels"]) guesses: List[Ints2d] = [ - self.model.ops.alloc2i(0, n_labels, dtype="i") for _ in docs + self.model.ops.alloc2i(0, n_labels) for _ in docs ] assert len(guesses) == n_docs return guesses From 2e52479eec987367117d27fb4f049df2efb2518d Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Tue, 11 Oct 2022 23:45:05 +0900 Subject: [PATCH 040/161] Fix example code for spacy-wordnet (#11593) * Fix example code for spacy-wordnet It looks like in the most recent version, 0.1.0, it's no longer possible to pass the lang parameter to the component separately. Doing so will raise an error. * Apply suggestions from code review Co-authored-by: Sofie Van Landeghem * Cleanup * More cleanup Co-authored-by: Sofie Van Landeghem --- website/meta/universe.json | 14 +++++++------- 1 file changed, 7 insertions(+), 7 deletions(-) diff --git a/website/meta/universe.json b/website/meta/universe.json index a6a1a0fc7..637e9d6ce 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -2460,20 +2460,20 @@ "import spacy", "from spacy_wordnet.wordnet_annotator import WordnetAnnotator ", "", - "# Load an spacy model (supported models are \"es\" and \"en\") ", - "nlp = spacy.load('en')", - "# Spacy 3.x", - "nlp.add_pipe(\"spacy_wordnet\", after='tagger', config={'lang': nlp.lang})", - "# Spacy 2.x", + "# Load a spaCy model (supported languages are \"es\" and \"en\") ", + "nlp = spacy.load('en_core_web_sm')", + "# spaCy 3.x", + "nlp.add_pipe(\"spacy_wordnet\", after='tagger')", + "# spaCy 2.x", "# nlp.add_pipe(WordnetAnnotator(nlp.lang), after='tagger')", "token = nlp('prices')[0]", "", - "# wordnet object link spacy token with nltk wordnet interface by giving acces to", + "# WordNet object links spaCy token with NLTK WordNet interface by giving access to", "# synsets and lemmas ", "token._.wordnet.synsets()", "token._.wordnet.lemmas()", "", - "# And automatically tags with wordnet domains", + "# And automatically add info about WordNet domains", "token._.wordnet.wordnet_domains()" ], "author": "recognai", From fe06e037bcd733708401bce082863994b1fc48bd Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Wed, 12 Oct 2022 12:18:39 +0200 Subject: [PATCH 041/161] Fix init for pymorphy2_lookup lemmatizer mode (#11631) --- spacy/lang/ru/lemmatizer.py | 2 +- spacy/lang/uk/lemmatizer.py | 2 +- spacy/tests/conftest.py | 17 +++++++++++++++++ spacy/tests/lang/ru/test_lemmatizer.py | 14 ++++++++++++++ spacy/tests/lang/uk/test_lemmatizer.py | 8 ++++++++ 5 files changed, 41 insertions(+), 2 deletions(-) diff --git a/spacy/lang/ru/lemmatizer.py b/spacy/lang/ru/lemmatizer.py index 85180b1e4..5bf685d44 100644 --- a/spacy/lang/ru/lemmatizer.py +++ b/spacy/lang/ru/lemmatizer.py @@ -23,7 +23,7 @@ class RussianLemmatizer(Lemmatizer): overwrite: bool = False, scorer: Optional[Callable] = lemmatizer_score, ) -> None: - if mode == "pymorphy2": + if mode in {"pymorphy2", "pymorphy2_lookup"}: try: from pymorphy2 import MorphAnalyzer except ImportError: diff --git a/spacy/lang/uk/lemmatizer.py b/spacy/lang/uk/lemmatizer.py index a8bc56057..d4f8cc9e5 100644 --- a/spacy/lang/uk/lemmatizer.py +++ b/spacy/lang/uk/lemmatizer.py @@ -18,7 +18,7 @@ class UkrainianLemmatizer(RussianLemmatizer): overwrite: bool = False, scorer: Optional[Callable] = lemmatizer_score, ) -> None: - if mode == "pymorphy2": + if mode in {"pymorphy2", "pymorphy2_lookup"}: try: from pymorphy2 import MorphAnalyzer except ImportError: diff --git a/spacy/tests/conftest.py b/spacy/tests/conftest.py index 742bfcc6a..394ef00d3 100644 --- a/spacy/tests/conftest.py +++ b/spacy/tests/conftest.py @@ -343,6 +343,14 @@ def ru_lemmatizer(): return get_lang_class("ru")().add_pipe("lemmatizer") +@pytest.fixture +def ru_lookup_lemmatizer(): + pytest.importorskip("pymorphy2") + return get_lang_class("ru")().add_pipe( + "lemmatizer", config={"mode": "pymorphy2_lookup"} + ) + + @pytest.fixture(scope="session") def sa_tokenizer(): return get_lang_class("sa")().tokenizer @@ -422,6 +430,15 @@ def uk_lemmatizer(): return get_lang_class("uk")().add_pipe("lemmatizer") +@pytest.fixture +def uk_lookup_lemmatizer(): + pytest.importorskip("pymorphy2") + pytest.importorskip("pymorphy2_dicts_uk") + return get_lang_class("uk")().add_pipe( + "lemmatizer", config={"mode": "pymorphy2_lookup"} + ) + + @pytest.fixture(scope="session") def ur_tokenizer(): return get_lang_class("ur")().tokenizer diff --git a/spacy/tests/lang/ru/test_lemmatizer.py b/spacy/tests/lang/ru/test_lemmatizer.py index 9ca7f441b..e82fd4f8c 100644 --- a/spacy/tests/lang/ru/test_lemmatizer.py +++ b/spacy/tests/lang/ru/test_lemmatizer.py @@ -78,3 +78,17 @@ def test_ru_lemmatizer_punct(ru_lemmatizer): assert ru_lemmatizer.pymorphy2_lemmatize(doc[0]) == ['"'] doc = Doc(ru_lemmatizer.vocab, words=["»"], pos=["PUNCT"]) assert ru_lemmatizer.pymorphy2_lemmatize(doc[0]) == ['"'] + + +def test_ru_doc_lookup_lemmatization(ru_lookup_lemmatizer): + words = ["мама", "мыла", "раму"] + pos = ["NOUN", "VERB", "NOUN"] + morphs = [ + "Animacy=Anim|Case=Nom|Gender=Fem|Number=Sing", + "Aspect=Imp|Gender=Fem|Mood=Ind|Number=Sing|Tense=Past|VerbForm=Fin|Voice=Act", + "Animacy=Anim|Case=Acc|Gender=Fem|Number=Sing", + ] + doc = Doc(ru_lookup_lemmatizer.vocab, words=words, pos=pos, morphs=morphs) + doc = ru_lookup_lemmatizer(doc) + lemmas = [token.lemma_ for token in doc] + assert lemmas == ["мама", "мыла", "раму"] diff --git a/spacy/tests/lang/uk/test_lemmatizer.py b/spacy/tests/lang/uk/test_lemmatizer.py index 57dd4198a..788744aa1 100644 --- a/spacy/tests/lang/uk/test_lemmatizer.py +++ b/spacy/tests/lang/uk/test_lemmatizer.py @@ -9,3 +9,11 @@ def test_uk_lemmatizer(uk_lemmatizer): """Check that the default uk lemmatizer runs.""" doc = Doc(uk_lemmatizer.vocab, words=["a", "b", "c"]) uk_lemmatizer(doc) + assert [token.lemma for token in doc] + + +def test_uk_lookup_lemmatizer(uk_lookup_lemmatizer): + """Check that the lookup uk lemmatizer runs.""" + doc = Doc(uk_lookup_lemmatizer.vocab, words=["a", "b", "c"]) + uk_lookup_lemmatizer(doc) + assert [token.lemma for token in doc] From 4d869fcc111151bcefa08ee1a2b7b49dc5ecd677 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Wed, 12 Oct 2022 15:17:40 +0200 Subject: [PATCH 042/161] Small fixes to docstrings (#11610) * add missing scorer arg to docstring * fix class names in textcat_multilabel * add missing scorer to docstrings --- spacy/pipeline/spancat.py | 3 +++ spacy/pipeline/textcat_multilabel.py | 6 ++++-- 2 files changed, 7 insertions(+), 2 deletions(-) diff --git a/spacy/pipeline/spancat.py b/spacy/pipeline/spancat.py index 1b7a9eecb..ca9f1dab0 100644 --- a/spacy/pipeline/spancat.py +++ b/spacy/pipeline/spancat.py @@ -133,6 +133,9 @@ def make_spancat( spans_key (str): Key of the doc.spans dict to save the spans under. During initialization and training, the component will look for spans on the reference document under the same key. + scorer (Optional[Callable]): The scoring method. Defaults to + Scorer.score_spans for the Doc.spans[spans_key] with overlapping + spans allowed. threshold (float): Minimum probability to consider a prediction positive. Spans with a positive prediction will be saved on the Doc. Defaults to 0.5. diff --git a/spacy/pipeline/textcat_multilabel.py b/spacy/pipeline/textcat_multilabel.py index e33a885f8..119ae3310 100644 --- a/spacy/pipeline/textcat_multilabel.py +++ b/spacy/pipeline/textcat_multilabel.py @@ -96,8 +96,8 @@ def make_multilabel_textcat( model: Model[List[Doc], List[Floats2d]], threshold: float, scorer: Optional[Callable], -) -> "TextCategorizer": - """Create a TextCategorizer component. The text categorizer predicts categories +) -> "MultiLabel_TextCategorizer": + """Create a MultiLabel_TextCategorizer component. The text categorizer predicts categories over a whole document. It can learn one or more labels, and the labels are considered to be non-mutually exclusive, which means that there can be zero or more labels per doc). @@ -105,6 +105,7 @@ def make_multilabel_textcat( model (Model[List[Doc], List[Floats2d]]): A model instance that predicts scores for each category. threshold (float): Cutoff to consider a prediction "positive". + scorer (Optional[Callable]): The scoring method. """ return MultiLabel_TextCategorizer( nlp.vocab, model, name, threshold=threshold, scorer=scorer @@ -147,6 +148,7 @@ class MultiLabel_TextCategorizer(TextCategorizer): name (str): The component instance name, used to add entries to the losses during training. threshold (float): Cutoff to consider a prediction "positive". + scorer (Optional[Callable]): The scoring method. DOCS: https://spacy.io/api/textcategorizer#init """ From 6b5a3e72198aa9735587b0712e3eb2c24234b463 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Fri, 14 Oct 2022 08:16:49 +0200 Subject: [PATCH 043/161] Extend to pydantic v1.10 (#11635) * Update types in `spacy.schemas` for updated pydantic+mypy --- requirements.txt | 2 +- setup.cfg | 2 +- spacy/schemas.py | 18 +++++++++--------- 3 files changed, 11 insertions(+), 11 deletions(-) diff --git a/requirements.txt b/requirements.txt index 14847ff21..9d6bbb2c4 100644 --- a/requirements.txt +++ b/requirements.txt @@ -15,7 +15,7 @@ pathy>=0.3.5 numpy>=1.15.0 requests>=2.13.0,<3.0.0 tqdm>=4.38.0,<5.0.0 -pydantic>=1.7.4,!=1.8,!=1.8.1,<1.10.0 +pydantic>=1.7.4,!=1.8,!=1.8.1,<1.11.0 jinja2 langcodes>=3.2.0,<4.0.0 # Official Python utilities diff --git a/setup.cfg b/setup.cfg index 2dc5e7042..c2653feba 100644 --- a/setup.cfg +++ b/setup.cfg @@ -56,7 +56,7 @@ install_requires = tqdm>=4.38.0,<5.0.0 numpy>=1.15.0 requests>=2.13.0,<3.0.0 - pydantic>=1.7.4,!=1.8,!=1.8.1,<1.10.0 + pydantic>=1.7.4,!=1.8,!=1.8.1,<1.11.0 jinja2 # Official Python utilities setuptools diff --git a/spacy/schemas.py b/spacy/schemas.py index 048082134..ab71b2016 100644 --- a/spacy/schemas.py +++ b/spacy/schemas.py @@ -181,12 +181,12 @@ class TokenPatternNumber(BaseModel): IS_SUBSET: Optional[List[StrictInt]] = Field(None, alias="is_subset") IS_SUPERSET: Optional[List[StrictInt]] = Field(None, alias="is_superset") INTERSECTS: Optional[List[StrictInt]] = Field(None, alias="intersects") - EQ: Union[StrictInt, StrictFloat] = Field(None, alias="==") - NEQ: Union[StrictInt, StrictFloat] = Field(None, alias="!=") - GEQ: Union[StrictInt, StrictFloat] = Field(None, alias=">=") - LEQ: Union[StrictInt, StrictFloat] = Field(None, alias="<=") - GT: Union[StrictInt, StrictFloat] = Field(None, alias=">") - LT: Union[StrictInt, StrictFloat] = Field(None, alias="<") + EQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="==") + NEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="!=") + GEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias=">=") + LEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="<=") + GT: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias=">") + LT: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="<") class Config: extra = "forbid" @@ -430,7 +430,7 @@ class ProjectConfigAssetURL(BaseModel): # fmt: off dest: StrictStr = Field(..., title="Destination of downloaded asset") url: Optional[StrictStr] = Field(None, title="URL of asset") - checksum: str = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})") + checksum: Optional[str] = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})") description: StrictStr = Field("", title="Description of asset") # fmt: on @@ -438,7 +438,7 @@ class ProjectConfigAssetURL(BaseModel): class ProjectConfigAssetGit(BaseModel): # fmt: off git: ProjectConfigAssetGitItem = Field(..., title="Git repo information") - checksum: str = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})") + checksum: Optional[str] = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})") description: Optional[StrictStr] = Field(None, title="Description of asset") # fmt: on @@ -508,7 +508,7 @@ class DocJSONSchema(BaseModel): None, title="Indices of sentences' start and end indices" ) text: StrictStr = Field(..., title="Document text") - spans: Dict[StrictStr, List[Dict[StrictStr, Union[StrictStr, StrictInt]]]] = Field( + spans: Optional[Dict[StrictStr, List[Dict[StrictStr, Union[StrictStr, StrictInt]]]]] = Field( None, title="Span information - end/start indices, label, KB ID" ) tokens: List[Dict[StrictStr, Union[StrictStr, StrictInt]]] = Field( From ceb62352bfcad49b3ad63e3e65ef12dabab645b3 Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 14 Oct 2022 18:04:55 +0900 Subject: [PATCH 044/161] Auto-format code with black (#11649) Co-authored-by: explosion-bot --- spacy/pipeline/edit_tree_lemmatizer.py | 4 +--- spacy/schemas.py | 6 +++--- 2 files changed, 4 insertions(+), 6 deletions(-) diff --git a/spacy/pipeline/edit_tree_lemmatizer.py b/spacy/pipeline/edit_tree_lemmatizer.py index 76b0e0bc9..12f9b73a3 100644 --- a/spacy/pipeline/edit_tree_lemmatizer.py +++ b/spacy/pipeline/edit_tree_lemmatizer.py @@ -148,9 +148,7 @@ class EditTreeLemmatizer(TrainablePipe): if not any(len(doc) for doc in docs): # Handle cases where there are no tokens in any docs. n_labels = len(self.cfg["labels"]) - guesses: List[Ints2d] = [ - self.model.ops.alloc2i(0, n_labels) for _ in docs - ] + guesses: List[Ints2d] = [self.model.ops.alloc2i(0, n_labels) for _ in docs] assert len(guesses) == n_docs return guesses scores = self.model.predict(docs) diff --git a/spacy/schemas.py b/spacy/schemas.py index ab71b2016..a67d96d9d 100644 --- a/spacy/schemas.py +++ b/spacy/schemas.py @@ -508,9 +508,9 @@ class DocJSONSchema(BaseModel): None, title="Indices of sentences' start and end indices" ) text: StrictStr = Field(..., title="Document text") - spans: Optional[Dict[StrictStr, List[Dict[StrictStr, Union[StrictStr, StrictInt]]]]] = Field( - None, title="Span information - end/start indices, label, KB ID" - ) + spans: Optional[ + Dict[StrictStr, List[Dict[StrictStr, Union[StrictStr, StrictInt]]]] + ] = Field(None, title="Span information - end/start indices, label, KB ID") tokens: List[Dict[StrictStr, Union[StrictStr, StrictInt]]] = Field( ..., title="Token information - ID, start, annotations" ) From 2ce6aadda2d455cf2f2a1aef494b2bafe3e07119 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Mon, 17 Oct 2022 12:10:03 +0200 Subject: [PATCH 045/161] update default configs to recent versions (#11618) --- spacy/pipeline/spancat.py | 6 +++--- spacy/pipeline/textcat_multilabel.py | 4 ++-- 2 files changed, 5 insertions(+), 5 deletions(-) diff --git a/spacy/pipeline/spancat.py b/spacy/pipeline/spancat.py index 1b7a9eecb..5ede622c2 100644 --- a/spacy/pipeline/spancat.py +++ b/spacy/pipeline/spancat.py @@ -26,17 +26,17 @@ scorer = {"@layers": "spacy.LinearLogistic.v1"} hidden_size = 128 [model.tok2vec] -@architectures = "spacy.Tok2Vec.v1" +@architectures = "spacy.Tok2Vec.v2" [model.tok2vec.embed] -@architectures = "spacy.MultiHashEmbed.v1" +@architectures = "spacy.MultiHashEmbed.v2" width = 96 rows = [5000, 2000, 1000, 1000] attrs = ["ORTH", "PREFIX", "SUFFIX", "SHAPE"] include_static_vectors = false [model.tok2vec.encode] -@architectures = "spacy.MaxoutWindowEncoder.v1" +@architectures = "spacy.MaxoutWindowEncoder.v2" width = ${model.tok2vec.embed.width} window_size = 1 maxout_pieces = 3 diff --git a/spacy/pipeline/textcat_multilabel.py b/spacy/pipeline/textcat_multilabel.py index e33a885f8..10aef46aa 100644 --- a/spacy/pipeline/textcat_multilabel.py +++ b/spacy/pipeline/textcat_multilabel.py @@ -19,7 +19,7 @@ multi_label_default_config = """ @architectures = "spacy.TextCatEnsemble.v2" [model.tok2vec] -@architectures = "spacy.Tok2Vec.v1" +@architectures = "spacy.Tok2Vec.v2" [model.tok2vec.embed] @architectures = "spacy.MultiHashEmbed.v2" @@ -29,7 +29,7 @@ attrs = ["ORTH", "LOWER", "PREFIX", "SUFFIX", "SHAPE", "ID"] include_static_vectors = false [model.tok2vec.encode] -@architectures = "spacy.MaxoutWindowEncoder.v1" +@architectures = "spacy.MaxoutWindowEncoder.v2" width = ${model.tok2vec.embed.width} window_size = 1 maxout_pieces = 3 From 858565a5671de61334443d6a2348164bc39216e1 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Tue, 18 Oct 2022 15:11:39 +0900 Subject: [PATCH 046/161] Fix issues with DVC commands (#11592) * Fix flag handling in dvc Prior to this commit, if a flag (--verbose or --quiet) was passed to DVC, it would be added to the end of the generated dvc command line. This would result in the command being interpreted as part of the actual command to run, rather than an argument to dvc. This would result in command lines like: spacy project run preprocess --verbose That would fail with an error that there's no such directory as `--verbose`. This change puts the flags at the front of the dvc command so that they are interpreted correctly. It removes the `run_dvc_commands` function, which had been reduced to just a for loop and wasn't used elsewhere. A separate problem is that there's no way to specify the quiet behaviour to dvc from the command line, though it's unclear if that's a bug. * Add dvc quiet flag to docs * Handle case in DVC where no commands are appropriate If only have commands with no deps or outputs (admittedly unlikely), you get a weird error about the dvc file not existing. This gives explicit output instead. * Add support for quiet flag * Fix command execution Commands are strings now because they're joined further up. --- spacy/cli/project/dvc.py | 57 +++++++++++++++++++++------------------- website/docs/api/cli.md | 3 ++- 2 files changed, 32 insertions(+), 28 deletions(-) diff --git a/spacy/cli/project/dvc.py b/spacy/cli/project/dvc.py index 83dc5efbf..a15353855 100644 --- a/spacy/cli/project/dvc.py +++ b/spacy/cli/project/dvc.py @@ -25,6 +25,7 @@ def project_update_dvc_cli( project_dir: Path = Arg(Path.cwd(), help="Location of project directory. Defaults to current working directory.", exists=True, file_okay=False), workflow: Optional[str] = Arg(None, help=f"Name of workflow defined in {PROJECT_FILE}. Defaults to first workflow if not set."), verbose: bool = Opt(False, "--verbose", "-V", help="Print more info"), + quiet: bool = Opt(False, "--quiet", "-q", help="Print less info"), force: bool = Opt(False, "--force", "-F", help="Force update DVC config"), # fmt: on ): @@ -36,7 +37,7 @@ def project_update_dvc_cli( DOCS: https://spacy.io/api/cli#project-dvc """ - project_update_dvc(project_dir, workflow, verbose=verbose, force=force) + project_update_dvc(project_dir, workflow, verbose=verbose, quiet=quiet, force=force) def project_update_dvc( @@ -44,6 +45,7 @@ def project_update_dvc( workflow: Optional[str] = None, *, verbose: bool = False, + quiet: bool = False, force: bool = False, ) -> None: """Update the auto-generated Data Version Control (DVC) config file. A DVC @@ -54,11 +56,12 @@ def project_update_dvc( workflow (Optional[str]): Optional name of workflow defined in project.yml. If not set, the first workflow will be used. verbose (bool): Print more info. + quiet (bool): Print less info. force (bool): Force update DVC config. """ config = load_project_config(project_dir) updated = update_dvc_config( - project_dir, config, workflow, verbose=verbose, force=force + project_dir, config, workflow, verbose=verbose, quiet=quiet, force=force ) help_msg = "To execute the workflow with DVC, run: dvc repro" if updated: @@ -72,7 +75,7 @@ def update_dvc_config( config: Dict[str, Any], workflow: Optional[str] = None, verbose: bool = False, - silent: bool = False, + quiet: bool = False, force: bool = False, ) -> bool: """Re-run the DVC commands in dry mode and update dvc.yaml file in the @@ -83,7 +86,7 @@ def update_dvc_config( path (Path): The path to the project directory. config (Dict[str, Any]): The loaded project.yml. verbose (bool): Whether to print additional info (via DVC). - silent (bool): Don't output anything (via DVC). + quiet (bool): Don't output anything (via DVC). force (bool): Force update, even if hashes match. RETURNS (bool): Whether the DVC config file was updated. """ @@ -105,6 +108,14 @@ def update_dvc_config( dvc_config_path.unlink() dvc_commands = [] config_commands = {cmd["name"]: cmd for cmd in config.get("commands", [])} + + # some flags that apply to every command + flags = [] + if verbose: + flags.append("--verbose") + if quiet: + flags.append("--quiet") + for name in workflows[workflow]: command = config_commands[name] deps = command.get("deps", []) @@ -118,14 +129,26 @@ def update_dvc_config( deps_cmd = [c for cl in [["-d", p] for p in deps] for c in cl] outputs_cmd = [c for cl in [["-o", p] for p in outputs] for c in cl] outputs_nc_cmd = [c for cl in [["-O", p] for p in outputs_no_cache] for c in cl] - dvc_cmd = ["run", "-n", name, "-w", str(path), "--no-exec"] + + dvc_cmd = ["run", *flags, "-n", name, "-w", str(path), "--no-exec"] if command.get("no_skip"): dvc_cmd.append("--always-changed") full_cmd = [*dvc_cmd, *deps_cmd, *outputs_cmd, *outputs_nc_cmd, *project_cmd] dvc_commands.append(join_command(full_cmd)) + + if not dvc_commands: + # If we don't check for this, then there will be an error when reading the + # config, since DVC wouldn't create it. + msg.fail( + "No usable commands for DVC found. This can happen if none of your " + "commands have dependencies or outputs.", + exits=1, + ) + with working_dir(path): - dvc_flags = {"--verbose": verbose, "--quiet": silent} - run_dvc_commands(dvc_commands, flags=dvc_flags) + for c in dvc_commands: + dvc_command = "dvc " + c + run_command(dvc_command) with dvc_config_path.open("r+", encoding="utf8") as f: content = f.read() f.seek(0, 0) @@ -133,26 +156,6 @@ def update_dvc_config( return True -def run_dvc_commands( - commands: Iterable[str] = SimpleFrozenList(), flags: Dict[str, bool] = {} -) -> None: - """Run a sequence of DVC commands in a subprocess, in order. - - commands (List[str]): The string commands without the leading "dvc". - flags (Dict[str, bool]): Conditional flags to be added to command. Makes it - easier to pass flags like --quiet that depend on a variable or - command-line setting while avoiding lots of nested conditionals. - """ - for c in commands: - command = split_command(c) - dvc_command = ["dvc", *command] - # Add the flags if they are set to True - for flag, is_active in flags.items(): - if is_active: - dvc_command.append(flag) - run_command(dvc_command) - - def check_workflows(workflows: List[str], workflow: Optional[str] = None) -> None: """Validate workflows provided in project.yml and check that a given workflow can be used to generate a DVC config. diff --git a/website/docs/api/cli.md b/website/docs/api/cli.md index e5cd3089b..fc2c46022 100644 --- a/website/docs/api/cli.md +++ b/website/docs/api/cli.md @@ -1482,7 +1482,7 @@ You'll also need to add the assets you want to track with ```cli -$ python -m spacy project dvc [project_dir] [workflow] [--force] [--verbose] +$ python -m spacy project dvc [project_dir] [workflow] [--force] [--verbose] [--quiet] ``` > #### Example @@ -1499,6 +1499,7 @@ $ python -m spacy project dvc [project_dir] [workflow] [--force] [--verbose] | `workflow` | Name of workflow defined in `project.yml`. Defaults to first workflow if not set. ~~Optional[str] \(option)~~ | | `--force`, `-F` | Force-updating config file. ~~bool (flag)~~ | | `--verbose`, `-V` | Print more output generated by DVC. ~~bool (flag)~~ | +| `--quiet`, `-q` | Print no output generated by DVC. ~~bool (flag)~~ | | `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | | **CREATES** | A `dvc.yaml` file in the project directory, based on the steps defined in the given workflow. | From a1eacaa8db055322d4a066a08b730243a2f5b969 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Tue, 18 Oct 2022 14:36:06 +0200 Subject: [PATCH 047/161] Add python 3.11.0rc2 to CI (#11667) --- .github/azure-steps.yml | 1 + azure-pipelines.yml | 9 +++++++++ 2 files changed, 10 insertions(+) diff --git a/.github/azure-steps.yml b/.github/azure-steps.yml index 9d57219ca..cc0247b3a 100644 --- a/.github/azure-steps.yml +++ b/.github/azure-steps.yml @@ -10,6 +10,7 @@ steps: inputs: versionSpec: ${{ parameters.python_version }} architecture: ${{ parameters.architecture }} + allowUnstable: true - bash: | echo "##vso[task.setvariable variable=python_version]${{ parameters.python_version }}" diff --git a/azure-pipelines.yml b/azure-pipelines.yml index 2f5201614..357cce835 100644 --- a/azure-pipelines.yml +++ b/azure-pipelines.yml @@ -85,6 +85,15 @@ jobs: Python310Mac: imageName: "macos-latest" python.version: "3.10" + Python311Linux: + imageName: 'ubuntu-latest' + python.version: '3.11.0-rc.2' + Python311Windows: + imageName: 'windows-latest' + python.version: '3.11.0-rc.2' + Python311Mac: + imageName: 'macos-latest' + python.version: '3.11.0-rc.2' maxParallel: 4 pool: vmImage: $(imageName) From d66ccb8eb08cd515904045de84351546065fb3ed Mon Sep 17 00:00:00 2001 From: Edward <43848523+thomashacker@users.noreply.github.com> Date: Wed, 19 Oct 2022 15:52:47 +0200 Subject: [PATCH 048/161] Fix multiple entries per custom extension in doc json (#11551) * Fix multiple extensions and character offset * Rename token_start/end to start/end * Refactor Doc.from_json based on review * Iterate over user_data items * Only add non-empty underscore entries Co-authored-by: Adriane Boyd --- spacy/schemas.py | 4 +- spacy/tests/doc/test_json_doc_conversion.py | 25 +++++++---- spacy/tokens/doc.pyx | 48 ++++++++++----------- 3 files changed, 42 insertions(+), 35 deletions(-) diff --git a/spacy/schemas.py b/spacy/schemas.py index a67d96d9d..c824d76b9 100644 --- a/spacy/schemas.py +++ b/spacy/schemas.py @@ -519,9 +519,9 @@ class DocJSONSchema(BaseModel): title="Any custom data stored in the document's _ attribute", alias="_", ) - underscore_token: Optional[Dict[StrictStr, Dict[StrictStr, Any]]] = Field( + underscore_token: Optional[Dict[StrictStr, List[Dict[StrictStr, Any]]]] = Field( None, title="Any custom data stored in the token's _ attribute" ) - underscore_span: Optional[Dict[StrictStr, Dict[StrictStr, Any]]] = Field( + underscore_span: Optional[Dict[StrictStr, List[Dict[StrictStr, Any]]]] = Field( None, title="Any custom data stored in the span's _ attribute" ) diff --git a/spacy/tests/doc/test_json_doc_conversion.py b/spacy/tests/doc/test_json_doc_conversion.py index 0d7c061c9..19698cfb2 100644 --- a/spacy/tests/doc/test_json_doc_conversion.py +++ b/spacy/tests/doc/test_json_doc_conversion.py @@ -128,7 +128,9 @@ def test_doc_to_json_with_token_span_attributes(doc): doc._.json_test1 = "hello world" doc._.json_test2 = [1, 2, 3] doc[0:1]._.span_test = "span_attribute" + doc[0:2]._.span_test = "span_attribute_2" doc[0]._.token_test = 117 + doc[1]._.token_test = 118 doc.spans["span_group"] = [doc[0:1]] json_doc = doc.to_json( underscore=["json_test1", "json_test2", "token_test", "span_test"] @@ -139,8 +141,10 @@ def test_doc_to_json_with_token_span_attributes(doc): assert json_doc["_"]["json_test2"] == [1, 2, 3] assert "underscore_token" in json_doc assert "underscore_span" in json_doc - assert json_doc["underscore_token"]["token_test"]["value"] == 117 - assert json_doc["underscore_span"]["span_test"]["value"] == "span_attribute" + assert json_doc["underscore_token"]["token_test"][0]["value"] == 117 + assert json_doc["underscore_token"]["token_test"][1]["value"] == 118 + assert json_doc["underscore_span"]["span_test"][0]["value"] == "span_attribute" + assert json_doc["underscore_span"]["span_test"][1]["value"] == "span_attribute_2" assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0 assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc @@ -161,8 +165,8 @@ def test_doc_to_json_with_custom_user_data(doc): assert json_doc["_"]["json_test"] == "hello world" assert "underscore_token" in json_doc assert "underscore_span" in json_doc - assert json_doc["underscore_token"]["token_test"]["value"] == 117 - assert json_doc["underscore_span"]["span_test"]["value"] == "span_attribute" + assert json_doc["underscore_token"]["token_test"][0]["value"] == 117 + assert json_doc["underscore_span"]["span_test"][0]["value"] == "span_attribute" assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0 assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc @@ -181,8 +185,8 @@ def test_doc_to_json_with_token_span_same_identifier(doc): assert json_doc["_"]["my_ext"] == "hello world" assert "underscore_token" in json_doc assert "underscore_span" in json_doc - assert json_doc["underscore_token"]["my_ext"]["value"] == 117 - assert json_doc["underscore_span"]["my_ext"]["value"] == "span_attribute" + assert json_doc["underscore_token"]["my_ext"][0]["value"] == 117 + assert json_doc["underscore_span"]["my_ext"][0]["value"] == "span_attribute" assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0 assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc @@ -195,10 +199,9 @@ def test_doc_to_json_with_token_attributes_missing(doc): doc[0]._.token_test = 117 json_doc = doc.to_json(underscore=["span_test"]) - assert "underscore_token" in json_doc assert "underscore_span" in json_doc - assert json_doc["underscore_span"]["span_test"]["value"] == "span_attribute" - assert "token_test" not in json_doc["underscore_token"] + assert json_doc["underscore_span"]["span_test"][0]["value"] == "span_attribute" + assert "underscore_token" not in json_doc assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0 @@ -283,7 +286,9 @@ def test_json_to_doc_with_token_span_attributes(doc): doc._.json_test1 = "hello world" doc._.json_test2 = [1, 2, 3] doc[0:1]._.span_test = "span_attribute" + doc[0:2]._.span_test = "span_attribute_2" doc[0]._.token_test = 117 + doc[1]._.token_test = 118 json_doc = doc.to_json( underscore=["json_test1", "json_test2", "token_test", "span_test"] @@ -295,7 +300,9 @@ def test_json_to_doc_with_token_span_attributes(doc): assert new_doc._.json_test1 == "hello world" assert new_doc._.json_test2 == [1, 2, 3] assert new_doc[0]._.token_test == 117 + assert new_doc[1]._.token_test == 118 assert new_doc[0:1]._.span_test == "span_attribute" + assert new_doc[0:2]._.span_test == "span_attribute_2" assert new_doc.user_data == doc.user_data assert new_doc.to_bytes(exclude=["user_data"]) == doc.to_bytes( exclude=["user_data"] diff --git a/spacy/tokens/doc.pyx b/spacy/tokens/doc.pyx index d7d2fd8e6..295f91c28 100644 --- a/spacy/tokens/doc.pyx +++ b/spacy/tokens/doc.pyx @@ -1608,24 +1608,20 @@ cdef class Doc: Doc.set_extension(attr) self._.set(attr, doc_json["_"][attr]) - if doc_json.get("underscore_token", {}): - for token_attr in doc_json["underscore_token"]: - token_start = doc_json["underscore_token"][token_attr]["token_start"] - value = doc_json["underscore_token"][token_attr]["value"] - - if not Token.has_extension(token_attr): - Token.set_extension(token_attr) - self[token_start]._.set(token_attr, value) + for token_attr in doc_json.get("underscore_token", {}): + if not Token.has_extension(token_attr): + Token.set_extension(token_attr) + for token_data in doc_json["underscore_token"][token_attr]: + start = token_by_char(self.c, self.length, token_data["start"]) + value = token_data["value"] + self[start]._.set(token_attr, value) - if doc_json.get("underscore_span", {}): - for span_attr in doc_json["underscore_span"]: - token_start = doc_json["underscore_span"][span_attr]["token_start"] - token_end = doc_json["underscore_span"][span_attr]["token_end"] - value = doc_json["underscore_span"][span_attr]["value"] - - if not Span.has_extension(span_attr): - Span.set_extension(span_attr) - self[token_start:token_end]._.set(span_attr, value) + for span_attr in doc_json.get("underscore_span", {}): + if not Span.has_extension(span_attr): + Span.set_extension(span_attr) + for span_data in doc_json["underscore_span"][span_attr]: + value = span_data["value"] + self.char_span(span_data["start"], span_data["end"])._.set(span_attr, value) return self def to_json(self, underscore=None): @@ -1673,30 +1669,34 @@ cdef class Doc: if underscore: user_keys = set() if self.user_data: - data["_"] = {} - data["underscore_token"] = {} - data["underscore_span"] = {} - for data_key in self.user_data: + for data_key, value in self.user_data.copy().items(): if type(data_key) == tuple and len(data_key) >= 4 and data_key[0] == "._.": attr = data_key[1] start = data_key[2] end = data_key[3] if attr in underscore: user_keys.add(attr) - value = self.user_data[data_key] if not srsly.is_json_serializable(value): raise ValueError(Errors.E107.format(attr=attr, value=repr(value))) # Check if doc attribute if start is None: + if "_" not in data: + data["_"] = {} data["_"][attr] = value # Check if token attribute elif end is None: + if "underscore_token" not in data: + data["underscore_token"] = {} if attr not in data["underscore_token"]: - data["underscore_token"][attr] = {"token_start": start, "value": value} + data["underscore_token"][attr] = [] + data["underscore_token"][attr].append({"start": start, "value": value}) # Else span attribute else: + if "underscore_span" not in data: + data["underscore_span"] = {} if attr not in data["underscore_span"]: - data["underscore_span"][attr] = {"token_start": start, "token_end": end, "value": value} + data["underscore_span"][attr] = [] + data["underscore_span"][attr].append({"start": start, "end": end, "value": value}) for attr in underscore: if attr not in user_keys: From 3d0e895363921d4acb7f89a5b708472681e6fc1b Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Wed, 19 Oct 2022 17:33:55 +0200 Subject: [PATCH 049/161] Set version to v3.4.2 (#11672) --- spacy/about.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/about.py b/spacy/about.py index 843c15aba..ce86e6294 100644 --- a/spacy/about.py +++ b/spacy/about.py @@ -1,6 +1,6 @@ # fmt: off __title__ = "spacy" -__version__ = "3.4.1" +__version__ = "3.4.2" __download_url__ = "https://github.com/explosion/spacy-models/releases/download" __compatibility__ = "https://raw.githubusercontent.com/explosion/spacy-models/master/compatibility.json" __projects__ = "https://github.com/explosion/projects" From bf83f6872a55e307da289fb901db3c16dd35e8d1 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Thu, 20 Oct 2022 20:35:03 +0900 Subject: [PATCH 050/161] Add detailed example of env dict usage (#11677) * Add detailed example of env dict usage * Mark code blocks as yaml --- website/docs/usage/projects.md | 21 +++++++++++++++++++++ 1 file changed, 21 insertions(+) diff --git a/website/docs/usage/projects.md b/website/docs/usage/projects.md index 4797bbfe3..90b612358 100644 --- a/website/docs/usage/projects.md +++ b/website/docs/usage/projects.md @@ -243,6 +243,27 @@ pipelines. > python -m spacy project run test . --vars.foo bar > ``` +> #### Tip: Environment Variables +> +> Commands in a project file are not executed in a shell, so they don't have +> direct access to environment variables. But you can insert environment +> variables using the `env` dictionary to make values available for +> interpolation, just like values in `vars`. Here's an example `env` dict that +> makes `$PATH` available as `ENV_PATH`: +> +> ```yaml +> env: +> ENV_PATH: PATH +> ``` +> +> This can be used in a project command like so: +> +> ```yaml +> - name: "echo-path" +> script: +> - "echo ${env.ENV_PATH}" +> ``` + | Section | Description | | --------------------------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | | `title` | An optional project title used in `--help` message and [auto-generated docs](#custom-docs). | From b69d249a223fa4e633e11babc0830f3b68df57e2 Mon Sep 17 00:00:00 2001 From: Cellan Hall <60790416+Ce11an@users.noreply.github.com> Date: Thu, 20 Oct 2022 12:38:29 +0100 Subject: [PATCH 051/161] Adding `spacy-cleaner` to the spaCy universe (#11674) * added spacy-cleaner to the spaCy universe * Move data to righ section of universe.json * Cleanup - fix typo ("replacers") - spaCy doesn't need to be marked as code - lemma of "Hello" is lower case Co-authored-by: Paul O'Leary McCann --- website/meta/universe.json | 41 ++++++++++++++++++++++++++++++++++++++ 1 file changed, 41 insertions(+) diff --git a/website/meta/universe.json b/website/meta/universe.json index 637e9d6ce..d7c99956b 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -1,5 +1,46 @@ { "resources": [ + { + "id": "spacy-cleaner", + "title": "spacy-cleaner", + "slogan": "Easily clean text with spaCy!", + "description": "**spacy-cleaner** utilises spaCy `Language` models to replace, remove, and \n mutate spaCy tokens. Cleaning actions available are:\n\n* Remove/replace stopwords.\n* Remove/replace punctuation.\n* Remove/replace numbers.\n* Remove/replace emails.\n* Remove/replace URLs.\n* Perform lemmatisation.\n\nSee our [docs](https://ce11an.github.io/spacy-cleaner/) for more information.", + "github": "Ce11an/spacy-cleaner", + "pip": "spacy-cleaner", + "code_example": [ + "import spacy", + "import spacy_cleaner", + "from spacy_cleaner.processing import removers, replacers, mutators", + "", + "model = spacy.load(\"en_core_web_sm\")", + "pipeline = spacy_cleaner.Pipeline(", + " model,", + " removers.remove_stopword_token,", + " replacers.replace_punctuation_token,", + " mutators.mutate_lemma_token,", + ")", + "", + "texts = [\"Hello, my name is Cellan! I love to swim!\"]", + "", + "pipeline.clean(texts)", + "# ['hello _IS_PUNCT_ Cellan _IS_PUNCT_ love swim _IS_PUNCT_']" + ], + "code_language": "python", + "url": "https://ce11an.github.io/spacy-cleaner/", + "image": "https://raw.githubusercontent.com/Ce11an/spacy-cleaner/main/docs/assets/images/spacemen.png", + "author": "Cellan Hall", + "author_links": { + "twitter": "Ce11an", + "github": "Ce11an", + "website": "https://www.linkedin.com/in/cellan-hall/" + }, + "category": [ + "extension" + ], + "tags": [ + "text-processing" + ] + }, { "id": "Zshot", "title": "Zshot", From 0e2b7fb28be1eb7a2950ae341b7956c4b0ab7af8 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Fri, 21 Oct 2022 18:01:18 +0900 Subject: [PATCH 052/161] Remove thinc util reimports (#11665) * Remove imports marked as v2 leftovers There are a few functions that were in `spacy.util` in v2, but were moved to Thinc. In v3 these were imported in `spacy.util` so that code could be used unchanged, but the comment over them indicates they should always be imported from Thinc. This commit removes those imports. It doesn't look like any DeprecationWarning was ever thrown for using these, but it is probably fine to remove them anyway with a major version. It is not clear that they were widely used. * Import fix_random_seed correctly This seems to be the only place in spaCy that was using the old import. --- spacy/tests/pipeline/test_spancat.py | 4 ++-- spacy/util.py | 6 ------ 2 files changed, 2 insertions(+), 8 deletions(-) diff --git a/spacy/tests/pipeline/test_spancat.py b/spacy/tests/pipeline/test_spancat.py index 4fb26c7e7..d7da6eb23 100644 --- a/spacy/tests/pipeline/test_spancat.py +++ b/spacy/tests/pipeline/test_spancat.py @@ -1,7 +1,7 @@ import pytest import numpy from numpy.testing import assert_array_equal, assert_almost_equal -from thinc.api import get_current_ops, Ragged +from thinc.api import get_current_ops, Ragged, fix_random_seed from spacy import util from spacy.lang.en import English @@ -9,7 +9,7 @@ from spacy.language import Language from spacy.tokens import SpanGroup from spacy.tokens.span_groups import SpanGroups from spacy.training import Example -from spacy.util import fix_random_seed, registry, make_tempdir +from spacy.util import registry, make_tempdir OPS = get_current_ops() diff --git a/spacy/util.py b/spacy/util.py index 3034808ba..809bc1814 100644 --- a/spacy/util.py +++ b/spacy/util.py @@ -37,12 +37,6 @@ try: except ImportError: cupy = None -# These are functions that were previously (v2.x) available from spacy.util -# and have since moved to Thinc. We're importing them here so people's code -# doesn't break, but they should always be imported from Thinc from now on, -# not from spacy.util. -from thinc.api import fix_random_seed, compounding, decaying # noqa: F401 - from .symbols import ORTH from .compat import cupy, CudaStream, is_windows, importlib_metadata From 84d9cb6b387572293c8bcf26b0e71b508104b165 Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 21 Oct 2022 11:54:17 +0200 Subject: [PATCH 053/161] Auto-format code with black (#11687) Co-authored-by: explosion-bot --- spacy/tests/pipeline/test_tok2vec.py | 22 ++++++++++++++++------ 1 file changed, 16 insertions(+), 6 deletions(-) diff --git a/spacy/tests/pipeline/test_tok2vec.py b/spacy/tests/pipeline/test_tok2vec.py index 659274db9..e423d9a19 100644 --- a/spacy/tests/pipeline/test_tok2vec.py +++ b/spacy/tests/pipeline/test_tok2vec.py @@ -231,7 +231,7 @@ def test_tok2vec_listener_callback(): def test_tok2vec_listener_overfitting(): - """ Test that a pipeline with a listener properly overfits, even if 'tok2vec' is in the annotating components """ + """Test that a pipeline with a listener properly overfits, even if 'tok2vec' is in the annotating components""" orig_config = Config().from_str(cfg_string) nlp = util.load_model_from_config(orig_config, auto_fill=True, validate=True) train_examples = [] @@ -264,7 +264,7 @@ def test_tok2vec_listener_overfitting(): def test_tok2vec_frozen_not_annotating(): - """ Test that a pipeline with a frozen tok2vec raises an error when the tok2vec is not annotating """ + """Test that a pipeline with a frozen tok2vec raises an error when the tok2vec is not annotating""" orig_config = Config().from_str(cfg_string) nlp = util.load_model_from_config(orig_config, auto_fill=True, validate=True) train_examples = [] @@ -274,12 +274,16 @@ def test_tok2vec_frozen_not_annotating(): for i in range(2): losses = {} - with pytest.raises(ValueError, match=r"the tok2vec embedding layer is not updated"): - nlp.update(train_examples, sgd=optimizer, losses=losses, exclude=["tok2vec"]) + with pytest.raises( + ValueError, match=r"the tok2vec embedding layer is not updated" + ): + nlp.update( + train_examples, sgd=optimizer, losses=losses, exclude=["tok2vec"] + ) def test_tok2vec_frozen_overfitting(): - """ Test that a pipeline with a frozen & annotating tok2vec can still overfit """ + """Test that a pipeline with a frozen & annotating tok2vec can still overfit""" orig_config = Config().from_str(cfg_string) nlp = util.load_model_from_config(orig_config, auto_fill=True, validate=True) train_examples = [] @@ -289,7 +293,13 @@ def test_tok2vec_frozen_overfitting(): for i in range(100): losses = {} - nlp.update(train_examples, sgd=optimizer, losses=losses, exclude=["tok2vec"], annotates=["tok2vec"]) + nlp.update( + train_examples, + sgd=optimizer, + losses=losses, + exclude=["tok2vec"], + annotates=["tok2vec"], + ) assert losses["tagger"] < 0.0001 # test the trained model From cae4589f5a229ab4688338474d93d33512226fd8 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Mon, 24 Oct 2022 09:11:35 +0200 Subject: [PATCH 054/161] Replace EntityRuler with SpanRuler implementation (#11320) * Replace EntityRuler with SpanRuler implementation Remove `EntityRuler` and rename the `SpanRuler`-based `future_entity_ruler` to `entity_ruler`. Main changes: * It is no longer possible to load patterns on init as with `EntityRuler(patterns=)`. * The older serialization formats (`patterns.jsonl`) are no longer supported and the related tests are removed. * The config settings are only stored in the config, not in the serialized component (in particular the `phrase_matcher_attr` and overwrite settings). * Add migration guide to EntityRuler API docs * docs update * Minor edit Co-authored-by: svlandeg --- spacy/errors.py | 8 +- spacy/pipeline/__init__.py | 2 - spacy/pipeline/entity_ruler.py | 525 ------------------ spacy/pipeline/span_ruler.py | 17 +- spacy/tests/matcher/test_phrase_matcher.py | 9 +- spacy/tests/pipeline/test_entity_ruler.py | 255 +++------ .../serialize/test_serialize_pipeline.py | 57 +- website/docs/api/entityruler.md | 313 ++--------- website/docs/api/spanruler.md | 11 + website/docs/usage/101/_architecture.md | 40 +- website/docs/usage/101/_pipelines.md | 6 +- website/docs/usage/processing-pipelines.md | 5 +- website/docs/usage/rule-based-matching.md | 45 +- website/docs/usage/saving-loading.md | 10 +- website/docs/usage/training.md | 2 +- 15 files changed, 233 insertions(+), 1072 deletions(-) delete mode 100644 spacy/pipeline/entity_ruler.py diff --git a/spacy/errors.py b/spacy/errors.py index 856660106..820f7352e 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -460,13 +460,13 @@ class Errors(metaclass=ErrorsWithCodes): "same, but found '{nlp}' and '{vocab}' respectively.") E152 = ("The attribute {attr} is not supported for token patterns. " "Please use the option `validate=True` with the Matcher, PhraseMatcher, " - "EntityRuler or AttributeRuler for more details.") + "SpanRuler or AttributeRuler for more details.") E153 = ("The value type {vtype} is not supported for token patterns. " "Please use the option validate=True with Matcher, PhraseMatcher, " - "EntityRuler or AttributeRuler for more details.") + "SpanRuler or AttributeRuler for more details.") E154 = ("One of the attributes or values is not supported for token " "patterns. Please use the option `validate=True` with the Matcher, " - "PhraseMatcher, or EntityRuler for more details.") + "PhraseMatcher, or SpanRuler for more details.") E155 = ("The pipeline needs to include a {pipe} in order to use " "Matcher or PhraseMatcher with the attribute {attr}. " "Try using `nlp()` instead of `nlp.make_doc()` or `list(nlp.pipe())` " @@ -917,8 +917,6 @@ class Errors(metaclass=ErrorsWithCodes): E1021 = ("`pos` value \"{pp}\" is not a valid Universal Dependencies tag. " "Non-UD tags should use the `tag` property.") E1022 = ("Words must be of type str or int, but input is of type '{wtype}'") - E1023 = ("Couldn't read EntityRuler from the {path}. This file doesn't " - "exist.") E1024 = ("A pattern with {attr_type} '{label}' is not present in " "'{component}' patterns.") E1025 = ("Cannot intify the value '{value}' as an IOB string. The only " diff --git a/spacy/pipeline/__init__.py b/spacy/pipeline/__init__.py index 4744a989b..14dfed949 100644 --- a/spacy/pipeline/__init__.py +++ b/spacy/pipeline/__init__.py @@ -3,7 +3,6 @@ from .dep_parser import DependencyParser from .edit_tree_lemmatizer import EditTreeLemmatizer from .entity_linker import EntityLinker from .ner import EntityRecognizer -from .entity_ruler import EntityRuler from .lemmatizer import Lemmatizer from .morphologizer import Morphologizer from .pipe import Pipe @@ -23,7 +22,6 @@ __all__ = [ "DependencyParser", "EntityLinker", "EntityRecognizer", - "EntityRuler", "Morphologizer", "Lemmatizer", "MultiLabel_TextCategorizer", diff --git a/spacy/pipeline/entity_ruler.py b/spacy/pipeline/entity_ruler.py deleted file mode 100644 index 8154a077d..000000000 --- a/spacy/pipeline/entity_ruler.py +++ /dev/null @@ -1,525 +0,0 @@ -from typing import Optional, Union, List, Dict, Tuple, Iterable, Any, Callable, Sequence -import warnings -from collections import defaultdict -from pathlib import Path -import srsly - -from .pipe import Pipe -from ..training import Example -from ..language import Language -from ..errors import Errors, Warnings -from ..util import ensure_path, to_disk, from_disk, SimpleFrozenList, registry -from ..tokens import Doc, Span -from ..matcher import Matcher, PhraseMatcher -from ..scorer import get_ner_prf - - -DEFAULT_ENT_ID_SEP = "||" -PatternType = Dict[str, Union[str, List[Dict[str, Any]]]] - - -@Language.factory( - "entity_ruler", - assigns=["doc.ents", "token.ent_type", "token.ent_iob"], - default_config={ - "phrase_matcher_attr": None, - "validate": False, - "overwrite_ents": False, - "ent_id_sep": DEFAULT_ENT_ID_SEP, - "scorer": {"@scorers": "spacy.entity_ruler_scorer.v1"}, - }, - default_score_weights={ - "ents_f": 1.0, - "ents_p": 0.0, - "ents_r": 0.0, - "ents_per_type": None, - }, -) -def make_entity_ruler( - nlp: Language, - name: str, - phrase_matcher_attr: Optional[Union[int, str]], - validate: bool, - overwrite_ents: bool, - ent_id_sep: str, - scorer: Optional[Callable], -): - return EntityRuler( - nlp, - name, - phrase_matcher_attr=phrase_matcher_attr, - validate=validate, - overwrite_ents=overwrite_ents, - ent_id_sep=ent_id_sep, - scorer=scorer, - ) - - -def entity_ruler_score(examples, **kwargs): - return get_ner_prf(examples) - - -@registry.scorers("spacy.entity_ruler_scorer.v1") -def make_entity_ruler_scorer(): - return entity_ruler_score - - -class EntityRuler(Pipe): - """The EntityRuler lets you add spans to the `Doc.ents` using token-based - rules or exact phrase matches. It can be combined with the statistical - `EntityRecognizer` to boost accuracy, or used on its own to implement a - purely rule-based entity recognition system. After initialization, the - component is typically added to the pipeline using `nlp.add_pipe`. - - DOCS: https://spacy.io/api/entityruler - USAGE: https://spacy.io/usage/rule-based-matching#entityruler - """ - - def __init__( - self, - nlp: Language, - name: str = "entity_ruler", - *, - phrase_matcher_attr: Optional[Union[int, str]] = None, - validate: bool = False, - overwrite_ents: bool = False, - ent_id_sep: str = DEFAULT_ENT_ID_SEP, - patterns: Optional[List[PatternType]] = None, - scorer: Optional[Callable] = entity_ruler_score, - ) -> None: - """Initialize the entity ruler. If patterns are supplied here, they - need to be a list of dictionaries with a `"label"` and `"pattern"` - key. A pattern can either be a token pattern (list) or a phrase pattern - (string). For example: `{'label': 'ORG', 'pattern': 'Apple'}`. - - nlp (Language): The shared nlp object to pass the vocab to the matchers - and process phrase patterns. - name (str): Instance name of the current pipeline component. Typically - passed in automatically from the factory when the component is - added. Used to disable the current entity ruler while creating - phrase patterns with the nlp object. - phrase_matcher_attr (int / str): Token attribute to match on, passed - to the internal PhraseMatcher as `attr` - validate (bool): Whether patterns should be validated, passed to - Matcher and PhraseMatcher as `validate` - patterns (iterable): Optional patterns to load in. - overwrite_ents (bool): If existing entities are present, e.g. entities - added by the model, overwrite them by matches if necessary. - ent_id_sep (str): Separator used internally for entity IDs. - scorer (Optional[Callable]): The scoring method. Defaults to - spacy.scorer.get_ner_prf. - - DOCS: https://spacy.io/api/entityruler#init - """ - self.nlp = nlp - self.name = name - self.overwrite = overwrite_ents - self.token_patterns = defaultdict(list) # type: ignore - self.phrase_patterns = defaultdict(list) # type: ignore - self._validate = validate - self.matcher = Matcher(nlp.vocab, validate=validate) - self.phrase_matcher_attr = phrase_matcher_attr - self.phrase_matcher = PhraseMatcher( - nlp.vocab, attr=self.phrase_matcher_attr, validate=validate - ) - self.ent_id_sep = ent_id_sep - self._ent_ids = defaultdict(tuple) # type: ignore - if patterns is not None: - self.add_patterns(patterns) - self.scorer = scorer - - def __len__(self) -> int: - """The number of all patterns added to the entity ruler.""" - n_token_patterns = sum(len(p) for p in self.token_patterns.values()) - n_phrase_patterns = sum(len(p) for p in self.phrase_patterns.values()) - return n_token_patterns + n_phrase_patterns - - def __contains__(self, label: str) -> bool: - """Whether a label is present in the patterns.""" - return label in self.token_patterns or label in self.phrase_patterns - - def __call__(self, doc: Doc) -> Doc: - """Find matches in document and add them as entities. - - doc (Doc): The Doc object in the pipeline. - RETURNS (Doc): The Doc with added entities, if available. - - DOCS: https://spacy.io/api/entityruler#call - """ - error_handler = self.get_error_handler() - try: - matches = self.match(doc) - self.set_annotations(doc, matches) - return doc - except Exception as e: - return error_handler(self.name, self, [doc], e) - - def match(self, doc: Doc): - self._require_patterns() - with warnings.catch_warnings(): - warnings.filterwarnings("ignore", message="\\[W036") - matches = list(self.matcher(doc)) + list(self.phrase_matcher(doc)) - - final_matches = set( - [(m_id, start, end) for m_id, start, end in matches if start != end] - ) - get_sort_key = lambda m: (m[2] - m[1], -m[1]) - final_matches = sorted(final_matches, key=get_sort_key, reverse=True) - return final_matches - - def set_annotations(self, doc, matches): - """Modify the document in place""" - entities = list(doc.ents) - new_entities = [] - seen_tokens = set() - for match_id, start, end in matches: - if any(t.ent_type for t in doc[start:end]) and not self.overwrite: - continue - # check for end - 1 here because boundaries are inclusive - if start not in seen_tokens and end - 1 not in seen_tokens: - if match_id in self._ent_ids: - label, ent_id = self._ent_ids[match_id] - span = Span(doc, start, end, label=label, span_id=ent_id) - else: - span = Span(doc, start, end, label=match_id) - new_entities.append(span) - entities = [ - e for e in entities if not (e.start < end and e.end > start) - ] - seen_tokens.update(range(start, end)) - doc.ents = entities + new_entities - - @property - def labels(self) -> Tuple[str, ...]: - """All labels present in the match patterns. - - RETURNS (set): The string labels. - - DOCS: https://spacy.io/api/entityruler#labels - """ - keys = set(self.token_patterns.keys()) - keys.update(self.phrase_patterns.keys()) - all_labels = set() - - for l in keys: - if self.ent_id_sep in l: - label, _ = self._split_label(l) - all_labels.add(label) - else: - all_labels.add(l) - return tuple(sorted(all_labels)) - - def initialize( - self, - get_examples: Callable[[], Iterable[Example]], - *, - nlp: Optional[Language] = None, - patterns: Optional[Sequence[PatternType]] = None, - ): - """Initialize the pipe for training. - - get_examples (Callable[[], Iterable[Example]]): Function that - returns a representative sample of gold-standard Example objects. - nlp (Language): The current nlp object the component is part of. - patterns Optional[Iterable[PatternType]]: The list of patterns. - - DOCS: https://spacy.io/api/entityruler#initialize - """ - self.clear() - if patterns: - self.add_patterns(patterns) # type: ignore[arg-type] - - @property - def ent_ids(self) -> Tuple[Optional[str], ...]: - """All entity ids present in the match patterns `id` properties - - RETURNS (set): The string entity ids. - - DOCS: https://spacy.io/api/entityruler#ent_ids - """ - keys = set(self.token_patterns.keys()) - keys.update(self.phrase_patterns.keys()) - all_ent_ids = set() - - for l in keys: - if self.ent_id_sep in l: - _, ent_id = self._split_label(l) - all_ent_ids.add(ent_id) - return tuple(all_ent_ids) - - @property - def patterns(self) -> List[PatternType]: - """Get all patterns that were added to the entity ruler. - - RETURNS (list): The original patterns, one dictionary per pattern. - - DOCS: https://spacy.io/api/entityruler#patterns - """ - all_patterns = [] - for label, patterns in self.token_patterns.items(): - for pattern in patterns: - ent_label, ent_id = self._split_label(label) - p = {"label": ent_label, "pattern": pattern} - if ent_id: - p["id"] = ent_id - all_patterns.append(p) - for label, patterns in self.phrase_patterns.items(): - for pattern in patterns: - ent_label, ent_id = self._split_label(label) - p = {"label": ent_label, "pattern": pattern.text} - if ent_id: - p["id"] = ent_id - all_patterns.append(p) - return all_patterns - - def add_patterns(self, patterns: List[PatternType]) -> None: - """Add patterns to the entity ruler. A pattern can either be a token - pattern (list of dicts) or a phrase pattern (string). For example: - {'label': 'ORG', 'pattern': 'Apple'} - {'label': 'GPE', 'pattern': [{'lower': 'san'}, {'lower': 'francisco'}]} - - patterns (list): The patterns to add. - - DOCS: https://spacy.io/api/entityruler#add_patterns - """ - - # disable the nlp components after this one in case they hadn't been initialized / deserialised yet - try: - current_index = -1 - for i, (name, pipe) in enumerate(self.nlp.pipeline): - if self == pipe: - current_index = i - break - subsequent_pipes = [pipe for pipe in self.nlp.pipe_names[current_index:]] - except ValueError: - subsequent_pipes = [] - with self.nlp.select_pipes(disable=subsequent_pipes): - token_patterns = [] - phrase_pattern_labels = [] - phrase_pattern_texts = [] - phrase_pattern_ids = [] - for entry in patterns: - if isinstance(entry["pattern"], str): - phrase_pattern_labels.append(entry["label"]) - phrase_pattern_texts.append(entry["pattern"]) - phrase_pattern_ids.append(entry.get("id")) - elif isinstance(entry["pattern"], list): - token_patterns.append(entry) - phrase_patterns = [] - for label, pattern, ent_id in zip( - phrase_pattern_labels, - self.nlp.pipe(phrase_pattern_texts), - phrase_pattern_ids, - ): - phrase_pattern = {"label": label, "pattern": pattern} - if ent_id: - phrase_pattern["id"] = ent_id - phrase_patterns.append(phrase_pattern) - for entry in token_patterns + phrase_patterns: # type: ignore[operator] - label = entry["label"] # type: ignore - if "id" in entry: - ent_label = label - label = self._create_label(label, entry["id"]) - key = self.matcher._normalize_key(label) - self._ent_ids[key] = (ent_label, entry["id"]) - pattern = entry["pattern"] # type: ignore - if isinstance(pattern, Doc): - self.phrase_patterns[label].append(pattern) - self.phrase_matcher.add(label, [pattern]) # type: ignore - elif isinstance(pattern, list): - self.token_patterns[label].append(pattern) - self.matcher.add(label, [pattern]) - else: - raise ValueError(Errors.E097.format(pattern=pattern)) - - def clear(self) -> None: - """Reset all patterns.""" - self.token_patterns = defaultdict(list) - self.phrase_patterns = defaultdict(list) - self._ent_ids = defaultdict(tuple) - self.matcher = Matcher(self.nlp.vocab, validate=self._validate) - self.phrase_matcher = PhraseMatcher( - self.nlp.vocab, attr=self.phrase_matcher_attr, validate=self._validate - ) - - def remove(self, ent_id: str) -> None: - """Remove a pattern by its ent_id if a pattern with this ent_id was added before - - ent_id (str): id of the pattern to be removed - RETURNS: None - DOCS: https://spacy.io/api/entityruler#remove - """ - label_id_pairs = [ - (label, eid) for (label, eid) in self._ent_ids.values() if eid == ent_id - ] - if not label_id_pairs: - raise ValueError( - Errors.E1024.format(attr_type="ID", label=ent_id, component=self.name) - ) - created_labels = [ - self._create_label(label, eid) for (label, eid) in label_id_pairs - ] - # remove the patterns from self.phrase_patterns - self.phrase_patterns = defaultdict( - list, - { - label: val - for (label, val) in self.phrase_patterns.items() - if label not in created_labels - }, - ) - # remove the patterns from self.token_pattern - self.token_patterns = defaultdict( - list, - { - label: val - for (label, val) in self.token_patterns.items() - if label not in created_labels - }, - ) - # remove the patterns from self.token_pattern - for label in created_labels: - if label in self.phrase_matcher: - self.phrase_matcher.remove(label) - else: - self.matcher.remove(label) - - def _require_patterns(self) -> None: - """Raise a warning if this component has no patterns defined.""" - if len(self) == 0: - warnings.warn(Warnings.W036.format(name=self.name)) - - def _split_label(self, label: str) -> Tuple[str, Optional[str]]: - """Split Entity label into ent_label and ent_id if it contains self.ent_id_sep - - label (str): The value of label in a pattern entry - RETURNS (tuple): ent_label, ent_id - """ - if self.ent_id_sep in label: - ent_label, ent_id = label.rsplit(self.ent_id_sep, 1) - else: - ent_label = label - ent_id = None # type: ignore - return ent_label, ent_id - - def _create_label(self, label: Any, ent_id: Any) -> str: - """Join Entity label with ent_id if the pattern has an `id` attribute - If ent_id is not a string, the label is returned as is. - - label (str): The label to set for ent.label_ - ent_id (str): The label - RETURNS (str): The ent_label joined with configured `ent_id_sep` - """ - if isinstance(ent_id, str): - label = f"{label}{self.ent_id_sep}{ent_id}" - return label - - def from_bytes( - self, patterns_bytes: bytes, *, exclude: Iterable[str] = SimpleFrozenList() - ) -> "EntityRuler": - """Load the entity ruler from a bytestring. - - patterns_bytes (bytes): The bytestring to load. - RETURNS (EntityRuler): The loaded entity ruler. - - DOCS: https://spacy.io/api/entityruler#from_bytes - """ - cfg = srsly.msgpack_loads(patterns_bytes) - self.clear() - if isinstance(cfg, dict): - self.add_patterns(cfg.get("patterns", cfg)) - self.overwrite = cfg.get("overwrite", False) - self.phrase_matcher_attr = cfg.get("phrase_matcher_attr", None) - self.phrase_matcher = PhraseMatcher( - self.nlp.vocab, attr=self.phrase_matcher_attr - ) - self.ent_id_sep = cfg.get("ent_id_sep", DEFAULT_ENT_ID_SEP) - else: - self.add_patterns(cfg) - return self - - def to_bytes(self, *, exclude: Iterable[str] = SimpleFrozenList()) -> bytes: - """Serialize the entity ruler patterns to a bytestring. - - RETURNS (bytes): The serialized patterns. - - DOCS: https://spacy.io/api/entityruler#to_bytes - """ - serial = { - "overwrite": self.overwrite, - "ent_id_sep": self.ent_id_sep, - "phrase_matcher_attr": self.phrase_matcher_attr, - "patterns": self.patterns, - } - return srsly.msgpack_dumps(serial) - - def from_disk( - self, path: Union[str, Path], *, exclude: Iterable[str] = SimpleFrozenList() - ) -> "EntityRuler": - """Load the entity ruler from a file. Expects a file containing - newline-delimited JSON (JSONL) with one entry per line. - - path (str / Path): The JSONL file to load. - RETURNS (EntityRuler): The loaded entity ruler. - - DOCS: https://spacy.io/api/entityruler#from_disk - """ - path = ensure_path(path) - self.clear() - depr_patterns_path = path.with_suffix(".jsonl") - if path.suffix == ".jsonl": # user provides a jsonl - if path.is_file: - patterns = srsly.read_jsonl(path) - self.add_patterns(patterns) - else: - raise ValueError(Errors.E1023.format(path=path)) - elif depr_patterns_path.is_file(): - patterns = srsly.read_jsonl(depr_patterns_path) - self.add_patterns(patterns) - elif path.is_dir(): # path is a valid directory - cfg = {} - deserializers_patterns = { - "patterns": lambda p: self.add_patterns( - srsly.read_jsonl(p.with_suffix(".jsonl")) - ) - } - deserializers_cfg = {"cfg": lambda p: cfg.update(srsly.read_json(p))} - from_disk(path, deserializers_cfg, {}) - self.overwrite = cfg.get("overwrite", False) - self.phrase_matcher_attr = cfg.get("phrase_matcher_attr") - self.ent_id_sep = cfg.get("ent_id_sep", DEFAULT_ENT_ID_SEP) - - self.phrase_matcher = PhraseMatcher( - self.nlp.vocab, attr=self.phrase_matcher_attr - ) - from_disk(path, deserializers_patterns, {}) - else: # path is not a valid directory or file - raise ValueError(Errors.E146.format(path=path)) - return self - - def to_disk( - self, path: Union[str, Path], *, exclude: Iterable[str] = SimpleFrozenList() - ) -> None: - """Save the entity ruler patterns to a directory. The patterns will be - saved as newline-delimited JSON (JSONL). - - path (str / Path): The JSONL file to save. - - DOCS: https://spacy.io/api/entityruler#to_disk - """ - path = ensure_path(path) - cfg = { - "overwrite": self.overwrite, - "phrase_matcher_attr": self.phrase_matcher_attr, - "ent_id_sep": self.ent_id_sep, - } - serializers = { - "patterns": lambda p: srsly.write_jsonl( - p.with_suffix(".jsonl"), self.patterns - ), - "cfg": lambda p: srsly.write_json(p, cfg), - } - if path.suffix == ".jsonl": # user wants to save only JSONL - srsly.write_jsonl(path, self.patterns) - else: - to_disk(path, serializers, {}) diff --git a/spacy/pipeline/span_ruler.py b/spacy/pipeline/span_ruler.py index 807a4ffe5..e39b89073 100644 --- a/spacy/pipeline/span_ruler.py +++ b/spacy/pipeline/span_ruler.py @@ -11,7 +11,7 @@ from ..language import Language from ..errors import Errors, Warnings from ..util import ensure_path, SimpleFrozenList, registry from ..tokens import Doc, Span -from ..scorer import Scorer +from ..scorer import Scorer, get_ner_prf from ..matcher import Matcher, PhraseMatcher from .. import util @@ -20,7 +20,7 @@ DEFAULT_SPANS_KEY = "ruler" @Language.factory( - "future_entity_ruler", + "entity_ruler", assigns=["doc.ents"], default_config={ "phrase_matcher_attr": None, @@ -63,6 +63,15 @@ def make_entity_ruler( ) +def entity_ruler_score(examples, **kwargs): + return get_ner_prf(examples) + + +@registry.scorers("spacy.entity_ruler_scorer.v1") +def make_entity_ruler_scorer(): + return entity_ruler_score + + @Language.factory( "span_ruler", assigns=["doc.spans"], @@ -117,7 +126,7 @@ def prioritize_new_ents_filter( ) -> List[Span]: """Merge entities and spans into one list without overlaps by allowing spans to overwrite any entities that they overlap with. Intended to - replicate the overwrite_ents=True behavior from the EntityRuler. + replicate the overwrite_ents=True behavior from the v3 EntityRuler. entities (Iterable[Span]): The entities, already filtered for overlaps. spans (Iterable[Span]): The spans to merge, may contain overlaps. @@ -148,7 +157,7 @@ def prioritize_existing_ents_filter( ) -> List[Span]: """Merge entities and spans into one list without overlaps by prioritizing existing entities. Intended to replicate the overwrite_ents=False behavior - from the EntityRuler. + from the v3 EntityRuler. entities (Iterable[Span]): The entities, already filtered for overlaps. spans (Iterable[Span]): The spans to merge, may contain overlaps. diff --git a/spacy/tests/matcher/test_phrase_matcher.py b/spacy/tests/matcher/test_phrase_matcher.py index b462b1878..20d0febb8 100644 --- a/spacy/tests/matcher/test_phrase_matcher.py +++ b/spacy/tests/matcher/test_phrase_matcher.py @@ -87,14 +87,15 @@ def test_issue4373(): @pytest.mark.issue(4651) def test_issue4651_with_phrase_matcher_attr(): - """Test that the EntityRuler PhraseMatcher is deserialized correctly using - the method from_disk when the EntityRuler argument phrase_matcher_attr is + """Test that the entity_ruler PhraseMatcher is deserialized correctly using + the method from_disk when the entity_ruler argument phrase_matcher_attr is specified. """ text = "Spacy is a python library for nlp" nlp = English() patterns = [{"label": "PYTHON_LIB", "pattern": "spacy", "id": "spaCy"}] - ruler = nlp.add_pipe("entity_ruler", config={"phrase_matcher_attr": "LOWER"}) + config = {"phrase_matcher_attr": "LOWER"} + ruler = nlp.add_pipe("entity_ruler", config=config) ruler.add_patterns(patterns) doc = nlp(text) res = [(ent.text, ent.label_, ent.ent_id_) for ent in doc.ents] @@ -102,7 +103,7 @@ def test_issue4651_with_phrase_matcher_attr(): with make_tempdir() as d: file_path = d / "entityruler" ruler.to_disk(file_path) - nlp_reloaded.add_pipe("entity_ruler").from_disk(file_path) + nlp_reloaded.add_pipe("entity_ruler", config=config).from_disk(file_path) doc_reloaded = nlp_reloaded(text) res_reloaded = [(ent.text, ent.label_, ent.ent_id_) for ent in doc_reloaded.ents] assert res == res_reloaded diff --git a/spacy/tests/pipeline/test_entity_ruler.py b/spacy/tests/pipeline/test_entity_ruler.py index 6851e2a7c..440849e84 100644 --- a/spacy/tests/pipeline/test_entity_ruler.py +++ b/spacy/tests/pipeline/test_entity_ruler.py @@ -4,7 +4,7 @@ from spacy import registry from spacy.tokens import Doc, Span from spacy.language import Language from spacy.lang.en import English -from spacy.pipeline import EntityRuler, EntityRecognizer, merge_entities +from spacy.pipeline import EntityRecognizer, merge_entities from spacy.pipeline import SpanRuler from spacy.pipeline.ner import DEFAULT_NER_MODEL from spacy.errors import MatchPatternError @@ -12,8 +12,6 @@ from spacy.tests.util import make_tempdir from thinc.api import NumpyOps, get_current_ops -ENTITY_RULERS = ["entity_ruler", "future_entity_ruler"] - @pytest.fixture def nlp(): @@ -40,13 +38,12 @@ def add_ent_component(doc): @pytest.mark.issue(3345) -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_issue3345(entity_ruler_factory): +def test_issue3345(): """Test case where preset entity crosses sentence boundary.""" nlp = English() doc = Doc(nlp.vocab, words=["I", "live", "in", "New", "York"]) doc[4].is_sent_start = True - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") + ruler = nlp.add_pipe("entity_ruler") ruler.add_patterns([{"label": "GPE", "pattern": "New York"}]) cfg = {"model": DEFAULT_NER_MODEL} model = registry.resolve(cfg, validate=True)["model"] @@ -65,15 +62,14 @@ def test_issue3345(entity_ruler_factory): @pytest.mark.issue(4849) -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_issue4849(entity_ruler_factory): +def test_issue4849(): nlp = English() patterns = [ {"label": "PERSON", "pattern": "joe biden", "id": "joe-biden"}, {"label": "PERSON", "pattern": "bernie sanders", "id": "bernie-sanders"}, ] ruler = nlp.add_pipe( - entity_ruler_factory, + "entity_ruler", name="entity_ruler", config={"phrase_matcher_attr": "LOWER"}, ) @@ -96,11 +92,10 @@ def test_issue4849(entity_ruler_factory): @pytest.mark.issue(5918) -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_issue5918(entity_ruler_factory): +def test_issue5918(): # Test edge case when merging entities. nlp = English() - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") + ruler = nlp.add_pipe("entity_ruler") patterns = [ {"label": "ORG", "pattern": "Digicon Inc"}, {"label": "ORG", "pattern": "Rotan Mosle Inc's"}, @@ -125,10 +120,9 @@ def test_issue5918(entity_ruler_factory): @pytest.mark.issue(8168) -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_issue8168(entity_ruler_factory): +def test_issue8168(): nlp = English() - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") + ruler = nlp.add_pipe("entity_ruler") patterns = [ {"label": "ORG", "pattern": "Apple"}, { @@ -148,12 +142,9 @@ def test_issue8168(entity_ruler_factory): @pytest.mark.issue(8216) -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_fix8216(nlp, patterns, entity_ruler_factory): +def test_entity_ruler_fix8216(nlp, patterns): """Test that patterns don't get added excessively.""" - ruler = nlp.add_pipe( - entity_ruler_factory, name="entity_ruler", config={"validate": True} - ) + ruler = nlp.add_pipe("entity_ruler", config={"validate": True}) ruler.add_patterns(patterns) pattern_count = sum(len(mm) for mm in ruler.matcher._patterns.values()) assert pattern_count > 0 @@ -162,16 +153,15 @@ def test_entity_ruler_fix8216(nlp, patterns, entity_ruler_factory): assert after_count == pattern_count -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_init(nlp, patterns, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") +def test_entity_ruler_init(nlp, patterns): + ruler = nlp.add_pipe("entity_ruler") ruler.add_patterns(patterns) assert len(ruler) == len(patterns) assert len(ruler.labels) == 4 assert "HELLO" in ruler assert "BYE" in ruler nlp.remove_pipe("entity_ruler") - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") + ruler = nlp.add_pipe("entity_ruler") ruler.add_patterns(patterns) doc = nlp("hello world bye bye") assert len(doc.ents) == 2 @@ -179,23 +169,21 @@ def test_entity_ruler_init(nlp, patterns, entity_ruler_factory): assert doc.ents[1].label_ == "BYE" -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_no_patterns_warns(nlp, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") +def test_entity_ruler_no_patterns_warns(nlp): + ruler = nlp.add_pipe("entity_ruler") assert len(ruler) == 0 assert len(ruler.labels) == 0 nlp.remove_pipe("entity_ruler") - nlp.add_pipe(entity_ruler_factory, name="entity_ruler") + nlp.add_pipe("entity_ruler") assert nlp.pipe_names == ["entity_ruler"] with pytest.warns(UserWarning): doc = nlp("hello world bye bye") assert len(doc.ents) == 0 -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_init_patterns(nlp, patterns, entity_ruler_factory): +def test_entity_ruler_init_patterns(nlp, patterns): # initialize with patterns - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") + ruler = nlp.add_pipe("entity_ruler") assert len(ruler.labels) == 0 ruler.initialize(lambda: [], patterns=patterns) assert len(ruler.labels) == 4 @@ -207,7 +195,7 @@ def test_entity_ruler_init_patterns(nlp, patterns, entity_ruler_factory): nlp.config["initialize"]["components"]["entity_ruler"] = { "patterns": {"@misc": "entity_ruler_patterns"} } - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") + ruler = nlp.add_pipe("entity_ruler") assert len(ruler.labels) == 0 nlp.initialize() assert len(ruler.labels) == 4 @@ -216,20 +204,18 @@ def test_entity_ruler_init_patterns(nlp, patterns, entity_ruler_factory): assert doc.ents[1].label_ == "BYE" -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_init_clear(nlp, patterns, entity_ruler_factory): +def test_entity_ruler_init_clear(nlp, patterns): """Test that initialization clears patterns.""" - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") + ruler = nlp.add_pipe("entity_ruler") ruler.add_patterns(patterns) assert len(ruler.labels) == 4 ruler.initialize(lambda: []) assert len(ruler.labels) == 0 -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_clear(nlp, patterns, entity_ruler_factory): +def test_entity_ruler_clear(nlp, patterns): """Test that initialization clears patterns.""" - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") + ruler = nlp.add_pipe("entity_ruler") ruler.add_patterns(patterns) assert len(ruler.labels) == 4 doc = nlp("hello world") @@ -241,9 +227,8 @@ def test_entity_ruler_clear(nlp, patterns, entity_ruler_factory): assert len(doc.ents) == 0 -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_existing(nlp, patterns, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") +def test_entity_ruler_existing(nlp, patterns): + ruler = nlp.add_pipe("entity_ruler") ruler.add_patterns(patterns) nlp.add_pipe("add_ent", before="entity_ruler") doc = nlp("OH HELLO WORLD bye bye") @@ -252,11 +237,8 @@ def test_entity_ruler_existing(nlp, patterns, entity_ruler_factory): assert doc.ents[1].label_ == "BYE" -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_existing_overwrite(nlp, patterns, entity_ruler_factory): - ruler = nlp.add_pipe( - entity_ruler_factory, name="entity_ruler", config={"overwrite_ents": True} - ) +def test_entity_ruler_existing_overwrite(nlp, patterns): + ruler = nlp.add_pipe("entity_ruler", config={"overwrite_ents": True}) ruler.add_patterns(patterns) nlp.add_pipe("add_ent", before="entity_ruler") doc = nlp("OH HELLO WORLD bye bye") @@ -266,11 +248,8 @@ def test_entity_ruler_existing_overwrite(nlp, patterns, entity_ruler_factory): assert doc.ents[1].label_ == "BYE" -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_existing_complex(nlp, patterns, entity_ruler_factory): - ruler = nlp.add_pipe( - entity_ruler_factory, name="entity_ruler", config={"overwrite_ents": True} - ) +def test_entity_ruler_existing_complex(nlp, patterns): + ruler = nlp.add_pipe("entity_ruler", config={"overwrite_ents": True}) ruler.add_patterns(patterns) nlp.add_pipe("add_ent", before="entity_ruler") doc = nlp("foo foo bye bye") @@ -281,11 +260,8 @@ def test_entity_ruler_existing_complex(nlp, patterns, entity_ruler_factory): assert len(doc.ents[1]) == 2 -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_entity_id(nlp, patterns, entity_ruler_factory): - ruler = nlp.add_pipe( - entity_ruler_factory, name="entity_ruler", config={"overwrite_ents": True} - ) +def test_entity_ruler_entity_id(nlp, patterns): + ruler = nlp.add_pipe("entity_ruler", config={"overwrite_ents": True}) ruler.add_patterns(patterns) doc = nlp("Apple is a technology company") assert len(doc.ents) == 1 @@ -293,26 +269,23 @@ def test_entity_ruler_entity_id(nlp, patterns, entity_ruler_factory): assert doc.ents[0].ent_id_ == "a1" -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_cfg_ent_id_sep(nlp, patterns, entity_ruler_factory): +def test_entity_ruler_cfg_ent_id_sep(nlp, patterns): config = {"overwrite_ents": True, "ent_id_sep": "**"} - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler", config=config) + ruler = nlp.add_pipe("entity_ruler", config=config) ruler.add_patterns(patterns) doc = nlp("Apple is a technology company") - if isinstance(ruler, EntityRuler): - assert "TECH_ORG**a1" in ruler.phrase_patterns assert len(doc.ents) == 1 assert doc.ents[0].label_ == "TECH_ORG" assert doc.ents[0].ent_id_ == "a1" -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_serialize_bytes(nlp, patterns, entity_ruler_factory): - ruler = EntityRuler(nlp, patterns=patterns) +def test_entity_ruler_serialize_bytes(nlp, patterns): + ruler = nlp.add_pipe("entity_ruler") + ruler.add_patterns(patterns) assert len(ruler) == len(patterns) assert len(ruler.labels) == 4 ruler_bytes = ruler.to_bytes() - new_ruler = EntityRuler(nlp) + new_ruler = nlp.add_pipe("entity_ruler", name="new_ruler") assert len(new_ruler) == 0 assert len(new_ruler.labels) == 0 new_ruler = new_ruler.from_bytes(ruler_bytes) @@ -324,28 +297,27 @@ def test_entity_ruler_serialize_bytes(nlp, patterns, entity_ruler_factory): assert sorted(new_ruler.labels) == sorted(ruler.labels) -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_serialize_phrase_matcher_attr_bytes( - nlp, patterns, entity_ruler_factory -): - ruler = EntityRuler(nlp, phrase_matcher_attr="LOWER", patterns=patterns) +def test_entity_ruler_serialize_phrase_matcher_attr_bytes(nlp, patterns): + ruler = nlp.add_pipe("entity_ruler", config={"phrase_matcher_attr": "LOWER"}) + ruler.add_patterns(patterns) assert len(ruler) == len(patterns) assert len(ruler.labels) == 4 ruler_bytes = ruler.to_bytes() - new_ruler = EntityRuler(nlp) + new_ruler = nlp.add_pipe( + "entity_ruler", name="new_ruler", config={"phrase_matcher_attr": "LOWER"} + ) assert len(new_ruler) == 0 assert len(new_ruler.labels) == 0 - assert new_ruler.phrase_matcher_attr is None new_ruler = new_ruler.from_bytes(ruler_bytes) assert len(new_ruler) == len(patterns) assert len(new_ruler.labels) == 4 - assert new_ruler.phrase_matcher_attr == "LOWER" -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_validate(nlp, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") - validated_ruler = EntityRuler(nlp, validate=True) +def test_entity_ruler_validate(nlp): + ruler = nlp.add_pipe("entity_ruler") + validated_ruler = nlp.add_pipe( + "entity_ruler", name="validated_ruler", config={"validate": True} + ) valid_pattern = {"label": "HELLO", "pattern": [{"LOWER": "HELLO"}]} invalid_pattern = {"label": "HELLO", "pattern": [{"ASDF": "HELLO"}]} @@ -362,16 +334,15 @@ def test_entity_ruler_validate(nlp, entity_ruler_factory): validated_ruler.add_patterns([invalid_pattern]) -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_properties(nlp, patterns, entity_ruler_factory): - ruler = EntityRuler(nlp, patterns=patterns, overwrite_ents=True) +def test_entity_ruler_properties(nlp, patterns): + ruler = nlp.add_pipe("entity_ruler", config={"overwrite_ents": True}) + ruler.add_patterns(patterns) assert sorted(ruler.labels) == sorted(["HELLO", "BYE", "COMPLEX", "TECH_ORG"]) - assert sorted(ruler.ent_ids) == ["a1", "a2"] + assert sorted(ruler.ids) == ["a1", "a2"] -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_overlapping_spans(nlp, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") +def test_entity_ruler_overlapping_spans(nlp): + ruler = nlp.add_pipe("entity_ruler") patterns = [ {"label": "FOOBAR", "pattern": "foo bar"}, {"label": "BARBAZ", "pattern": "bar baz"}, @@ -383,14 +354,13 @@ def test_entity_ruler_overlapping_spans(nlp, entity_ruler_factory): @pytest.mark.parametrize("n_process", [1, 2]) -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_multiprocessing(nlp, n_process, entity_ruler_factory): +def test_entity_ruler_multiprocessing(nlp, n_process): if isinstance(get_current_ops, NumpyOps) or n_process < 2: texts = ["I enjoy eating Pizza Hut pizza."] patterns = [{"label": "FASTFOOD", "pattern": "Pizza Hut", "id": "1234"}] - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") + ruler = nlp.add_pipe("entity_ruler") ruler.add_patterns(patterns) for doc in nlp.pipe(texts, n_process=2): @@ -398,9 +368,8 @@ def test_entity_ruler_multiprocessing(nlp, n_process, entity_ruler_factory): assert ent.ent_id_ == "1234" -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_serialize_jsonl(nlp, patterns, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") +def test_entity_ruler_serialize_jsonl(nlp, patterns): + ruler = nlp.add_pipe("entity_ruler") ruler.add_patterns(patterns) with make_tempdir() as d: ruler.to_disk(d / "test_ruler.jsonl") @@ -409,9 +378,8 @@ def test_entity_ruler_serialize_jsonl(nlp, patterns, entity_ruler_factory): ruler.from_disk(d / "non_existing.jsonl") # read from a bad jsonl file -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_serialize_dir(nlp, patterns, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") +def test_entity_ruler_serialize_dir(nlp, patterns): + ruler = nlp.add_pipe("entity_ruler") ruler.add_patterns(patterns) with make_tempdir() as d: ruler.to_disk(d / "test_ruler") @@ -420,9 +388,8 @@ def test_entity_ruler_serialize_dir(nlp, patterns, entity_ruler_factory): ruler.from_disk(d / "non_existing_dir") # read from a bad directory -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_remove_basic(nlp, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") +def test_entity_ruler_remove_basic(nlp): + ruler = nlp.add_pipe("entity_ruler") patterns = [ {"label": "PERSON", "pattern": "Dina", "id": "dina"}, {"label": "ORG", "pattern": "ACME", "id": "acme"}, @@ -432,24 +399,16 @@ def test_entity_ruler_remove_basic(nlp, entity_ruler_factory): doc = nlp("Dina went to school") assert len(ruler.patterns) == 3 assert len(doc.ents) == 1 - if isinstance(ruler, EntityRuler): - assert "PERSON||dina" in ruler.phrase_matcher assert doc.ents[0].label_ == "PERSON" assert doc.ents[0].text == "Dina" - if isinstance(ruler, EntityRuler): - ruler.remove("dina") - else: - ruler.remove_by_id("dina") + ruler.remove_by_id("dina") doc = nlp("Dina went to school") assert len(doc.ents) == 0 - if isinstance(ruler, EntityRuler): - assert "PERSON||dina" not in ruler.phrase_matcher assert len(ruler.patterns) == 2 -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_remove_same_id_multiple_patterns(nlp, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") +def test_entity_ruler_remove_same_id_multiple_patterns(nlp): + ruler = nlp.add_pipe("entity_ruler") patterns = [ {"label": "PERSON", "pattern": "Dina", "id": "dina"}, {"label": "ORG", "pattern": "DinaCorp", "id": "dina"}, @@ -458,25 +417,15 @@ def test_entity_ruler_remove_same_id_multiple_patterns(nlp, entity_ruler_factory ruler.add_patterns(patterns) doc = nlp("Dina founded DinaCorp and ACME.") assert len(ruler.patterns) == 3 - if isinstance(ruler, EntityRuler): - assert "PERSON||dina" in ruler.phrase_matcher - assert "ORG||dina" in ruler.phrase_matcher assert len(doc.ents) == 3 - if isinstance(ruler, EntityRuler): - ruler.remove("dina") - else: - ruler.remove_by_id("dina") + ruler.remove_by_id("dina") doc = nlp("Dina founded DinaCorp and ACME.") assert len(ruler.patterns) == 1 - if isinstance(ruler, EntityRuler): - assert "PERSON||dina" not in ruler.phrase_matcher - assert "ORG||dina" not in ruler.phrase_matcher assert len(doc.ents) == 1 -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_remove_nonexisting_pattern(nlp, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") +def test_entity_ruler_remove_nonexisting_pattern(nlp): + ruler = nlp.add_pipe("entity_ruler") patterns = [ {"label": "PERSON", "pattern": "Dina", "id": "dina"}, {"label": "ORG", "pattern": "ACME", "id": "acme"}, @@ -491,9 +440,8 @@ def test_entity_ruler_remove_nonexisting_pattern(nlp, entity_ruler_factory): ruler.remove_by_id("nepattern") -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_remove_several_patterns(nlp, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") +def test_entity_ruler_remove_several_patterns(nlp): + ruler = nlp.add_pipe("entity_ruler") patterns = [ {"label": "PERSON", "pattern": "Dina", "id": "dina"}, {"label": "ORG", "pattern": "ACME", "id": "acme"}, @@ -507,27 +455,20 @@ def test_entity_ruler_remove_several_patterns(nlp, entity_ruler_factory): assert doc.ents[0].text == "Dina" assert doc.ents[1].label_ == "ORG" assert doc.ents[1].text == "ACME" - if isinstance(ruler, EntityRuler): - ruler.remove("dina") - else: - ruler.remove_by_id("dina") + ruler.remove_by_id("dina") doc = nlp("Dina founded her company ACME") assert len(ruler.patterns) == 2 assert len(doc.ents) == 1 assert doc.ents[0].label_ == "ORG" assert doc.ents[0].text == "ACME" - if isinstance(ruler, EntityRuler): - ruler.remove("acme") - else: - ruler.remove_by_id("acme") + ruler.remove_by_id("acme") doc = nlp("Dina founded her company ACME") assert len(ruler.patterns) == 1 assert len(doc.ents) == 0 -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_remove_patterns_in_a_row(nlp, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") +def test_entity_ruler_remove_patterns_in_a_row(nlp): + ruler = nlp.add_pipe("entity_ruler") patterns = [ {"label": "PERSON", "pattern": "Dina", "id": "dina"}, {"label": "ORG", "pattern": "ACME", "id": "acme"}, @@ -543,21 +484,15 @@ def test_entity_ruler_remove_patterns_in_a_row(nlp, entity_ruler_factory): assert doc.ents[1].text == "ACME" assert doc.ents[2].label_ == "DATE" assert doc.ents[2].text == "her birthday" - if isinstance(ruler, EntityRuler): - ruler.remove("dina") - ruler.remove("acme") - ruler.remove("bday") - else: - ruler.remove_by_id("dina") - ruler.remove_by_id("acme") - ruler.remove_by_id("bday") + ruler.remove_by_id("dina") + ruler.remove_by_id("acme") + ruler.remove_by_id("bday") doc = nlp("Dina went to school") assert len(doc.ents) == 0 -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_remove_all_patterns(nlp, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") +def test_entity_ruler_remove_all_patterns(nlp): + ruler = nlp.add_pipe("entity_ruler") patterns = [ {"label": "PERSON", "pattern": "Dina", "id": "dina"}, {"label": "ORG", "pattern": "ACME", "id": "acme"}, @@ -565,29 +500,19 @@ def test_entity_ruler_remove_all_patterns(nlp, entity_ruler_factory): ] ruler.add_patterns(patterns) assert len(ruler.patterns) == 3 - if isinstance(ruler, EntityRuler): - ruler.remove("dina") - else: - ruler.remove_by_id("dina") + ruler.remove_by_id("dina") assert len(ruler.patterns) == 2 - if isinstance(ruler, EntityRuler): - ruler.remove("acme") - else: - ruler.remove_by_id("acme") + ruler.remove_by_id("acme") assert len(ruler.patterns) == 1 - if isinstance(ruler, EntityRuler): - ruler.remove("bday") - else: - ruler.remove_by_id("bday") + ruler.remove_by_id("bday") assert len(ruler.patterns) == 0 with pytest.warns(UserWarning): doc = nlp("Dina founded her company ACME on her birthday") assert len(doc.ents) == 0 -@pytest.mark.parametrize("entity_ruler_factory", ENTITY_RULERS) -def test_entity_ruler_remove_and_add(nlp, entity_ruler_factory): - ruler = nlp.add_pipe(entity_ruler_factory, name="entity_ruler") +def test_entity_ruler_remove_and_add(nlp): + ruler = nlp.add_pipe("entity_ruler") patterns = [{"label": "DATE", "pattern": "last time"}] ruler.add_patterns(patterns) doc = ruler( @@ -608,10 +533,7 @@ def test_entity_ruler_remove_and_add(nlp, entity_ruler_factory): assert doc.ents[0].text == "last time" assert doc.ents[1].label_ == "DATE" assert doc.ents[1].text == "this time" - if isinstance(ruler, EntityRuler): - ruler.remove("ttime") - else: - ruler.remove_by_id("ttime") + ruler.remove_by_id("ttime") doc = ruler( nlp.make_doc("I saw him last time we met, this time he brought some flowers") ) @@ -634,10 +556,7 @@ def test_entity_ruler_remove_and_add(nlp, entity_ruler_factory): ) assert len(ruler.patterns) == 3 assert len(doc.ents) == 3 - if isinstance(ruler, EntityRuler): - ruler.remove("ttime") - else: - ruler.remove_by_id("ttime") + ruler.remove_by_id("ttime") doc = ruler( nlp.make_doc( "I saw him last time we met, this time he brought some flowers, another time some chocolate." diff --git a/spacy/tests/serialize/test_serialize_pipeline.py b/spacy/tests/serialize/test_serialize_pipeline.py index b948bb76c..e49882441 100644 --- a/spacy/tests/serialize/test_serialize_pipeline.py +++ b/spacy/tests/serialize/test_serialize_pipeline.py @@ -8,7 +8,7 @@ import spacy from spacy import Vocab, load, registry from spacy.lang.en import English from spacy.language import Language -from spacy.pipeline import DependencyParser, EntityRecognizer, EntityRuler +from spacy.pipeline import DependencyParser, EntityRecognizer from spacy.pipeline import SentenceRecognizer, Tagger, TextCategorizer from spacy.pipeline import TrainablePipe from spacy.pipeline.dep_parser import DEFAULT_PARSER_MODEL @@ -85,58 +85,17 @@ def test_issue_3526_1(en_vocab): {"label": "TECH_ORG", "pattern": "Apple", "id": "a1"}, ] nlp = Language(vocab=en_vocab) - ruler = EntityRuler(nlp, patterns=patterns, overwrite_ents=True) + ruler = nlp.add_pipe("entity_ruler", config={"overwrite_ents": True}) + ruler.add_patterns(patterns) ruler_bytes = ruler.to_bytes() assert len(ruler) == len(patterns) assert len(ruler.labels) == 4 - assert ruler.overwrite - new_ruler = EntityRuler(nlp) + new_ruler = nlp.add_pipe( + "entity_ruler", name="new_ruler", config={"overwrite_ents": True} + ) new_ruler = new_ruler.from_bytes(ruler_bytes) assert len(new_ruler) == len(ruler) assert len(new_ruler.labels) == 4 - assert new_ruler.overwrite == ruler.overwrite - assert new_ruler.ent_id_sep == ruler.ent_id_sep - - -@pytest.mark.issue(3526) -def test_issue_3526_2(en_vocab): - patterns = [ - {"label": "HELLO", "pattern": "hello world"}, - {"label": "BYE", "pattern": [{"LOWER": "bye"}, {"LOWER": "bye"}]}, - {"label": "HELLO", "pattern": [{"ORTH": "HELLO"}]}, - {"label": "COMPLEX", "pattern": [{"ORTH": "foo", "OP": "*"}]}, - {"label": "TECH_ORG", "pattern": "Apple", "id": "a1"}, - ] - nlp = Language(vocab=en_vocab) - ruler = EntityRuler(nlp, patterns=patterns, overwrite_ents=True) - bytes_old_style = srsly.msgpack_dumps(ruler.patterns) - new_ruler = EntityRuler(nlp) - new_ruler = new_ruler.from_bytes(bytes_old_style) - assert len(new_ruler) == len(ruler) - for pattern in ruler.patterns: - assert pattern in new_ruler.patterns - assert new_ruler.overwrite is not ruler.overwrite - - -@pytest.mark.issue(3526) -def test_issue_3526_3(en_vocab): - patterns = [ - {"label": "HELLO", "pattern": "hello world"}, - {"label": "BYE", "pattern": [{"LOWER": "bye"}, {"LOWER": "bye"}]}, - {"label": "HELLO", "pattern": [{"ORTH": "HELLO"}]}, - {"label": "COMPLEX", "pattern": [{"ORTH": "foo", "OP": "*"}]}, - {"label": "TECH_ORG", "pattern": "Apple", "id": "a1"}, - ] - nlp = Language(vocab=en_vocab) - ruler = EntityRuler(nlp, patterns=patterns, overwrite_ents=True) - with make_tempdir() as tmpdir: - out_file = tmpdir / "entity_ruler" - srsly.write_jsonl(out_file.with_suffix(".jsonl"), ruler.patterns) - new_ruler = EntityRuler(nlp).from_disk(out_file) - for pattern in ruler.patterns: - assert pattern in new_ruler.patterns - assert len(new_ruler) == len(ruler) - assert new_ruler.overwrite is not ruler.overwrite @pytest.mark.issue(3526) @@ -150,16 +109,14 @@ def test_issue_3526_4(en_vocab): nlp.to_disk(tmpdir) ruler = nlp.get_pipe("entity_ruler") assert ruler.patterns == [{"label": "ORG", "pattern": "Apple"}] - assert ruler.overwrite is True nlp2 = load(tmpdir) new_ruler = nlp2.get_pipe("entity_ruler") assert new_ruler.patterns == [{"label": "ORG", "pattern": "Apple"}] - assert new_ruler.overwrite is True @pytest.mark.issue(4042) def test_issue4042(): - """Test that serialization of an EntityRuler before NER works fine.""" + """Test that serialization of an entity_ruler before NER works fine.""" nlp = English() # add ner pipe ner = nlp.add_pipe("ner") diff --git a/website/docs/api/entityruler.md b/website/docs/api/entityruler.md index ef7acbbf1..651c87585 100644 --- a/website/docs/api/entityruler.md +++ b/website/docs/api/entityruler.md @@ -1,13 +1,24 @@ --- title: EntityRuler -tag: class -source: spacy/pipeline/entity_ruler.py new: 2.1 teaser: 'Pipeline component for rule-based named entity recognition' api_string_name: entity_ruler api_trainable: false --- + + +As of spaCy v4, there is no separate `EntityRuler` class. The entity ruler is +implemented as a special case of the `SpanRuler` component. + +See the [migration guide](#migrating) below for differences between the v3 +`EntityRuler` and v4 `SpanRuler` implementations of the `entity_ruler` +component. + +See the [`SpanRuler`](/api/spanruler) API docs for the full API. + + + The entity ruler lets you add spans to the [`Doc.ents`](/api/doc#ents) using token-based rules or exact phrase matches. It can be combined with the statistical [`EntityRecognizer`](/api/entityrecognizer) to boost accuracy, or @@ -63,271 +74,51 @@ how the component should be configured. You can override its settings via the | `ent_id_sep` | Separator used internally for entity IDs. Defaults to `"\|\|"`. ~~str~~ | | `scorer` | The scoring method. Defaults to [`spacy.scorer.get_ner_prf`](/api/scorer#get_ner_prf). ~~Optional[Callable]~~ | -```python -%%GITHUB_SPACY/spacy/pipeline/entity_ruler.py +## Migrating from v3 {#migrating} + +### Loading patterns + +Unlike the v3 `EntityRuler`, the `SpanRuler` cannot load patterns on +initialization with `SpanRuler(patterns=patterns)` or directly from a JSONL file +path with `SpanRuler.from_disk(jsonl_path)`. Patterns should be loaded from the +JSONL file separately and then added through +[`SpanRuler.initialize`](/api/spanruler#initialize]) or +[`SpanRuler.add_patterns`](/api/spanruler#add_patterns). + +```diff + ruler = nlp.get_pipe("entity_ruler") +- ruler.from_disk("patterns.jsonl") ++ import srsly ++ patterns = srsly.read_jsonl("patterns.jsonl") ++ ruler.add_patterns(patterns) ``` -## EntityRuler.\_\_init\_\_ {#init tag="method"} +### Saving patterns -Initialize the entity ruler. If patterns are supplied here, they need to be a -list of dictionaries with a `"label"` and `"pattern"` key. A pattern can either -be a token pattern (list) or a phrase pattern (string). For example: -`{"label": "ORG", "pattern": "Apple"}`. +`SpanRuler.to_disk` always saves the full component data to a directory and does +not include an option to save the patterns to a single JSONL file. -> #### Example -> -> ```python -> # Construction via add_pipe -> ruler = nlp.add_pipe("entity_ruler") -> -> # Construction from class -> from spacy.pipeline import EntityRuler -> ruler = EntityRuler(nlp, overwrite_ents=True) -> ``` +```diff + ruler = nlp.get_pipe("entity_ruler") +- ruler.to_disk("patterns.jsonl") ++ import srsly ++ srsly.write_jsonl("patterns.jsonl", ruler.patterns) +``` -| Name | Description | -| --------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `nlp` | The shared nlp object to pass the vocab to the matchers and process phrase patterns. ~~Language~~ | -| `name` 3 | Instance name of the current pipeline component. Typically passed in automatically from the factory when the component is added. Used to disable the current entity ruler while creating phrase patterns with the nlp object. ~~str~~ | -| _keyword-only_ | | -| `phrase_matcher_attr` | Optional attribute name match on for the internal [`PhraseMatcher`](/api/phrasematcher), e.g. `LOWER` to match on the lowercase token text. Defaults to `None`. ~~Optional[Union[int, str]]~~ | -| `validate` | Whether patterns should be validated, passed to Matcher and PhraseMatcher as `validate`. Defaults to `False`. ~~bool~~ | -| `overwrite_ents` | If existing entities are present, e.g. entities added by the model, overwrite them by matches if necessary. Defaults to `False`. ~~bool~~ | -| `ent_id_sep` | Separator used internally for entity IDs. Defaults to `"\|\|"`. ~~str~~ | -| `patterns` | Optional patterns to load in on initialization. ~~Optional[List[Dict[str, Union[str, List[dict]]]]]~~ | +### Accessing token and phrase patterns -## EntityRuler.initialize {#initialize tag="method" new="3"} +The separate token patterns and phrase patterns are no longer accessible under +`ruler.token_patterns` or `ruler.phrase_patterns`. You can access the combined +patterns in their original format using the property +[`SpanRuler.patterns`](/api/spanruler#patterns). -Initialize the component with data and used before training to load in rules -from a [pattern file](/usage/rule-based-matching/#entityruler-files). This method -is typically called by [`Language.initialize`](/api/language#initialize) and -lets you customize arguments it receives via the -[`[initialize.components]`](/api/data-formats#config-initialize) block in the -config. +### Removing patterns by ID -> #### Example -> -> ```python -> entity_ruler = nlp.add_pipe("entity_ruler") -> entity_ruler.initialize(lambda: [], nlp=nlp, patterns=patterns) -> ``` -> -> ```ini -> ### config.cfg -> [initialize.components.entity_ruler] -> -> [initialize.components.entity_ruler.patterns] -> @readers = "srsly.read_jsonl.v1" -> path = "corpus/entity_ruler_patterns.jsonl -> ``` +[`SpanRuler.remove`](/api/spanruler#remove) removes by label rather than ID. To +remove by ID, use [`SpanRuler.remove_by_id`](/api/spanruler#remove_by_id): -| Name | Description | -| -------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `get_examples` | Function that returns gold-standard annotations in the form of [`Example`](/api/example) objects. Not used by the `EntityRuler`. ~~Callable[[], Iterable[Example]]~~ | -| _keyword-only_ | | -| `nlp` | The current `nlp` object. Defaults to `None`. ~~Optional[Language]~~ | -| `patterns` | The list of patterns. Defaults to `None`. ~~Optional[Sequence[Dict[str, Union[str, List[Dict[str, Any]]]]]]~~ | - -## EntityRuler.\_\len\_\_ {#len tag="method"} - -The number of all patterns added to the entity ruler. - -> #### Example -> -> ```python -> ruler = nlp.add_pipe("entity_ruler") -> assert len(ruler) == 0 -> ruler.add_patterns([{"label": "ORG", "pattern": "Apple"}]) -> assert len(ruler) == 1 -> ``` - -| Name | Description | -| ----------- | ------------------------------- | -| **RETURNS** | The number of patterns. ~~int~~ | - -## EntityRuler.\_\_contains\_\_ {#contains tag="method"} - -Whether a label is present in the patterns. - -> #### Example -> -> ```python -> ruler = nlp.add_pipe("entity_ruler") -> ruler.add_patterns([{"label": "ORG", "pattern": "Apple"}]) -> assert "ORG" in ruler -> assert not "PERSON" in ruler -> ``` - -| Name | Description | -| ----------- | ----------------------------------------------------- | -| `label` | The label to check. ~~str~~ | -| **RETURNS** | Whether the entity ruler contains the label. ~~bool~~ | - -## EntityRuler.\_\_call\_\_ {#call tag="method"} - -Find matches in the `Doc` and add them to the `doc.ents`. Typically, this -happens automatically after the component has been added to the pipeline using -[`nlp.add_pipe`](/api/language#add_pipe). If the entity ruler was initialized -with `overwrite_ents=True`, existing entities will be replaced if they overlap -with the matches. When matches overlap in a Doc, the entity ruler prioritizes -longer patterns over shorter, and if equal the match occuring first in the Doc -is chosen. - -> #### Example -> -> ```python -> ruler = nlp.add_pipe("entity_ruler") -> ruler.add_patterns([{"label": "ORG", "pattern": "Apple"}]) -> -> doc = nlp("A text about Apple.") -> ents = [(ent.text, ent.label_) for ent in doc.ents] -> assert ents == [("Apple", "ORG")] -> ``` - -| Name | Description | -| ----------- | -------------------------------------------------------------------- | -| `doc` | The `Doc` object to process, e.g. the `Doc` in the pipeline. ~~Doc~~ | -| **RETURNS** | The modified `Doc` with added entities, if available. ~~Doc~~ | - -## EntityRuler.add_patterns {#add_patterns tag="method"} - -Add patterns to the entity ruler. A pattern can either be a token pattern (list -of dicts) or a phrase pattern (string). For more details, see the usage guide on -[rule-based matching](/usage/rule-based-matching). - -> #### Example -> -> ```python -> patterns = [ -> {"label": "ORG", "pattern": "Apple"}, -> {"label": "GPE", "pattern": [{"lower": "san"}, {"lower": "francisco"}]} -> ] -> ruler = nlp.add_pipe("entity_ruler") -> ruler.add_patterns(patterns) -> ``` - -| Name | Description | -| ---------- | ---------------------------------------------------------------- | -| `patterns` | The patterns to add. ~~List[Dict[str, Union[str, List[dict]]]]~~ | - - -## EntityRuler.remove {#remove tag="method" new="3.2.1"} - -Remove a pattern by its ID from the entity ruler. A `ValueError` is raised if the ID does not exist. - -> #### Example -> -> ```python -> patterns = [{"label": "ORG", "pattern": "Apple", "id": "apple"}] -> ruler = nlp.add_pipe("entity_ruler") -> ruler.add_patterns(patterns) -> ruler.remove("apple") -> ``` - -| Name | Description | -| ---------- | ---------------------------------------------------------------- | -| `id` | The ID of the pattern rule. ~~str~~ | - -## EntityRuler.to_disk {#to_disk tag="method"} - -Save the entity ruler patterns to a directory. The patterns will be saved as -newline-delimited JSON (JSONL). If a file with the suffix `.jsonl` is provided, -only the patterns are saved as JSONL. If a directory name is provided, a -`patterns.jsonl` and `cfg` file with the component configuration is exported. - -> #### Example -> -> ```python -> ruler = nlp.add_pipe("entity_ruler") -> ruler.to_disk("/path/to/patterns.jsonl") # saves patterns only -> ruler.to_disk("/path/to/entity_ruler") # saves patterns and config -> ``` - -| Name | Description | -| ------ | -------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `path` | A path to a JSONL file or directory, which will be created if it doesn't exist. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | - -## EntityRuler.from_disk {#from_disk tag="method"} - -Load the entity ruler from a path. Expects either a file containing -newline-delimited JSON (JSONL) with one entry per line, or a directory -containing a `patterns.jsonl` file and a `cfg` file with the component -configuration. - -> #### Example -> -> ```python -> ruler = nlp.add_pipe("entity_ruler") -> ruler.from_disk("/path/to/patterns.jsonl") # loads patterns only -> ruler.from_disk("/path/to/entity_ruler") # loads patterns and config -> ``` - -| Name | Description | -| ----------- | ------------------------------------------------------------------------------------------------------------- | -| `path` | A path to a JSONL file or directory. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ | -| **RETURNS** | The modified `EntityRuler` object. ~~EntityRuler~~ | - -## EntityRuler.to_bytes {#to_bytes tag="method"} - -Serialize the entity ruler patterns to a bytestring. - -> #### Example -> -> ```python -> ruler = nlp.add_pipe("entity_ruler") -> ruler_bytes = ruler.to_bytes() -> ``` - -| Name | Description | -| ----------- | ---------------------------------- | -| **RETURNS** | The serialized patterns. ~~bytes~~ | - -## EntityRuler.from_bytes {#from_bytes tag="method"} - -Load the pipe from a bytestring. Modifies the object in place and returns it. - -> #### Example -> -> ```python -> ruler_bytes = ruler.to_bytes() -> ruler = nlp.add_pipe("entity_ruler") -> ruler.from_bytes(ruler_bytes) -> ``` - -| Name | Description | -| ------------ | -------------------------------------------------- | -| `bytes_data` | The bytestring to load. ~~bytes~~ | -| **RETURNS** | The modified `EntityRuler` object. ~~EntityRuler~~ | - -## EntityRuler.labels {#labels tag="property"} - -All labels present in the match patterns. - -| Name | Description | -| ----------- | -------------------------------------- | -| **RETURNS** | The string labels. ~~Tuple[str, ...]~~ | - -## EntityRuler.ent_ids {#ent_ids tag="property" new="2.2.2"} - -All entity IDs present in the `id` properties of the match patterns. - -| Name | Description | -| ----------- | ----------------------------------- | -| **RETURNS** | The string IDs. ~~Tuple[str, ...]~~ | - -## EntityRuler.patterns {#patterns tag="property"} - -Get all patterns that were added to the entity ruler. - -| Name | Description | -| ----------- | ---------------------------------------------------------------------------------------- | -| **RETURNS** | The original patterns, one dictionary per pattern. ~~List[Dict[str, Union[str, dict]]]~~ | - -## Attributes {#attributes} - -| Name | Description | -| ----------------- | --------------------------------------------------------------------------------------------------------------------- | -| `matcher` | The underlying matcher used to process token patterns. ~~Matcher~~ | -| `phrase_matcher` | The underlying phrase matcher used to process phrase patterns. ~~PhraseMatcher~~ | -| `token_patterns` | The token patterns present in the entity ruler, keyed by label. ~~Dict[str, List[Dict[str, Union[str, List[dict]]]]~~ | -| `phrase_patterns` | The phrase patterns present in the entity ruler, keyed by label. ~~Dict[str, List[Doc]]~~ | +```diff + ruler = nlp.get_pipe("entity_ruler") +- ruler.remove("id") ++ ruler.remove_by_id("id") +``` diff --git a/website/docs/api/spanruler.md b/website/docs/api/spanruler.md index b573f7c58..1339d0967 100644 --- a/website/docs/api/spanruler.md +++ b/website/docs/api/spanruler.md @@ -13,6 +13,17 @@ The span ruler lets you add spans to [`Doc.spans`](/api/doc#spans) and/or usage examples, see the docs on [rule-based span matching](/usage/rule-based-matching#spanruler). + + +As of spaCy v4, there is no separate `EntityRuler` class. The entity ruler is +implemented as a special case of the `SpanRuler` component. + +See the [migration guide](/api/entityruler#migrating) for differences between +the v3 `EntityRuler` and v4 `SpanRuler` implementations of the `entity_ruler` +component. + + + ## Assigned Attributes {#assigned-attributes} Matches will be saved to `Doc.spans[spans_key]` as a diff --git a/website/docs/usage/101/_architecture.md b/website/docs/usage/101/_architecture.md index 4ebca2756..ecc7f2fd9 100644 --- a/website/docs/usage/101/_architecture.md +++ b/website/docs/usage/101/_architecture.md @@ -41,25 +41,27 @@ components for different language processing tasks and also allows adding ![The processing pipeline](../../images/pipeline.svg) -| Name | Description | -| ----------------------------------------------- | ------------------------------------------------------------------------------------------- | -| [`AttributeRuler`](/api/attributeruler) | Set token attributes using matcher rules. | -| [`DependencyParser`](/api/dependencyparser) | Predict syntactic dependencies. | -| [`EditTreeLemmatizer`](/api/edittreelemmatizer) | Predict base forms of words. | -| [`EntityLinker`](/api/entitylinker) | Disambiguate named entities to nodes in a knowledge base. | -| [`EntityRecognizer`](/api/entityrecognizer) | Predict named entities, e.g. persons or products. | -| [`EntityRuler`](/api/entityruler) | Add entity spans to the `Doc` using token-based rules or exact phrase matches. | -| [`Lemmatizer`](/api/lemmatizer) | Determine the base forms of words using rules and lookups. | -| [`Morphologizer`](/api/morphologizer) | Predict morphological features and coarse-grained part-of-speech tags. | -| [`SentenceRecognizer`](/api/sentencerecognizer) | Predict sentence boundaries. | -| [`Sentencizer`](/api/sentencizer) | Implement rule-based sentence boundary detection that doesn't require the dependency parse. | -| [`Tagger`](/api/tagger) | Predict part-of-speech tags. | -| [`TextCategorizer`](/api/textcategorizer) | Predict categories or labels over the whole document. | -| [`Tok2Vec`](/api/tok2vec) | Apply a "token-to-vector" model and set its outputs. | -| [`Tokenizer`](/api/tokenizer) | Segment raw text and create `Doc` objects from the words. | -| [`TrainablePipe`](/api/pipe) | Class that all trainable pipeline components inherit from. | -| [`Transformer`](/api/transformer) | Use a transformer model and set its outputs. | -| [Other functions](/api/pipeline-functions) | Automatically apply something to the `Doc`, e.g. to merge spans of tokens. | +| Component name | Component class | Description | +| ---------------------- | ---------------------------------------------------- | ------------------------------------------------------------------------------------------- | +| `attribute_ruler` | [`AttributeRuler`](/api/attributeruler) | Set token attributes using matcher rules. | +| `entity_linker` | [`EntityLinker`](/api/entitylinker) | Disambiguate named entities to nodes in a knowledge base. | +| `entity_ruler` | [`SpanRuler`](/api/spanruler) | Add entity spans to the `Doc` using token-based rules or exact phrase matches. | +| `lemmatizer` | [`Lemmatizer`](/api/lemmatizer) | Determine the base forms of words using rules and lookups. | +| `morphologizer` | [`Morphologizer`](/api/morphologizer) | Predict morphological features and coarse-grained part-of-speech tags. | +| `ner` | [`EntityRecognizer`](/api/entityrecognizer) | Predict named entities, e.g. persons or products. | +| `parser` | [`DependencyParser`](/api/dependencyparser) | Predict syntactic dependencies. | +| `senter` | [`SentenceRecognizer`](/api/sentencerecognizer) | Predict sentence boundaries. | +| `sentencizer` | [`Sentencizer`](/api/sentencizer) | Implement rule-based sentence boundary detection that doesn't require the dependency parse. | +| `span_ruler` | [`SpanRuler`](/api/spanruler) | Add spans to the `Doc` using token-based rules or exact phrase matches. | +| `tagger` | [`Tagger`](/api/tagger) | Predict part-of-speech tags. | +| `textcat` | [`TextCategorizer`](/api/textcategorizer) | Predict exactly one category or label over a whole document. | +| `textcat_multilabel` | [`MultiLabel_TextCategorizer`](/api/textcategorizer) | Predict 0, 1 or more categories or labels over a whole document. | +| `tok2vec` | [`Tok2Vec`](/api/tok2vec) | Apply a "token-to-vector" model and set its outputs. | +| `tokenizer` | [`Tokenizer`](/api/tokenizer) | Segment raw text and create `Doc` objects from the words. | +| `trainable_lemmatizer` | [`EditTreeLemmatizer`](/api/edittreelemmatizer) | Predict base forms of words. | +| `transformer` | [`Transformer`](/api/transformer) | Use a transformer model and set its outputs. | +| - | [`TrainablePipe`](/api/pipe) | Class that all trainable pipeline components inherit from. | +| - | [Other functions](/api/pipeline-functions) | Automatically apply something to the `Doc`, e.g. to merge spans of tokens. | ### Matchers {#architecture-matchers} diff --git a/website/docs/usage/101/_pipelines.md b/website/docs/usage/101/_pipelines.md index f43219f41..3a6d67a37 100644 --- a/website/docs/usage/101/_pipelines.md +++ b/website/docs/usage/101/_pipelines.md @@ -53,9 +53,9 @@ example, a custom lemmatizer may need the part-of-speech tags assigned, so it'll only work if it's added after the tagger. The parser will respect pre-defined sentence boundaries, so if a previous component in the pipeline sets them, its dependency predictions may be different. Similarly, it matters if you add the -[`EntityRuler`](/api/entityruler) before or after the statistical entity -recognizer: if it's added before, the entity recognizer will take the existing -entities into account when making predictions. The +[`SpanRuler`](/api/spanruler) before or after the statistical entity recognizer: +if it's added before and it is writing to `doc.ents`, then the entity recognizer +will take those existing entities into account when making predictions. The [`EntityLinker`](/api/entitylinker), which resolves named entities to knowledge base IDs, should be preceded by a pipeline component that recognizes entities such as the [`EntityRecognizer`](/api/entityrecognizer). diff --git a/website/docs/usage/processing-pipelines.md b/website/docs/usage/processing-pipelines.md index bd28810ae..2463b523f 100644 --- a/website/docs/usage/processing-pipelines.md +++ b/website/docs/usage/processing-pipelines.md @@ -303,13 +303,14 @@ available pipeline components and component functions. > ruler = nlp.add_pipe("entity_ruler") > ``` -| String name | Component | Description | +| Component name | Component class | Description | | ---------------------- | ---------------------------------------------------- | ----------------------------------------------------------------------------------------- | | `tagger` | [`Tagger`](/api/tagger) | Assign part-of-speech-tags. | | `parser` | [`DependencyParser`](/api/dependencyparser) | Assign dependency labels. | | `ner` | [`EntityRecognizer`](/api/entityrecognizer) | Assign named entities. | | `entity_linker` | [`EntityLinker`](/api/entitylinker) | Assign knowledge base IDs to named entities. Should be added after the entity recognizer. | -| `entity_ruler` | [`EntityRuler`](/api/entityruler) | Assign named entities based on pattern rules and dictionaries. | +| `span_ruler` | [`SpanRuler`](/api/spanruler) | Assign spans based on pattern rules and dictionaries. | +| `entity_ruler` | [`SpanRuler`](/api/spanruler) | Assign named entities based on pattern rules and dictionaries. | | `textcat` | [`TextCategorizer`](/api/textcategorizer) | Assign text categories: exactly one category is predicted per document. | | `textcat_multilabel` | [`MultiLabel_TextCategorizer`](/api/textcategorizer) | Assign text categories in a multi-label setting: zero, one or more labels per document. | | `lemmatizer` | [`Lemmatizer`](/api/lemmatizer) | Assign base forms to words using rules and lookups. | diff --git a/website/docs/usage/rule-based-matching.md b/website/docs/usage/rule-based-matching.md index bf1891df1..d9f551820 100644 --- a/website/docs/usage/rule-based-matching.md +++ b/website/docs/usage/rule-based-matching.md @@ -375,7 +375,7 @@ scoped quantifiers – instead, you can build those behaviors with `on_match` callbacks. | OP | Description | -|---------|------------------------------------------------------------------------| +| ------- | ---------------------------------------------------------------------- | | `!` | Negate the pattern, by requiring it to match exactly 0 times. | | `?` | Make the pattern optional, by allowing it to match 0 or 1 times. | | `+` | Require the pattern to match 1 or more times. | @@ -471,7 +471,7 @@ matches = matcher(doc) ``` A very similar logic has been implemented in the built-in -[`EntityRuler`](/api/entityruler) by the way. It also takes care of handling +[`entity_ruler`](/api/entityruler) by the way. It also takes care of handling overlapping matches, which you would otherwise have to take care of yourself. > #### Tip: Visualizing matches @@ -1270,7 +1270,7 @@ of patterns such as `{}` that match any token in the sentence. ## Rule-based entity recognition {#entityruler new="2.1"} -The [`EntityRuler`](/api/entityruler) is a component that lets you add named +The [`entity_ruler`](/api/entityruler) is a component that lets you add named entities based on pattern dictionaries, which makes it easy to combine rule-based and statistical named entity recognition for even more powerful pipelines. @@ -1295,13 +1295,12 @@ pattern. The entity ruler accepts two types of patterns: ### Using the entity ruler {#entityruler-usage} -The [`EntityRuler`](/api/entityruler) is a pipeline component that's typically -added via [`nlp.add_pipe`](/api/language#add_pipe). When the `nlp` object is -called on a text, it will find matches in the `doc` and add them as entities to -the `doc.ents`, using the specified pattern label as the entity label. If any -matches were to overlap, the pattern matching most tokens takes priority. If -they also happen to be equally long, then the match occurring first in the `Doc` -is chosen. +The `entity_ruler` is a pipeline component that's typically added via +[`nlp.add_pipe`](/api/language#add_pipe). When the `nlp` object is called on a +text, it will find matches in the `doc` and add them as entities to `doc.ents`, +using the specified pattern label as the entity label. If any matches were to +overlap, the pattern matching most tokens takes priority. If they also happen to +be equally long, then the match occurring first in the `Doc` is chosen. ```python ### {executable="true"} @@ -1339,7 +1338,7 @@ doc = nlp("MyCorp Inc. is a company in the U.S.") print([(ent.text, ent.label_) for ent in doc.ents]) ``` -#### Validating and debugging EntityRuler patterns {#entityruler-pattern-validation new="2.1.8"} +#### Validating and debugging entity ruler patterns {#entityruler-pattern-validation new="2.1.8"} The entity ruler can validate patterns against a JSON schema with the config setting `"validate"`. See details under @@ -1351,9 +1350,9 @@ ruler = nlp.add_pipe("entity_ruler", config={"validate": True}) ### Adding IDs to patterns {#entityruler-ent-ids new="2.2.2"} -The [`EntityRuler`](/api/entityruler) can also accept an `id` attribute for each -pattern. Using the `id` attribute allows multiple patterns to be associated with -the same entity. +The [`entity_ruler`](/api/entityruler) can also accept an `id` attribute for +each pattern. Using the `id` attribute allows multiple patterns to be associated +with the same entity. ```python ### {executable="true"} @@ -1373,10 +1372,10 @@ doc2 = nlp("Apple is opening its first big office in San Fran.") print([(ent.text, ent.label_, ent.id_) for ent in doc2.ents]) ``` -If the `id` attribute is included in the [`EntityRuler`](/api/entityruler) -patterns, the `id_` property of the matched entity is set to the `id` given -in the patterns. So in the example above it's easy to identify that "San -Francisco" and "San Fran" are both the same entity. +If the `id` attribute is included in the [`entity_ruler`](/api/entityruler) +patterns, the `id_` property of the matched entity is set to the `id` given in +the patterns. So in the example above it's easy to identify that "San Francisco" +and "San Fran" are both the same entity. ### Using pattern files {#entityruler-files} @@ -1400,13 +1399,13 @@ new_ruler = nlp.add_pipe("entity_ruler").from_disk("./patterns.jsonl") If you're using the [Prodigy](https://prodi.gy) annotation tool, you might recognize these pattern files from bootstrapping your named entity and text -classification labelling. The patterns for the `EntityRuler` follow the same +classification labelling. The patterns for the `entity_ruler` follow the same syntax, so you can use your existing Prodigy pattern files in spaCy, and vice versa. -When you save out an `nlp` object that has an `EntityRuler` added to its +When you save out an `nlp` object that has an `entity_ruler` added to its pipeline, its patterns are automatically exported to the pipeline directory: ```python @@ -1429,9 +1428,9 @@ rules included! When using a large amount of **phrase patterns** (roughly > 10000) it's useful to understand how the `add_patterns` function of the entity ruler works. For -each **phrase pattern**, the EntityRuler calls the nlp object to construct a doc -object. This happens in case you try to add the EntityRuler at the end of an -existing pipeline with, for example, a POS tagger and want to extract matches +each **phrase pattern**, the entity ruler calls the nlp object to construct a +doc object. This happens in case you try to add the entity ruler at the end of +an existing pipeline with, for example, a POS tagger and want to extract matches based on the pattern's POS signature. In this case you would pass a config value of `"phrase_matcher_attr": "POS"` for the entity ruler. diff --git a/website/docs/usage/saving-loading.md b/website/docs/usage/saving-loading.md index 9a4b584a3..d2b67b199 100644 --- a/website/docs/usage/saving-loading.md +++ b/website/docs/usage/saving-loading.md @@ -193,13 +193,13 @@ the data to and from a JSON file. > #### Real-world example > -> To see custom serialization methods in action, check out the new -> [`EntityRuler`](/api/entityruler) component and its -> [source](%%GITHUB_SPACY/spacy/pipeline/entity_ruler.py). Patterns added to the +> To see custom serialization methods in action, check out the +> [`SpanRuler`](/api/spanruler) component and its +> [source](%%GITHUB_SPACY/spacy/pipeline/span_ruler.py). Patterns added to the > component will be saved to a `.jsonl` file if the pipeline is serialized to > disk, and to a bytestring if the pipeline is serialized to bytes. This allows -> saving out a pipeline with a rule-based entity recognizer and including all -> rules _with_ the component data. +> saving out a pipeline with rule-based components _with_ all the component +> data. ```python ### {highlight="16-23,25-30"} diff --git a/website/docs/usage/training.md b/website/docs/usage/training.md index 27a8bbca7..5ee148224 100644 --- a/website/docs/usage/training.md +++ b/website/docs/usage/training.md @@ -424,7 +424,7 @@ your components during training, and the most common scenarios are: 2. Update an existing **trained component** with more examples. 3. Include an existing trained component without updating it. 4. Include a non-trainable component, like a rule-based - [`EntityRuler`](/api/entityruler) or [`Sentencizer`](/api/sentencizer), or a + [`SpanRuler`](/api/spanruler) or [`Sentencizer`](/api/sentencizer), or a fully [custom component](/usage/processing-pipelines#custom-components). If a component block defines a `factory`, spaCy will look it up in the From 88d35450dcedd89fa739640d8a8d3e62f3643b4a Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Tue, 25 Oct 2022 14:53:18 +0200 Subject: [PATCH 055/161] Rename test helper method with non-test_ name (#11701) --- spacy/tests/test_models.py | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/spacy/tests/test_models.py b/spacy/tests/test_models.py index 2306cabb7..d91ed1201 100644 --- a/spacy/tests/test_models.py +++ b/spacy/tests/test_models.py @@ -23,7 +23,7 @@ def get_textcat_bow_kwargs(): def get_textcat_cnn_kwargs(): - return {"tok2vec": test_tok2vec(), "exclusive_classes": False, "nO": 13} + return {"tok2vec": make_test_tok2vec(), "exclusive_classes": False, "nO": 13} def get_all_params(model): @@ -65,7 +65,7 @@ def get_tok2vec_kwargs(): } -def test_tok2vec(): +def make_test_tok2vec(): return build_Tok2Vec_model(**get_tok2vec_kwargs()) From 8740e4341f03fe2720f50c64e2f94a339d6bd4be Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Tue, 25 Oct 2022 14:54:54 +0200 Subject: [PATCH 056/161] Update languages and version in README and website (#11694) --- README.md | 6 +++--- website/meta/languages.json | 28 ++++++++++++++++++++++++++-- 2 files changed, 29 insertions(+), 5 deletions(-) diff --git a/README.md b/README.md index d9ef83e01..abfc3da67 100644 --- a/README.md +++ b/README.md @@ -8,7 +8,7 @@ be used in real products. spaCy comes with [pretrained pipelines](https://spacy.io/models) and -currently supports tokenization and training for **60+ languages**. It features +currently supports tokenization and training for **70+ languages**. It features state-of-the-art speed and **neural network models** for tagging, parsing, **named entity recognition**, **text classification** and more, multi-task learning with pretrained **transformers** like BERT, as well as a @@ -16,7 +16,7 @@ production-ready [**training system**](https://spacy.io/usage/training) and easy model packaging, deployment and workflow management. spaCy is commercial open-source software, released under the MIT license. -💫 **Version 3.4.0 out now!** +💫 **Version 3.4 out now!** [Check out the release notes here.](https://github.com/explosion/spaCy/releases) [![Azure Pipelines](https://img.shields.io/azure-devops/build/explosion-ai/public/8/master.svg?logo=azure-pipelines&style=flat-square&label=build)](https://dev.azure.com/explosion-ai/public/_build?definitionId=8) @@ -79,7 +79,7 @@ more people can benefit from it. ## Features -- Support for **60+ languages** +- Support for **70+ languages** - **Trained pipelines** for different languages and tasks - Multi-task learning with pretrained **transformers** like BERT - Support for pretrained **word vectors** and embeddings diff --git a/website/meta/languages.json b/website/meta/languages.json index 0028b4a5f..bd1535c90 100644 --- a/website/meta/languages.json +++ b/website/meta/languages.json @@ -4,12 +4,22 @@ "code": "af", "name": "Afrikaans" }, + { + "code": "am", + "name": "Amharic", + "has_examples": true + }, { "code": "ar", "name": "Arabic", "example": "هذه جملة", "has_examples": true }, + { + "code": "az", + "name": "Azerbaijani", + "has_examples": true + }, { "code": "bg", "name": "Bulgarian", @@ -65,7 +75,7 @@ { "code": "dsb", "name": "Lower Sorbian", - "has_examples": true + "has_examples": true }, { "code": "el", @@ -142,6 +152,11 @@ "code": "ga", "name": "Irish" }, + { + "code": "grc", + "name": "Ancient Greek", + "has_examples": true + }, { "code": "gu", "name": "Gujarati", @@ -172,7 +187,7 @@ { "code": "hsb", "name": "Upper Sorbian", - "has_examples": true + "has_examples": true }, { "code": "hu", @@ -260,6 +275,10 @@ "example": "Адамга эң кыйыны — күн сайын адам болуу", "has_examples": true }, + { + "code": "la", + "name": "Latin" + }, { "code": "lb", "name": "Luxembourgish", @@ -448,6 +467,11 @@ "example": "นี่คือประโยค", "has_examples": true }, + { + "code": "ti", + "name": "Tigrinya", + "has_examples": true + }, { "code": "tl", "name": "Tagalog" From 0a9859ba01c8a51842218e1817dff7ff784951df Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Tue, 25 Oct 2022 19:38:23 +0200 Subject: [PATCH 057/161] Reduce python 3.10 in CI to one OS (#11703) --- azure-pipelines.yml | 12 ++++++------ 1 file changed, 6 insertions(+), 6 deletions(-) diff --git a/azure-pipelines.yml b/azure-pipelines.yml index 357cce835..eea07cb7a 100644 --- a/azure-pipelines.yml +++ b/azure-pipelines.yml @@ -76,15 +76,15 @@ jobs: # Python39Mac: # imageName: "macos-latest" # python.version: "3.9" - Python310Linux: - imageName: "ubuntu-latest" - python.version: "3.10" + # Python310Linux: + # imageName: "ubuntu-latest" + # python.version: "3.10" Python310Windows: imageName: "windows-latest" python.version: "3.10" - Python310Mac: - imageName: "macos-latest" - python.version: "3.10" + # Python310Mac: + # imageName: "macos-latest" + # python.version: "3.10" Python311Linux: imageName: 'ubuntu-latest' python.version: '3.11.0-rc.2' From a9139907a943f0cc91dac0338aa43caa38939778 Mon Sep 17 00:00:00 2001 From: Ryn Daniels <397565+ryndaniels@users.noreply.github.com> Date: Wed, 26 Oct 2022 09:15:13 +0300 Subject: [PATCH 058/161] update github actions to deal with deprecations (#11702) --- .github/workflows/autoblack.yml | 9 +++++---- 1 file changed, 5 insertions(+), 4 deletions(-) diff --git a/.github/workflows/autoblack.yml b/.github/workflows/autoblack.yml index 8d0282650..3ad4cf408 100644 --- a/.github/workflows/autoblack.yml +++ b/.github/workflows/autoblack.yml @@ -12,10 +12,10 @@ jobs: if: github.repository_owner == 'explosion' runs-on: ubuntu-latest steps: - - uses: actions/checkout@v2 + - uses: actions/checkout@v3 with: ref: ${{ github.head_ref }} - - uses: actions/setup-python@v2 + - uses: actions/setup-python@v3 - run: pip install black - name: Auto-format code if needed run: black spacy @@ -23,10 +23,11 @@ jobs: # code and makes GitHub think the action failed - name: Check for modified files id: git-check - run: echo ::set-output name=modified::$(if git diff-index --quiet HEAD --; then echo "false"; else echo "true"; fi) + run: echo modified=$(if git diff-index --quiet HEAD --; then echo "false"; else echo "true"; fi) >> $GITHUB_OUTPUT + - name: Create Pull Request if: steps.git-check.outputs.modified == 'true' - uses: peter-evans/create-pull-request@v3 + uses: peter-evans/create-pull-request@v4 with: title: Auto-format code with black labels: meta From 865691d169c3be413007f0d7324e03a7aac3b3cb Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Wed, 26 Oct 2022 08:43:00 +0200 Subject: [PATCH 059/161] Adjust default attrs for textcat configs (#11698) --- spacy/pipeline/textcat.py | 4 ++-- spacy/pipeline/textcat_multilabel.py | 4 ++-- 2 files changed, 4 insertions(+), 4 deletions(-) diff --git a/spacy/pipeline/textcat.py b/spacy/pipeline/textcat.py index c45f819fc..59549ad99 100644 --- a/spacy/pipeline/textcat.py +++ b/spacy/pipeline/textcat.py @@ -24,8 +24,8 @@ single_label_default_config = """ [model.tok2vec.embed] @architectures = "spacy.MultiHashEmbed.v2" width = 64 -rows = [2000, 2000, 1000, 1000, 1000, 1000] -attrs = ["ORTH", "LOWER", "PREFIX", "SUFFIX", "SHAPE", "ID"] +rows = [2000, 2000, 500, 1000, 500] +attrs = ["NORM", "LOWER", "PREFIX", "SUFFIX", "SHAPE"] include_static_vectors = false [model.tok2vec.encode] diff --git a/spacy/pipeline/textcat_multilabel.py b/spacy/pipeline/textcat_multilabel.py index 493c440c3..eb83d9cb7 100644 --- a/spacy/pipeline/textcat_multilabel.py +++ b/spacy/pipeline/textcat_multilabel.py @@ -24,8 +24,8 @@ multi_label_default_config = """ [model.tok2vec.embed] @architectures = "spacy.MultiHashEmbed.v2" width = 64 -rows = [2000, 2000, 1000, 1000, 1000, 1000] -attrs = ["ORTH", "LOWER", "PREFIX", "SUFFIX", "SHAPE", "ID"] +rows = [2000, 2000, 500, 1000, 500] +attrs = ["NORM", "LOWER", "PREFIX", "SUFFIX", "SHAPE"] include_static_vectors = false [model.tok2vec.encode] From 6b78135b9e158e5bc02e39c1a73ef28bb360a44f Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Thu, 27 Oct 2022 22:08:24 +0900 Subject: [PATCH 060/161] Add warning to install widget for M1 GPUs (#11666) * Add warning to install widget for M1 GPUs * Use Thinc tracking issue instead * Update website/src/widgets/quickstart-install.js Co-authored-by: Adriane Boyd * Underline URL in warning * Update website/src/widgets/quickstart-install.js Co-authored-by: Adriane Boyd * Don't install cupy on m1 gpus Co-authored-by: Adriane Boyd --- website/src/styles/quickstart.module.sass | 3 +++ website/src/widgets/quickstart-install.js | 11 ++++++++++- 2 files changed, 13 insertions(+), 1 deletion(-) diff --git a/website/src/styles/quickstart.module.sass b/website/src/styles/quickstart.module.sass index 8ad106a78..d0f9db551 100644 --- a/website/src/styles/quickstart.module.sass +++ b/website/src/styles/quickstart.module.sass @@ -149,6 +149,9 @@ & > span display: block + a + text-decoration: underline + .small font-size: var(--font-size-code) line-height: 1.65 diff --git a/website/src/widgets/quickstart-install.js b/website/src/widgets/quickstart-install.js index 0d2186acb..28dd14ecc 100644 --- a/website/src/widgets/quickstart-install.js +++ b/website/src/widgets/quickstart-install.js @@ -159,6 +159,9 @@ const QuickstartInstall = ({ id, title }) => { setters={setters} showDropdown={showDropdown} > + + # Note M1 GPU support is experimental, see Thinc issue #792 + python -m venv .env @@ -198,7 +201,13 @@ const QuickstartInstall = ({ id, title }) => { {nightly ? ' --pre' : ''} conda install -c conda-forge spacy - + + conda install -c conda-forge cupy + + + conda install -c conda-forge cupy + + conda install -c conda-forge cupy From d61e742960ef230b423dfa157449b291a03bd119 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Fri, 28 Oct 2022 17:25:34 +0900 Subject: [PATCH 061/161] Handle Docs with no entities in EntityLinker (#11640) * Handle docs with no entities If a whole batch contains no entities it won't make it to the model, but it's possible for individual Docs to have no entities. Before this commit, those Docs would cause an error when attempting to concatenate arrays because the dimensions didn't match. It turns out the process of preparing the Ragged at the end of the span maker forward was a little different from list2ragged, which just uses the flatten function directly. Letting list2ragged do the conversion avoids the dimension issue. This did not come up before because in NEL demo projects it's typical for data with no entities to be discarded before it reaches the NEL component. This includes a simple direct test that shows the issue and checks it's resolved. It doesn't check if there are any downstream changes, so a more complete test could be added. A full run was tested by adding an example with no entities to the Emerson sample project. * Add a blank instance to default training data in tests Rather than adding a specific test, since not failing on instances with no entities is basic functionality, it makes sense to add it to the default set. * Fix without modifying architecture If the architecture is modified this would have to be a new version, but this change isn't big enough to merit that. --- spacy/ml/models/entity_linker.py | 7 +++---- spacy/tests/pipeline/test_entity_linker.py | 22 +++++++++++++++++++++- 2 files changed, 24 insertions(+), 5 deletions(-) diff --git a/spacy/ml/models/entity_linker.py b/spacy/ml/models/entity_linker.py index 4d18d216a..299b6bb52 100644 --- a/spacy/ml/models/entity_linker.py +++ b/spacy/ml/models/entity_linker.py @@ -71,11 +71,10 @@ def span_maker_forward(model, docs: List[Doc], is_train) -> Tuple[Ragged, Callab cands.append((start_token, end_token)) candidates.append(ops.asarray2i(cands)) - candlens = ops.asarray1i([len(cands) for cands in candidates]) - candidates = ops.xp.concatenate(candidates) - outputs = Ragged(candidates, candlens) + lengths = model.ops.asarray1i([len(cands) for cands in candidates]) + out = Ragged(model.ops.flatten(candidates), lengths) # because this is just rearranging docs, the backprop does nothing - return outputs, lambda x: [] + return out, lambda x: [] @registry.misc("spacy.KBFromFile.v1") diff --git a/spacy/tests/pipeline/test_entity_linker.py b/spacy/tests/pipeline/test_entity_linker.py index 4d683acc5..99f164f15 100644 --- a/spacy/tests/pipeline/test_entity_linker.py +++ b/spacy/tests/pipeline/test_entity_linker.py @@ -9,6 +9,7 @@ from spacy.compat import pickle from spacy.kb import Candidate, InMemoryLookupKB, get_candidates, KnowledgeBase from spacy.lang.en import English from spacy.ml import load_kb +from spacy.ml.models.entity_linker import build_span_maker from spacy.pipeline import EntityLinker from spacy.pipeline.legacy import EntityLinker_v1 from spacy.pipeline.tok2vec import DEFAULT_TOK2VEC_MODEL @@ -715,7 +716,11 @@ TRAIN_DATA = [ ("Russ Cochran was a member of University of Kentucky's golf team.", {"links": {(0, 12): {"Q7381115": 0.0, "Q2146908": 1.0}}, "entities": [(0, 12, "PERSON"), (43, 51, "LOC")], - "sent_starts": [1, -1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0]}) + "sent_starts": [1, -1, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0, 0]}), + # having a blank instance shouldn't break things + ("The weather is nice today.", + {"links": {}, "entities": [], + "sent_starts": [1, -1, 0, 0, 0, 0]}) ] GOLD_entities = ["Q2146908", "Q7381115", "Q7381115", "Q2146908"] # fmt: on @@ -1196,3 +1201,18 @@ def test_threshold(meet_threshold: bool, config: Dict[str, Any]): assert len(doc.ents) == 1 assert doc.ents[0].kb_id_ == entity_id if meet_threshold else EntityLinker.NIL + + +def test_span_maker_forward_with_empty(): + """The forward pass of the span maker may have a doc with no entities.""" + nlp = English() + doc1 = nlp("a b c") + ent = doc1[0:1] + ent.label_ = "X" + doc1.ents = [ent] + # no entities + doc2 = nlp("x y z") + + # just to get a model + span_maker = build_span_maker() + span_maker([doc1, doc2], False) From d25f09468c4eca20eb464d78d35e439474ed2dbc Mon Sep 17 00:00:00 2001 From: Aaron Zipp <15341396+aaronzipp@users.noreply.github.com> Date: Mon, 31 Oct 2022 05:27:12 +0100 Subject: [PATCH 062/161] Spelling mistake in rule-based-matching.md (#11717) Changed retokenize to retokenizer --- website/docs/usage/rule-based-matching.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/website/docs/usage/rule-based-matching.md b/website/docs/usage/rule-based-matching.md index f096890cb..64bbf8e7b 100644 --- a/website/docs/usage/rule-based-matching.md +++ b/website/docs/usage/rule-based-matching.md @@ -1792,7 +1792,7 @@ the entity `Span` – for example `._.orgs` or `._.prev_orgs` and > [`Doc.retokenize`](/api/doc#retokenize) context manager: > > ```python -> with doc.retokenize() as retokenize: +> with doc.retokenize() as retokenizer: > for ent in doc.ents: > retokenizer.merge(ent) > ``` From f7edd84b44a37b78d87fe6815399a576f1980b8b Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Wed, 2 Nov 2022 13:42:20 +0100 Subject: [PATCH 063/161] Switch CI to Python 3.11.0 (#11737) --- azure-pipelines.yml | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/azure-pipelines.yml b/azure-pipelines.yml index eea07cb7a..bf3672b8b 100644 --- a/azure-pipelines.yml +++ b/azure-pipelines.yml @@ -87,13 +87,13 @@ jobs: # python.version: "3.10" Python311Linux: imageName: 'ubuntu-latest' - python.version: '3.11.0-rc.2' + python.version: '3.11.0' Python311Windows: imageName: 'windows-latest' - python.version: '3.11.0-rc.2' + python.version: '3.11.0' Python311Mac: imageName: 'macos-latest' - python.version: '3.11.0-rc.2' + python.version: '3.11.0' maxParallel: 4 pool: vmImage: $(imageName) From 420b1d854be86e899088bb136f1daf23fc61ed1d Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Wed, 2 Nov 2022 15:35:04 +0100 Subject: [PATCH 064/161] Update textcat scorer threshold behavior (#11696) * Update textcat scorer threshold behavior For `textcat` (with exclusive classes) the scorer should always use a threshold of 0.0 because there should be one predicted label per doc and the numeric score for that particular label should not matter. * Rename to test_textcat_multilabel_threshold * Remove all uses of threshold for multi_label=False * Update Scorer.score_cats API docs * Add tests for score_cats with thresholds * Update textcat API docs * Fix types * Convert threshold back to float * Fix threshold type in docstring * Improve formatting in Scorer API docs --- spacy/pipeline/textcat.py | 7 +++-- spacy/scorer.py | 12 +++---- spacy/tests/pipeline/test_textcat.py | 6 ++-- spacy/tests/test_scorer.py | 47 ++++++++++++++++++++++++++++ website/docs/api/scorer.md | 21 +++++++------ website/docs/api/textcategorizer.md | 5 ++- 6 files changed, 73 insertions(+), 25 deletions(-) diff --git a/spacy/pipeline/textcat.py b/spacy/pipeline/textcat.py index 59549ad99..238a768ed 100644 --- a/spacy/pipeline/textcat.py +++ b/spacy/pipeline/textcat.py @@ -72,7 +72,7 @@ subword_features = true "textcat", assigns=["doc.cats"], default_config={ - "threshold": 0.5, + "threshold": 0.0, "model": DEFAULT_SINGLE_TEXTCAT_MODEL, "scorer": {"@scorers": "spacy.textcat_scorer.v1"}, }, @@ -144,7 +144,8 @@ class TextCategorizer(TrainablePipe): model (thinc.api.Model): The Thinc Model powering the pipeline component. name (str): The component instance name, used to add entries to the losses during training. - threshold (float): Cutoff to consider a prediction "positive". + threshold (float): Unused, not needed for single-label (exclusive + classes) classification. scorer (Optional[Callable]): The scoring method. Defaults to Scorer.score_cats for the attribute "cats". @@ -154,7 +155,7 @@ class TextCategorizer(TrainablePipe): self.model = model self.name = name self._rehearsal_model = None - cfg = {"labels": [], "threshold": threshold, "positive_label": None} + cfg: Dict[str, Any] = {"labels": [], "threshold": threshold, "positive_label": None} self.cfg = dict(cfg) self.scorer = scorer diff --git a/spacy/scorer.py b/spacy/scorer.py index 8cd755ac4..16fc303a0 100644 --- a/spacy/scorer.py +++ b/spacy/scorer.py @@ -446,7 +446,7 @@ class Scorer: labels (Iterable[str]): The set of possible labels. Defaults to []. multi_label (bool): Whether the attribute allows multiple labels. Defaults to True. When set to False (exclusive labels), missing - gold labels are interpreted as 0.0. + gold labels are interpreted as 0.0 and the threshold is set to 0.0. positive_label (str): The positive label for a binary task with exclusive classes. Defaults to None. threshold (float): Cutoff to consider a prediction "positive". Defaults @@ -471,6 +471,8 @@ class Scorer: """ if threshold is None: threshold = 0.5 if multi_label else 0.0 + if not multi_label: + threshold = 0.0 f_per_type = {label: PRFScore() for label in labels} auc_per_type = {label: ROCAUCScore() for label in labels} labels = set(labels) @@ -505,20 +507,18 @@ class Scorer: # Get the highest-scoring for each. pred_label, pred_score = max(pred_cats.items(), key=lambda it: it[1]) gold_label, gold_score = max(gold_cats.items(), key=lambda it: it[1]) - if pred_label == gold_label and pred_score >= threshold: + if pred_label == gold_label: f_per_type[pred_label].tp += 1 else: f_per_type[gold_label].fn += 1 - if pred_score >= threshold: - f_per_type[pred_label].fp += 1 + f_per_type[pred_label].fp += 1 elif gold_cats: gold_label, gold_score = max(gold_cats, key=lambda it: it[1]) if gold_score > 0: f_per_type[gold_label].fn += 1 elif pred_cats: pred_label, pred_score = max(pred_cats.items(), key=lambda it: it[1]) - if pred_score >= threshold: - f_per_type[pred_label].fp += 1 + f_per_type[pred_label].fp += 1 micro_prf = PRFScore() for label_prf in f_per_type.values(): micro_prf.tp += label_prf.tp diff --git a/spacy/tests/pipeline/test_textcat.py b/spacy/tests/pipeline/test_textcat.py index 0bb036a33..d359b77db 100644 --- a/spacy/tests/pipeline/test_textcat.py +++ b/spacy/tests/pipeline/test_textcat.py @@ -823,10 +823,10 @@ def test_textcat_loss(multi_label: bool, expected_loss: float): assert loss == expected_loss -def test_textcat_threshold(): +def test_textcat_multilabel_threshold(): # Ensure the scorer can be called with a different threshold nlp = English() - nlp.add_pipe("textcat") + nlp.add_pipe("textcat_multilabel") train_examples = [] for text, annotations in TRAIN_DATA_SINGLE_LABEL: @@ -849,7 +849,7 @@ def test_textcat_threshold(): ) pos_f = scores["cats_score"] assert scores["cats_f_per_type"]["POSITIVE"]["r"] == 1.0 - assert pos_f > macro_f + assert pos_f >= macro_f def test_textcat_multi_threshold(): diff --git a/spacy/tests/test_scorer.py b/spacy/tests/test_scorer.py index 6e15fa2de..b903f1669 100644 --- a/spacy/tests/test_scorer.py +++ b/spacy/tests/test_scorer.py @@ -474,3 +474,50 @@ def test_prf_score(): assert (a.precision, a.recall, a.fscore) == approx( (c.precision, c.recall, c.fscore) ) + + +def test_score_cats(en_tokenizer): + text = "some text" + gold_doc = en_tokenizer(text) + gold_doc.cats = {"POSITIVE": 1.0, "NEGATIVE": 0.0} + pred_doc = en_tokenizer(text) + pred_doc.cats = {"POSITIVE": 0.75, "NEGATIVE": 0.25} + example = Example(pred_doc, gold_doc) + # threshold is ignored for multi_label=False + scores1 = Scorer.score_cats( + [example], + "cats", + labels=list(gold_doc.cats.keys()), + multi_label=False, + positive_label="POSITIVE", + threshold=0.1, + ) + scores2 = Scorer.score_cats( + [example], + "cats", + labels=list(gold_doc.cats.keys()), + multi_label=False, + positive_label="POSITIVE", + threshold=0.9, + ) + assert scores1["cats_score"] == 1.0 + assert scores2["cats_score"] == 1.0 + assert scores1 == scores2 + # threshold is relevant for multi_label=True + scores = Scorer.score_cats( + [example], + "cats", + labels=list(gold_doc.cats.keys()), + multi_label=True, + threshold=0.9, + ) + assert scores["cats_macro_f"] == 0.0 + # threshold is relevant for multi_label=True + scores = Scorer.score_cats( + [example], + "cats", + labels=list(gold_doc.cats.keys()), + multi_label=True, + threshold=0.1, + ) + assert scores["cats_macro_f"] == 0.5 diff --git a/website/docs/api/scorer.md b/website/docs/api/scorer.md index ca3462aa9..9ef36e6fc 100644 --- a/website/docs/api/scorer.md +++ b/website/docs/api/scorer.md @@ -229,16 +229,17 @@ The reported `{attr}_score` depends on the classification properties: > print(scores["cats_macro_auc"]) > ``` -| Name | Description | -| ---------------- | -------------------------------------------------------------------------------------------------------------------------------------------------- | -| `examples` | The `Example` objects holding both the predictions and the correct gold-standard annotations. ~~Iterable[Example]~~ | -| `attr` | The attribute to score. ~~str~~ | -| _keyword-only_ | | -| `getter` | Defaults to `getattr`. If provided, `getter(doc, attr)` should return the cats for an individual `Doc`. ~~Callable[[Doc, str], Dict[str, float]]~~ | -| labels | The set of possible labels. Defaults to `[]`. ~~Iterable[str]~~ | -| `multi_label` | Whether the attribute allows multiple labels. Defaults to `True`. ~~bool~~ | -| `positive_label` | The positive label for a binary task with exclusive classes. Defaults to `None`. ~~Optional[str]~~ | -| **RETURNS** | A dictionary containing the scores, with inapplicable scores as `None`. ~~Dict[str, Optional[float]]~~ | +| Name | Description | +| ---------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `examples` | The `Example` objects holding both the predictions and the correct gold-standard annotations. ~~Iterable[Example]~~ | +| `attr` | The attribute to score. ~~str~~ | +| _keyword-only_ | | +| `getter` | Defaults to `getattr`. If provided, `getter(doc, attr)` should return the cats for an individual `Doc`. ~~Callable[[Doc, str], Dict[str, float]]~~ | +| labels | The set of possible labels. Defaults to `[]`. ~~Iterable[str]~~ | +| `multi_label` | Whether the attribute allows multiple labels. Defaults to `True`. When set to `False` (exclusive labels), missing gold labels are interpreted as `0.0` and the threshold is set to `0.0`. ~~bool~~ | +| `positive_label` | The positive label for a binary task with exclusive classes. Defaults to `None`. ~~Optional[str]~~ | +| `threshold` | Cutoff to consider a prediction "positive". Defaults to `0.5` for multi-label, and `0.0` (i.e. whatever's highest scoring) otherwise. ~~float~~ | +| **RETURNS** | A dictionary containing the scores, with inapplicable scores as `None`. ~~Dict[str, Optional[float]]~~ | ## Scorer.score_links {#score_links tag="staticmethod" new="3"} diff --git a/website/docs/api/textcategorizer.md b/website/docs/api/textcategorizer.md index 042b4ab76..f5f8706ec 100644 --- a/website/docs/api/textcategorizer.md +++ b/website/docs/api/textcategorizer.md @@ -63,7 +63,6 @@ architectures and their arguments and hyperparameters. > ```python > from spacy.pipeline.textcat import DEFAULT_SINGLE_TEXTCAT_MODEL > config = { -> "threshold": 0.5, > "model": DEFAULT_SINGLE_TEXTCAT_MODEL, > } > nlp.add_pipe("textcat", config=config) @@ -82,7 +81,7 @@ architectures and their arguments and hyperparameters. | Setting | Description | | ----------- | ---------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `threshold` | Cutoff to consider a prediction "positive", relevant when printing accuracy results. ~~float~~ | +| `threshold` | Cutoff to consider a prediction "positive", relevant for `textcat_multilabel` when calculating accuracy scores. ~~float~~ | | `model` | A model instance that predicts scores for each category. Defaults to [TextCatEnsemble](/api/architectures#TextCatEnsemble). ~~Model[List[Doc], List[Floats2d]]~~ | | `scorer` | The scoring method. Defaults to [`Scorer.score_cats`](/api/scorer#score_cats) for the attribute `"cats"`. ~~Optional[Callable]~~ | @@ -123,7 +122,7 @@ shortcut for this and instantiate the component using its string name and | `model` | The Thinc [`Model`](https://thinc.ai/docs/api-model) powering the pipeline component. ~~Model[List[Doc], List[Floats2d]]~~ | | `name` | String name of the component instance. Used to add entries to the `losses` during training. ~~str~~ | | _keyword-only_ | | -| `threshold` | Cutoff to consider a prediction "positive", relevant when printing accuracy results. ~~float~~ | +| `threshold` | Cutoff to consider a prediction "positive", relevant for `textcat_multilabel` when calculating accuracy scores. ~~float~~ | | `scorer` | The scoring method. Defaults to [`Scorer.score_cats`](/api/scorer#score_cats) for the attribute `"cats"`. ~~Optional[Callable]~~ | ## TextCategorizer.\_\_call\_\_ {#call tag="method"} From 2fb7e4dc74bd491ecec43971b2b29b0d28efd492 Mon Sep 17 00:00:00 2001 From: Ryn Daniels <397565+ryndaniels@users.noreply.github.com> Date: Wed, 2 Nov 2022 16:36:30 +0200 Subject: [PATCH 065/161] More version updates for github action deprecation warnings (#11705) * More version updates for github action deprecation warnings * fix the deprecated set-output commands * bump explosion-bot to run on ubuntu-latest --- .github/workflows/autoblack.yml | 2 +- .github/workflows/explosionbot.yml | 6 +++--- .github/workflows/slowtests.yml | 6 +++--- .github/workflows/spacy_universe_alert.yml | 4 ++-- 4 files changed, 9 insertions(+), 9 deletions(-) diff --git a/.github/workflows/autoblack.yml b/.github/workflows/autoblack.yml index 3ad4cf408..70882c3cc 100644 --- a/.github/workflows/autoblack.yml +++ b/.github/workflows/autoblack.yml @@ -15,7 +15,7 @@ jobs: - uses: actions/checkout@v3 with: ref: ${{ github.head_ref }} - - uses: actions/setup-python@v3 + - uses: actions/setup-python@v4 - run: pip install black - name: Auto-format code if needed run: black spacy diff --git a/.github/workflows/explosionbot.yml b/.github/workflows/explosionbot.yml index d585ecd9c..6b472cd12 100644 --- a/.github/workflows/explosionbot.yml +++ b/.github/workflows/explosionbot.yml @@ -8,14 +8,14 @@ on: jobs: explosion-bot: - runs-on: ubuntu-18.04 + runs-on: ubuntu-latest steps: - name: Dump GitHub context env: GITHUB_CONTEXT: ${{ toJson(github) }} run: echo "$GITHUB_CONTEXT" - - uses: actions/checkout@v1 - - uses: actions/setup-python@v1 + - uses: actions/checkout@v3 + - uses: actions/setup-python@v4 - name: Install and run explosion-bot run: | pip install git+https://${{ secrets.EXPLOSIONBOT_TOKEN }}@github.com/explosion/explosion-bot diff --git a/.github/workflows/slowtests.yml b/.github/workflows/slowtests.yml index 38ceb18c6..f9fd3e817 100644 --- a/.github/workflows/slowtests.yml +++ b/.github/workflows/slowtests.yml @@ -14,7 +14,7 @@ jobs: runs-on: ubuntu-latest steps: - name: Checkout - uses: actions/checkout@v1 + uses: actions/checkout@v3 with: ref: ${{ matrix.branch }} - name: Get commits from past 24 hours @@ -23,9 +23,9 @@ jobs: today=$(date '+%Y-%m-%d %H:%M:%S') yesterday=$(date -d "yesterday" '+%Y-%m-%d %H:%M:%S') if git log --after="$yesterday" --before="$today" | grep commit ; then - echo "::set-output name=run_tests::true" + echo run_tests=true >> $GITHUB_OUTPUT else - echo "::set-output name=run_tests::false" + echo run_tests=false >> $GITHUB_OUTPUT fi - name: Trigger buildkite build diff --git a/.github/workflows/spacy_universe_alert.yml b/.github/workflows/spacy_universe_alert.yml index cbbf14c6e..f507e0594 100644 --- a/.github/workflows/spacy_universe_alert.yml +++ b/.github/workflows/spacy_universe_alert.yml @@ -17,8 +17,8 @@ jobs: run: | echo "$GITHUB_CONTEXT" - - uses: actions/checkout@v1 - - uses: actions/setup-python@v1 + - uses: actions/checkout@v3 + - uses: actions/setup-python@v4 - name: Install Bernadette app dependency and send an alert env: SLACK_BOT_TOKEN: ${{ secrets.SLACK_BOT_TOKEN }} From 1211552f0ec84aef0b55f834d76899ab07e2c5cc Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Thu, 3 Nov 2022 09:29:46 +0100 Subject: [PATCH 066/161] Modernize and simplify CI steps (#11738) * Use `build` instead of `python setup.py sdist` * Remove in-place build with `setup.py` * Remove `gpu` parameter and GPU tests * Keep `architecture` and `num_build_jobs` in azure steps with CI defaults * Fix use of `num_build_jobs` parameters * Remove now-unused `prefix` parameter * Test imports and CLI before installing test requirements * Remove `*.egg-info` directory in addition to source directory for an warning-free `import spacy` * Switch `thinc-apple-ops` test to python 3.11 (as most recent python that is tested across platforms) --- .github/azure-steps.yml | 70 +++++++++++++++++++---------------------- azure-pipelines.yml | 17 ---------- 2 files changed, 33 insertions(+), 54 deletions(-) diff --git a/.github/azure-steps.yml b/.github/azure-steps.yml index cc0247b3a..b2bc80dd6 100644 --- a/.github/azure-steps.yml +++ b/.github/azure-steps.yml @@ -1,9 +1,7 @@ parameters: python_version: '' - architecture: '' - prefix: '' - gpu: false - num_build_jobs: 1 + architecture: 'x64' + num_build_jobs: 2 steps: - task: UsePythonVersion@0 @@ -17,16 +15,16 @@ steps: displayName: 'Set variables' - script: | - ${{ parameters.prefix }} python -m pip install -U pip setuptools - ${{ parameters.prefix }} python -m pip install -U -r requirements.txt + python -m pip install -U build pip setuptools + python -m pip install -U -r requirements.txt displayName: "Install dependencies" - script: | - ${{ parameters.prefix }} python setup.py build_ext --inplace -j ${{ parameters.num_build_jobs }} - ${{ parameters.prefix }} python setup.py sdist --formats=gztar - displayName: "Compile and build sdist" + python -m build --sdist + displayName: "Build sdist" - - script: python -m mypy spacy + - script: | + python -m mypy spacy displayName: 'Run mypy' condition: ne(variables['python_version'], '3.6') @@ -35,35 +33,24 @@ steps: contents: "spacy" displayName: "Delete source directory" + - task: DeleteFiles@1 + inputs: + contents: "*.egg-info" + displayName: "Delete egg-info directory" + - script: | - ${{ parameters.prefix }} python -m pip freeze --exclude torch --exclude cupy-cuda110 > installed.txt - ${{ parameters.prefix }} python -m pip uninstall -y -r installed.txt + python -m pip freeze > installed.txt + python -m pip uninstall -y -r installed.txt displayName: "Uninstall all packages" - bash: | - ${{ parameters.prefix }} SDIST=$(python -c "import os;print(os.listdir('./dist')[-1])" 2>&1) - ${{ parameters.prefix }} SPACY_NUM_BUILD_JOBS=2 python -m pip install dist/$SDIST + SDIST=$(python -c "import os;print(os.listdir('./dist')[-1])" 2>&1) + SPACY_NUM_BUILD_JOBS=${{ parameters.num_build_jobs }} python -m pip install dist/$SDIST displayName: "Install from sdist" - script: | - ${{ parameters.prefix }} python -m pip install -U -r requirements.txt - displayName: "Install test requirements" - - - script: | - ${{ parameters.prefix }} python -m pip install -U cupy-cuda110 -f https://github.com/cupy/cupy/releases/v9.0.0 - ${{ parameters.prefix }} python -m pip install "torch==1.7.1+cu110" -f https://download.pytorch.org/whl/torch_stable.html - displayName: "Install GPU requirements" - condition: eq(${{ parameters.gpu }}, true) - - - script: | - ${{ parameters.prefix }} python -m pytest --pyargs spacy -W error - displayName: "Run CPU tests" - condition: eq(${{ parameters.gpu }}, false) - - - script: | - ${{ parameters.prefix }} python -m pytest --pyargs spacy -W error -p spacy.tests.enable_gpu - displayName: "Run GPU tests" - condition: eq(${{ parameters.gpu }}, true) + python -W error -c "import spacy" + displayName: "Test import" - script: | python -m spacy download ca_core_news_sm @@ -106,13 +93,22 @@ steps: displayName: 'Test assemble CLI vectors warning' condition: eq(variables['python_version'], '3.8') + - script: | + python -m pip install -U -r requirements.txt + displayName: "Install test requirements" + + - script: | + python -m pytest --pyargs spacy -W error + displayName: "Run CPU tests" + + - script: | + python -m pip install --pre thinc-apple-ops + python -m pytest --pyargs spacy + displayName: "Run CPU tests with thinc-apple-ops" + condition: and(startsWith(variables['imageName'], 'macos'), eq(variables['python.version'], '3.11')) + - script: | python .github/validate_universe_json.py website/meta/universe.json displayName: 'Test website/meta/universe.json' condition: eq(variables['python_version'], '3.8') - - script: | - ${{ parameters.prefix }} python -m pip install --pre thinc-apple-ops - ${{ parameters.prefix }} python -m pytest --pyargs spacy - displayName: "Run CPU tests with thinc-apple-ops" - condition: and(startsWith(variables['imageName'], 'macos'), eq(variables['python.version'], '3.10')) diff --git a/azure-pipelines.yml b/azure-pipelines.yml index bf3672b8b..3499042cb 100644 --- a/azure-pipelines.yml +++ b/azure-pipelines.yml @@ -101,20 +101,3 @@ jobs: - template: .github/azure-steps.yml parameters: python_version: '$(python.version)' - architecture: 'x64' - -# - job: "TestGPU" -# dependsOn: "Validate" -# strategy: -# matrix: -# Python38LinuxX64_GPU: -# python.version: '3.8' -# pool: -# name: "LinuxX64_GPU" -# steps: -# - template: .github/azure-steps.yml -# parameters: -# python_version: '$(python.version)' -# architecture: 'x64' -# gpu: true -# num_build_jobs: 24 From db56600536e2d615a766fc2fc973a6cc9e0f1a52 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Thu, 3 Nov 2022 18:52:59 +0900 Subject: [PATCH 067/161] Fix default parameters for load functions (fix #11706) (#11713) * Fix default parameters for load functions Some load functions used SimpleFrozenList() directly instead of the _DEFAULT_EMPTY_PIPES parameter. That mostly worked as intended, but the changes in #11459 check for equality using identity, not value, so a warning is incorrectly raised sometimes, as in #11706. This change just has all the load functions use the singleton value instead. * Add test that there are no warnings on module-based load This will succeed due to changes in this branch, but local tests with the latest release failed as intended. * Try reverting commit and see if CI changes There is an error in CI that is probably unrelated. Revert "Fix default parameters for load functions" This reverts commit dc46b35687e92e4793e64edb11997d44b88c6a8b. * Revert "Try reverting commit and see if CI changes" This reverts commit 2514ed07ef29851b5ac60015442a7ce44c69decc. Co-authored-by: Adriane Boyd --- .github/azure-steps.yml | 5 +++++ spacy/util.py | 12 ++++++------ 2 files changed, 11 insertions(+), 6 deletions(-) diff --git a/.github/azure-steps.yml b/.github/azure-steps.yml index b2bc80dd6..e8bd0d212 100644 --- a/.github/azure-steps.yml +++ b/.github/azure-steps.yml @@ -59,6 +59,11 @@ steps: displayName: 'Test download CLI' condition: eq(variables['python_version'], '3.8') + - script: | + python -W error -c "import ca_core_news_sm; nlp = ca_core_news_sm.load(); doc=nlp('test')" + displayName: 'Test no warnings on load (#11713)' + condition: eq(variables['python_version'], '3.8') + - script: | python -m spacy convert extra/example_data/ner_example_data/ner-token-per-line-conll2003.json . displayName: 'Test convert CLI' diff --git a/spacy/util.py b/spacy/util.py index 3034808ba..76a1e0bfa 100644 --- a/spacy/util.py +++ b/spacy/util.py @@ -443,9 +443,9 @@ def load_model_from_package( name: str, *, vocab: Union["Vocab", bool] = True, - disable: Union[str, Iterable[str]] = SimpleFrozenList(), - enable: Union[str, Iterable[str]] = SimpleFrozenList(), - exclude: Union[str, Iterable[str]] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, config: Union[Dict[str, Any], Config] = SimpleFrozenDict(), ) -> "Language": """Load a model from an installed package. @@ -619,9 +619,9 @@ def load_model_from_init_py( init_file: Union[Path, str], *, vocab: Union["Vocab", bool] = True, - disable: Union[str, Iterable[str]] = SimpleFrozenList(), - enable: Union[str, Iterable[str]] = SimpleFrozenList(), - exclude: Union[str, Iterable[str]] = SimpleFrozenList(), + disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, + exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES, config: Union[Dict[str, Any], Config] = SimpleFrozenDict(), ) -> "Language": """Helper function to use in the `load()` method of a model package's From 40e1000db08858e8c928efacab8f710e027dde61 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Thu, 3 Nov 2022 11:49:08 +0100 Subject: [PATCH 068/161] Restore Doc attr getter values in Doc.to_json (#11700) --- spacy/tests/doc/test_json_doc_conversion.py | 9 +++++++ spacy/tokens/doc.pyx | 27 ++++++++++++++------- 2 files changed, 27 insertions(+), 9 deletions(-) diff --git a/spacy/tests/doc/test_json_doc_conversion.py b/spacy/tests/doc/test_json_doc_conversion.py index 19698cfb2..11a1817e6 100644 --- a/spacy/tests/doc/test_json_doc_conversion.py +++ b/spacy/tests/doc/test_json_doc_conversion.py @@ -370,3 +370,12 @@ def test_json_to_doc_validation_error(doc): doc_json.pop("tokens") with pytest.raises(ValueError): Doc(doc.vocab).from_json(doc_json, validate=True) + + +def test_to_json_underscore_doc_getters(doc): + def get_text_length(doc): + return len(doc.text) + + Doc.set_extension("text_length", getter=get_text_length) + doc_json = doc.to_json(underscore=["text_length"]) + assert doc_json["_"]["text_length"] == get_text_length(doc) diff --git a/spacy/tokens/doc.pyx b/spacy/tokens/doc.pyx index 295f91c28..f2621292c 100644 --- a/spacy/tokens/doc.pyx +++ b/spacy/tokens/doc.pyx @@ -1668,6 +1668,20 @@ cdef class Doc: if underscore: user_keys = set() + # Handle doc attributes with .get to include values from getters + # and not only values stored in user_data, for backwards + # compatibility + for attr in underscore: + if self.has_extension(attr): + if "_" not in data: + data["_"] = {} + value = self._.get(attr) + if not srsly.is_json_serializable(value): + raise ValueError(Errors.E107.format(attr=attr, value=repr(value))) + data["_"][attr] = value + user_keys.add(attr) + # Token and span attributes only include values stored in user_data + # and not values generated by getters if self.user_data: for data_key, value in self.user_data.copy().items(): if type(data_key) == tuple and len(data_key) >= 4 and data_key[0] == "._.": @@ -1678,20 +1692,15 @@ cdef class Doc: user_keys.add(attr) if not srsly.is_json_serializable(value): raise ValueError(Errors.E107.format(attr=attr, value=repr(value))) - # Check if doc attribute - if start is None: - if "_" not in data: - data["_"] = {} - data["_"][attr] = value - # Check if token attribute - elif end is None: + # Token attribute + if start is not None and end is None: if "underscore_token" not in data: data["underscore_token"] = {} if attr not in data["underscore_token"]: data["underscore_token"][attr] = [] data["underscore_token"][attr].append({"start": start, "value": value}) - # Else span attribute - else: + # Span attribute + elif start is not None and end is not None: if "underscore_span" not in data: data["underscore_span"] = {} if attr not in data["underscore_span"]: From bbf64cfc4391cccba447346badaacca4d42e583d Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 4 Nov 2022 11:17:43 +0100 Subject: [PATCH 069/161] Auto-format code with black (#11749) Co-authored-by: explosion-bot --- spacy/pipeline/textcat.py | 6 +++++- 1 file changed, 5 insertions(+), 1 deletion(-) diff --git a/spacy/pipeline/textcat.py b/spacy/pipeline/textcat.py index 238a768ed..4023c4456 100644 --- a/spacy/pipeline/textcat.py +++ b/spacy/pipeline/textcat.py @@ -155,7 +155,11 @@ class TextCategorizer(TrainablePipe): self.model = model self.name = name self._rehearsal_model = None - cfg: Dict[str, Any] = {"labels": [], "threshold": threshold, "positive_label": None} + cfg: Dict[str, Any] = { + "labels": [], + "threshold": threshold, + "positive_label": None, + } self.cfg = dict(cfg) self.scorer = scorer From ea326cf47d5324cff14bef983b0da122b9f0d1ed Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Mon, 7 Nov 2022 08:11:13 +0100 Subject: [PATCH 070/161] Fix types for Span.id and Span.id_ (#11744) --- spacy/tokens/span.pyi | 6 ++---- 1 file changed, 2 insertions(+), 4 deletions(-) diff --git a/spacy/tokens/span.pyi b/spacy/tokens/span.pyi index 617e3d19d..0a6f306a6 100644 --- a/spacy/tokens/span.pyi +++ b/spacy/tokens/span.pyi @@ -117,15 +117,13 @@ class Span: end_char: int label: int kb_id: int + id: int ent_id: int ent_id_: str @property - def id(self) -> int: ... - @property - def id_(self) -> str: ... - @property def orth_(self) -> str: ... @property def lemma_(self) -> str: ... label_: str kb_id_: str + id_: str From b76222e56adb49e33d7d0471674dfe2f207b2020 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Mon, 7 Nov 2022 16:11:55 +0900 Subject: [PATCH 071/161] Raise Typer limit (#11720) * Raise typer limit to <0.7.0 * Raise limit to <0.8.0 --- requirements.txt | 2 +- setup.cfg | 2 +- 2 files changed, 2 insertions(+), 2 deletions(-) diff --git a/requirements.txt b/requirements.txt index 9d6bbb2c4..d91a3b3d4 100644 --- a/requirements.txt +++ b/requirements.txt @@ -9,7 +9,7 @@ murmurhash>=0.28.0,<1.1.0 wasabi>=0.9.1,<1.1.0 srsly>=2.4.3,<3.0.0 catalogue>=2.0.6,<2.1.0 -typer>=0.3.0,<0.5.0 +typer>=0.3.0,<0.8.0 pathy>=0.3.5 # Third party dependencies numpy>=1.15.0 diff --git a/setup.cfg b/setup.cfg index c2653feba..82d4d2758 100644 --- a/setup.cfg +++ b/setup.cfg @@ -51,7 +51,7 @@ install_requires = srsly>=2.4.3,<3.0.0 catalogue>=2.0.6,<2.1.0 # Third-party dependencies - typer>=0.3.0,<0.5.0 + typer>=0.3.0,<0.8.0 pathy>=0.3.5 tqdm>=4.38.0,<5.0.0 numpy>=1.15.0 From e91b47a22655c0384202f797e9d50d3660596d32 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Mon, 7 Nov 2022 10:43:34 +0100 Subject: [PATCH 072/161] Check for unsafe paths in tarfile.extractall (CVE-2007-4559) (#11746) * Adding tarfile member sanitization to extractall() * Format * Simplify and add error message * Fix import * Add comment about CVE Co-authored-by: TrellixVulnTeam --- spacy/cli/project/remote_storage.py | 19 ++++++++++++++++++- spacy/errors.py | 2 ++ 2 files changed, 20 insertions(+), 1 deletion(-) diff --git a/spacy/cli/project/remote_storage.py b/spacy/cli/project/remote_storage.py index 336a4bcb3..12e252b3c 100644 --- a/spacy/cli/project/remote_storage.py +++ b/spacy/cli/project/remote_storage.py @@ -10,6 +10,7 @@ from .._util import get_hash, get_checksum, download_file, ensure_pathy from ...util import make_tempdir, get_minor_version, ENV_VARS, check_bool_env_var from ...git_info import GIT_VERSION from ... import about +from ...errors import Errors if TYPE_CHECKING: from pathy import Pathy # noqa: F401 @@ -84,7 +85,23 @@ class RemoteStorage: with tarfile.open(tar_loc, mode=mode_string) as tar_file: # This requires that the path is added correctly, relative # to root. This is how we set things up in push() - tar_file.extractall(self.root) + + # Disallow paths outside the current directory for the tar + # file (CVE-2007-4559, directory traversal vulnerability) + def is_within_directory(directory, target): + abs_directory = os.path.abspath(directory) + abs_target = os.path.abspath(target) + prefix = os.path.commonprefix([abs_directory, abs_target]) + return prefix == abs_directory + + def safe_extract(tar, path): + for member in tar.getmembers(): + member_path = os.path.join(path, member.name) + if not is_within_directory(path, member_path): + raise ValueError(Errors.E852) + tar.extractall(path) + + safe_extract(tar_file, self.root) return url def find( diff --git a/spacy/errors.py b/spacy/errors.py index e0628819d..2f8a3996f 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -544,6 +544,8 @@ class Errors(metaclass=ErrorsWithCodes): "during training, make sure to include it in 'annotating components'") # New errors added in v3.x + E852 = ("The tar file pulled from the remote attempted an unsafe path " + "traversal.") E853 = ("Unsupported component factory name '{name}'. The character '.' is " "not permitted in factory names.") E854 = ("Unable to set doc.ents. Check that the 'ents_filter' does not " From 6105f20d8a10a18a0e5985d310664812198840a8 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Mon, 7 Nov 2022 13:25:40 +0100 Subject: [PATCH 073/161] Switch CI to python 3.11 (#11765) --- azure-pipelines.yml | 6 +++--- 1 file changed, 3 insertions(+), 3 deletions(-) diff --git a/azure-pipelines.yml b/azure-pipelines.yml index 3499042cb..9c3b92f06 100644 --- a/azure-pipelines.yml +++ b/azure-pipelines.yml @@ -87,13 +87,13 @@ jobs: # python.version: "3.10" Python311Linux: imageName: 'ubuntu-latest' - python.version: '3.11.0' + python.version: '3.11' Python311Windows: imageName: 'windows-latest' - python.version: '3.11.0' + python.version: '3.11' Python311Mac: imageName: 'macos-latest' - python.version: '3.11.0' + python.version: '3.11' maxParallel: 4 pool: vmImage: $(imageName) From e116395f890a70447c75109026e7b37f20c142c2 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Mon, 7 Nov 2022 14:46:08 +0100 Subject: [PATCH 074/161] Add fallback in requirements check, only check once (#11735) * Add fallback in requirements check, only check once * Rename to skip_requirements_check * Update spacy/cli/project/run.py Co-authored-by: Paul O'Leary McCann Co-authored-by: Paul O'Leary McCann --- spacy/cli/project/run.py | 15 ++++++++++++--- 1 file changed, 12 insertions(+), 3 deletions(-) diff --git a/spacy/cli/project/run.py b/spacy/cli/project/run.py index ebab7471e..638e7fab1 100644 --- a/spacy/cli/project/run.py +++ b/spacy/cli/project/run.py @@ -53,6 +53,7 @@ def project_run( force: bool = False, dry: bool = False, capture: bool = False, + skip_requirements_check: bool = False, ) -> None: """Run a named script defined in the project.yml. If the script is part of the default pipeline (defined in the "run" section), DVC is used to @@ -69,6 +70,7 @@ def project_run( sys.exit will be called with the return code. You should use capture=False when you want to turn over execution to the command, and capture=True when you want to run the command more like a function. + skip_requirements_check (bool): Whether to skip the requirements check. """ config = load_project_config(project_dir, overrides=overrides) commands = {cmd["name"]: cmd for cmd in config.get("commands", [])} @@ -76,9 +78,10 @@ def project_run( validate_subcommand(list(commands.keys()), list(workflows.keys()), subcommand) req_path = project_dir / "requirements.txt" - if config.get("check_requirements", True) and os.path.exists(req_path): - with req_path.open() as requirements_file: - _check_requirements([req.replace("\n", "") for req in requirements_file]) + if not skip_requirements_check: + if config.get("check_requirements", True) and os.path.exists(req_path): + with req_path.open() as requirements_file: + _check_requirements([req.strip() for req in requirements_file]) if subcommand in workflows: msg.info(f"Running workflow '{subcommand}'") @@ -90,6 +93,7 @@ def project_run( force=force, dry=dry, capture=capture, + skip_requirements_check=True, ) else: cmd = commands[subcommand] @@ -338,6 +342,11 @@ def _check_requirements(requirements: List[str]) -> Tuple[bool, bool]: failed_pkgs_msgs.append(dnf.report()) except pkg_resources.VersionConflict as vc: conflicting_pkgs_msgs.append(vc.report()) + except Exception: + msg.warn(f"Unable to check requirement: {req} " + "Check that the requirement is formatted according to PEP " + "440, in particular that URLs are formatted as " + "'package_name @ URL'") if len(failed_pkgs_msgs) or len(conflicting_pkgs_msgs): msg.warn( From 2e3cfd758ea414497802843970666a18ed4d123e Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Tue, 8 Nov 2022 04:46:19 +0100 Subject: [PATCH 075/161] Use python 3.10 for GHA universe alert (#11768) --- .github/workflows/spacy_universe_alert.yml | 2 ++ 1 file changed, 2 insertions(+) diff --git a/.github/workflows/spacy_universe_alert.yml b/.github/workflows/spacy_universe_alert.yml index f507e0594..837aaeb33 100644 --- a/.github/workflows/spacy_universe_alert.yml +++ b/.github/workflows/spacy_universe_alert.yml @@ -19,6 +19,8 @@ jobs: - uses: actions/checkout@v3 - uses: actions/setup-python@v4 + with: + python-version: '3.10' - name: Install Bernadette app dependency and send an alert env: SLACK_BOT_TOKEN: ${{ secrets.SLACK_BOT_TOKEN }} From 20bbbe3e44f14d42a4861d1399ad98d6e1707d84 Mon Sep 17 00:00:00 2001 From: Raphael Mitsch Date: Tue, 8 Nov 2022 14:58:10 +0100 Subject: [PATCH 076/161] Revert disable/disabled merging behavior (#11745) * Merge disable with disabled. Adjust warnings, errors and tests. * Replace any() with set operation. * Update spacy/tests/pipeline/test_pipe_methods.py Co-authored-by: Adriane Boyd * Update docs. * Remve reference to config entry nlp.enabled from docs. Co-authored-by: Adriane Boyd --- spacy/errors.py | 4 +- spacy/language.py | 45 ++++++++----------- spacy/tests/pipeline/test_pipe_methods.py | 18 ++++---- .../serialize/test_serialize_pipeline.py | 7 ++- website/docs/api/language.md | 24 +++++----- website/docs/api/top-level.md | 20 ++++----- website/docs/usage/processing-pipelines.md | 3 +- 7 files changed, 56 insertions(+), 65 deletions(-) diff --git a/spacy/errors.py b/spacy/errors.py index 2f8a3996f..278e5496a 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -212,8 +212,8 @@ class Warnings(metaclass=ErrorsWithCodes): W121 = ("Attempting to trace non-existent method '{method}' in pipe '{pipe}'") W122 = ("Couldn't trace method '{method}' in pipe '{pipe}'. This can happen if the pipe class " "is a Cython extension type.") - W123 = ("Argument {arg} with value {arg_value} is used instead of {config_value} as specified in the config. Be " - "aware that this might affect other components in your pipeline.") + W123 = ("Argument `enable` with value {enable} does not contain all values specified in the config option " + "`enabled` ({enabled}). Be aware that this might affect other components in your pipeline.") class Errors(metaclass=ErrorsWithCodes): diff --git a/spacy/language.py b/spacy/language.py index d391f15ab..967af1e62 100644 --- a/spacy/language.py +++ b/spacy/language.py @@ -1879,31 +1879,22 @@ class Language: if isinstance(exclude, str): exclude = [exclude] - def fetch_pipes_status(value: Iterable[str], key: str) -> Iterable[str]: - """Fetch value for `enable` or `disable` w.r.t. the specified config and passed arguments passed to - .load(). If both arguments and config specified values for this field, the passed arguments take precedence - and a warning is printed. - value (Iterable[str]): Passed value for `enable` or `disable`. - key (str): Key for field in config (either "enabled" or "disabled"). - RETURN (Iterable[str]): - """ - # We assume that no argument was passed if the value is the specified default value. - if id(value) == id(_DEFAULT_EMPTY_PIPES): - return config["nlp"].get(key, []) - else: - if len(config["nlp"].get(key, [])): - warnings.warn( - Warnings.W123.format( - arg=key[:-1], - arg_value=value, - config_value=config["nlp"][key], - ) + # `enable` should not be merged with `enabled` (the opposite is true for `disable`/`disabled`). If the config + # specifies values for `enabled` not included in `enable`, emit warning. + if id(enable) != id(_DEFAULT_EMPTY_PIPES): + enabled = config["nlp"].get("enabled", []) + if len(enabled) and not set(enabled).issubset(enable): + warnings.warn( + Warnings.W123.format( + enable=enable, + enabled=enabled, ) - return value + ) + # Ensure sets of disabled/enabled pipe names are not contradictory. disabled_pipes = cls._resolve_component_status( - fetch_pipes_status(disable, "disabled"), - fetch_pipes_status(enable, "enabled"), + list({*disable, *config["nlp"].get("disabled", [])}), + enable, config["nlp"]["pipeline"], ) nlp._disabled = set(p for p in disabled_pipes if p not in exclude) @@ -2084,10 +2075,12 @@ class Language: if enable: if isinstance(enable, str): enable = [enable] - to_disable = [ - pipe_name for pipe_name in pipe_names if pipe_name not in enable - ] - if disable and disable != to_disable: + to_disable = { + *[pipe_name for pipe_name in pipe_names if pipe_name not in enable], + *disable, + } + # If any pipe to be enabled is in to_disable, the specification is inconsistent. + if len(set(enable) & to_disable): raise ValueError(Errors.E1042.format(enable=enable, disable=disable)) return tuple(to_disable) diff --git a/spacy/tests/pipeline/test_pipe_methods.py b/spacy/tests/pipeline/test_pipe_methods.py index 14a7a36e5..4dd7bae16 100644 --- a/spacy/tests/pipeline/test_pipe_methods.py +++ b/spacy/tests/pipeline/test_pipe_methods.py @@ -615,20 +615,18 @@ def test_enable_disable_conflict_with_config(): with make_tempdir() as tmp_dir: nlp.to_disk(tmp_dir) - # Expected to fail, as config and arguments conflict. - with pytest.raises(ValueError): - spacy.load( - tmp_dir, enable=["tagger"], config={"nlp": {"disabled": ["senter"]}} - ) + # Expected to succeed, as config and arguments do not conflict. + assert spacy.load( + tmp_dir, enable=["tagger"], config={"nlp": {"disabled": ["senter"]}} + ).disabled == ["senter", "sentencizer"] # Expected to succeed without warning due to the lack of a conflicting config option. spacy.load(tmp_dir, enable=["tagger"]) - # Expected to succeed with a warning, as disable=[] should override the config setting. - with pytest.warns(UserWarning): + # Expected to fail due to conflict between enable and disabled. + with pytest.raises(ValueError): spacy.load( tmp_dir, - enable=["tagger"], - disable=[], - config={"nlp": {"disabled": ["senter"]}}, + enable=["senter"], + config={"nlp": {"disabled": ["senter", "tagger"]}}, ) diff --git a/spacy/tests/serialize/test_serialize_pipeline.py b/spacy/tests/serialize/test_serialize_pipeline.py index b948bb76c..9fcf18e2d 100644 --- a/spacy/tests/serialize/test_serialize_pipeline.py +++ b/spacy/tests/serialize/test_serialize_pipeline.py @@ -404,11 +404,10 @@ def test_serialize_pipeline_disable_enable(): assert nlp3.component_names == ["ner", "tagger"] with make_tempdir() as d: nlp3.to_disk(d) - with pytest.warns(UserWarning): - nlp4 = spacy.load(d, disable=["ner"]) - assert nlp4.pipe_names == ["tagger"] + nlp4 = spacy.load(d, disable=["ner"]) + assert nlp4.pipe_names == [] assert nlp4.component_names == ["ner", "tagger"] - assert nlp4.disabled == ["ner"] + assert nlp4.disabled == ["ner", "tagger"] with make_tempdir() as d: nlp.to_disk(d) nlp5 = spacy.load(d, exclude=["tagger"]) diff --git a/website/docs/api/language.md b/website/docs/api/language.md index 767a7450a..504640d57 100644 --- a/website/docs/api/language.md +++ b/website/docs/api/language.md @@ -63,18 +63,18 @@ spaCy loads a model under the hood based on its > nlp = Language.from_config(config) > ``` -| Name | Description | -| ------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `config` | The loaded config. ~~Union[Dict[str, Any], Config]~~ | -| _keyword-only_ | | -| `vocab` | A `Vocab` object. If `True`, a vocab is created using the default language data settings. ~~Vocab~~ | -| `disable` | Name(s) of pipeline component(s) to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [`nlp.enable_pipe`](/api/language#enable_pipe). ~~Union[str, Iterable[str]]~~ | -| `enable` 3.4 | Name(s) of pipeline component(s) to [enable](/usage/processing-pipelines#disabling). All other pipes will be disabled, but can be enabled again using [`nlp.enable_pipe`](/api/language#enable_pipe). ~~Union[str, Iterable[str]]~~ | -| `exclude` | Name(s) of pipeline component(s) to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~Union[str, Iterable[str]]~~ | -| `meta` | [Meta data](/api/data-formats#meta) overrides. ~~Dict[str, Any]~~ | -| `auto_fill` | Whether to automatically fill in missing values in the config, based on defaults and function argument annotations. Defaults to `True`. ~~bool~~ | -| `validate` | Whether to validate the component config and arguments against the types expected by the factory. Defaults to `True`. ~~bool~~ | -| **RETURNS** | The initialized object. ~~Language~~ | +| Name | Description | +| ------------------------------------- | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `config` | The loaded config. ~~Union[Dict[str, Any], Config]~~ | +| _keyword-only_ | | +| `vocab` | A `Vocab` object. If `True`, a vocab is created using the default language data settings. ~~Vocab~~ | +| `disable` | Name(s) of pipeline component(s) to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [nlp.enable_pipe](/api/language#enable_pipe). Is merged with the config entry `nlp.disabled`. ~~Union[str, Iterable[str]]~~ | +| `enable` 3.4 | Name(s) of pipeline component(s) to [enable](/usage/processing-pipelines#disabling). All other pipes will be disabled, but can be enabled again using [nlp.enable_pipe](/api/language#enable_pipe). ~~Union[str, Iterable[str]]~~ | +| `exclude` | Name(s) of pipeline component(s) to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~Union[str, Iterable[str]]~~ | +| `meta` | [Meta data](/api/data-formats#meta) overrides. ~~Dict[str, Any]~~ | +| `auto_fill` | Whether to automatically fill in missing values in the config, based on defaults and function argument annotations. Defaults to `True`. ~~bool~~ | +| `validate` | Whether to validate the component config and arguments against the types expected by the factory. Defaults to `True`. ~~bool~~ | +| **RETURNS** | The initialized object. ~~Language~~ | ## Language.component {#component tag="classmethod" new="3"} diff --git a/website/docs/api/top-level.md b/website/docs/api/top-level.md index bc53fc868..c798f2a8d 100644 --- a/website/docs/api/top-level.md +++ b/website/docs/api/top-level.md @@ -45,16 +45,16 @@ specified separately using the new `exclude` keyword argument. > nlp = spacy.load("en_core_web_sm", exclude=["parser", "tagger"]) > ``` -| Name | Description | -| ------------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | -| `name` | Pipeline to load, i.e. package name or path. ~~Union[str, Path]~~ | -| _keyword-only_ | | -| `vocab` | Optional shared vocab to pass in on initialization. If `True` (default), a new `Vocab` object will be created. ~~Union[Vocab, bool]~~ | -| `disable` | Name(s) of pipeline component(s) to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [nlp.enable_pipe](/api/language#enable_pipe). ~~Union[str, Iterable[str]]~~ | -| `enable` 3.4 | Name(s) of pipeline component(s) to [enable](/usage/processing-pipelines#disabling). All other pipes will be disabled. ~~Union[str, Iterable[str]]~~ | -| `exclude` 3 | Name(s) of pipeline component(s) to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~Union[str, Iterable[str]]~~ | -| `config` 3 | Optional config overrides, either as nested dict or dict keyed by section value in dot notation, e.g. `"components.name.value"`. ~~Union[Dict[str, Any], Config]~~ | -| **RETURNS** | A `Language` object with the loaded pipeline. ~~Language~~ | +| Name | Description | +| ------------------------------------- | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `name` | Pipeline to load, i.e. package name or path. ~~Union[str, Path]~~ | +| _keyword-only_ | | +| `vocab` | Optional shared vocab to pass in on initialization. If `True` (default), a new `Vocab` object will be created. ~~Union[Vocab, bool]~~ | +| `disable` | Name(s) of pipeline component(s) to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [nlp.enable_pipe](/api/language#enable_pipe). Is merged with the config entry `nlp.disabled`. ~~Union[str, Iterable[str]]~~ | +| `enable` 3.4 | Name(s) of pipeline component(s) to [enable](/usage/processing-pipelines#disabling). All other pipes will be disabled. ~~Union[str, Iterable[str]]~~ | +| `exclude` 3 | Name(s) of pipeline component(s) to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~Union[str, Iterable[str]]~~ | +| `config` 3 | Optional config overrides, either as nested dict or dict keyed by section value in dot notation, e.g. `"components.name.value"`. ~~Union[Dict[str, Any], Config]~~ | +| **RETURNS** | A `Language` object with the loaded pipeline. ~~Language~~ | Essentially, `spacy.load()` is a convenience wrapper that reads the pipeline's [`config.cfg`](/api/data-formats#config), uses the language and pipeline diff --git a/website/docs/usage/processing-pipelines.md b/website/docs/usage/processing-pipelines.md index bd28810ae..0b63cdcb8 100644 --- a/website/docs/usage/processing-pipelines.md +++ b/website/docs/usage/processing-pipelines.md @@ -363,7 +363,8 @@ nlp.enable_pipe("tagger") ``` In addition to `disable`, `spacy.load()` also accepts `enable`. If `enable` is -set, all components except for those in `enable` are disabled. +set, all components except for those in `enable` are disabled. If `enable` and +`disable` conflict (i.e. the same component is included in both), an error is raised. ```python # Load the complete pipeline, but disable all components except for tok2vec and tagger From 03eebe9d1c79d39a632876205e93f023fc096d85 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Wed, 9 Nov 2022 10:59:28 +0100 Subject: [PATCH 077/161] Update warning, add tests for project requirements check (#11777) * Update warning, add tests for project requirements check * Make warning more general for differences between PEP 508 and pip * Add tests for _check_requirements * Parameterize test --- spacy/cli/project/run.py | 5 ++--- spacy/tests/test_cli.py | 41 ++++++++++++++++++++++++++++++++++++++++ 2 files changed, 43 insertions(+), 3 deletions(-) diff --git a/spacy/cli/project/run.py b/spacy/cli/project/run.py index 638e7fab1..5db9e14f4 100644 --- a/spacy/cli/project/run.py +++ b/spacy/cli/project/run.py @@ -344,9 +344,8 @@ def _check_requirements(requirements: List[str]) -> Tuple[bool, bool]: conflicting_pkgs_msgs.append(vc.report()) except Exception: msg.warn(f"Unable to check requirement: {req} " - "Check that the requirement is formatted according to PEP " - "440, in particular that URLs are formatted as " - "'package_name @ URL'") + "Checks are currently limited to requirement specifiers " + "(PEP 508)") if len(failed_pkgs_msgs) or len(conflicting_pkgs_msgs): msg.warn( diff --git a/spacy/tests/test_cli.py b/spacy/tests/test_cli.py index 838e00369..8225e14f1 100644 --- a/spacy/tests/test_cli.py +++ b/spacy/tests/test_cli.py @@ -1,5 +1,6 @@ import os import math +import pkg_resources from random import sample from typing import Counter @@ -25,6 +26,7 @@ from spacy.cli.download import get_compatibility, get_version from spacy.cli.init_config import RECOMMENDATIONS, init_config, fill_config from spacy.cli.package import get_third_party_dependencies from spacy.cli.package import _is_permitted_package_name +from spacy.cli.project.run import _check_requirements from spacy.cli.validate import get_model_pkgs from spacy.lang.en import English from spacy.lang.nl import Dutch @@ -855,3 +857,42 @@ def test_span_length_freq_dist_output_must_be_correct(): span_freqs = _get_spans_length_freq_dist(sample_span_lengths, threshold) assert sum(span_freqs.values()) >= threshold assert list(span_freqs.keys()) == [3, 1, 4, 5, 2] + + +@pytest.mark.parametrize( + "reqs,output", + [ + [ + """ + spacy + + # comment + + thinc""", + (False, False), + ], + [ + """# comment + --some-flag + spacy""", + (False, False), + ], + [ + """# comment + --some-flag + spacy; python_version >= '3.6'""", + (False, False), + ], + [ + """# comment + spacyunknowndoesnotexist12345""", + (True, False), + ], + ], +) +def test_project_check_requirements(reqs, output): + # excessive guard against unlikely package name + try: + pkg_resources.require("spacyunknowndoesnotexist12345") + except pkg_resources.DistributionNotFound: + assert output == _check_requirements([req.strip() for req in reqs.split("\n")]) From 322b5dc1df7031139780963cebaa081a75384834 Mon Sep 17 00:00:00 2001 From: Jacobo Myerston <43222279+jmyerston@users.noreply.github.com> Date: Wed, 9 Nov 2022 20:21:20 -0800 Subject: [PATCH 078/161] Add greCy to Universe (#11774) * Update universe.json * Update universe.json fixes Github value --- website/meta/universe.json | 26 ++++++++++++++++++++++++++ 1 file changed, 26 insertions(+) diff --git a/website/meta/universe.json b/website/meta/universe.json index d7c99956b..fa765f640 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -1,5 +1,31 @@ { "resources": [ + { + "id": "grecy", + "title": "greCy", + "slogan": "Ancient Greek pipelines for spaCy", + "description": "greCy offers state-of-the-art pipelines for ancient Greek NLP. The repository makes language models available in various sizes, some of them containing floret word vectors and a BERT transformer layer.", + "github": "jmyerston/greCy", + "code_example": [ + "import spacy", + "#After installing the grc_ud_proiel_trf wheel package from the greCy repository", + "", + "nlp = spacy.load('grc_ud_proiel_trf')", + "doc = nlp('δοκῶ μοι περὶ ὧν πυνθάνεσθε οὐκ ἀμελέτητος εἶναι.')", + "", + "for token in doc:", + " print(token.text, token.norm_, token.lemma_, token.pos_, token.tag_)" + ], + "code_language": "python", + "author": "Jacobo Myerston", + "author_links": { + "twitter": "@jcbmyrstn", + "github": "jmyerston", + "website": "https://huggingface.co/spaces/Jacobo/syntax" + }, + "category": ["pipeline", "research"], + "tags": ["ancient Greek"] + }, { "id": "spacy-cleaner", "title": "spacy-cleaner", From 188a7d00eb552faaa70ba6ee3032757eecefbb5a Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 11 Nov 2022 09:58:31 +0100 Subject: [PATCH 079/161] Auto-format code with black (#11792) Co-authored-by: explosion-bot --- spacy/cli/project/run.py | 8 +++++--- 1 file changed, 5 insertions(+), 3 deletions(-) diff --git a/spacy/cli/project/run.py b/spacy/cli/project/run.py index 5db9e14f4..a109c4a5a 100644 --- a/spacy/cli/project/run.py +++ b/spacy/cli/project/run.py @@ -343,9 +343,11 @@ def _check_requirements(requirements: List[str]) -> Tuple[bool, bool]: except pkg_resources.VersionConflict as vc: conflicting_pkgs_msgs.append(vc.report()) except Exception: - msg.warn(f"Unable to check requirement: {req} " - "Checks are currently limited to requirement specifiers " - "(PEP 508)") + msg.warn( + f"Unable to check requirement: {req} " + "Checks are currently limited to requirement specifiers " + "(PEP 508)" + ) if len(failed_pkgs_msgs) or len(conflicting_pkgs_msgs): msg.warn( From 3478ff1eb0fd57c48a332e7787efe6ea47492e13 Mon Sep 17 00:00:00 2001 From: Edward <43848523+thomashacker@users.noreply.github.com> Date: Mon, 14 Nov 2022 09:41:01 +0100 Subject: [PATCH 080/161] remove new v2 tags (#11780) --- website/README.md | 4 +- website/docs/api/cli.md | 81 ++++++------ website/docs/api/doc.md | 50 ++++---- website/docs/api/language.md | 72 +++++------ website/docs/api/lexeme.md | 82 ++++++------ website/docs/api/matcher.md | 14 +-- website/docs/api/phrasematcher.md | 10 +- website/docs/api/span.md | 62 +++++----- website/docs/api/token.md | 144 +++++++++++----------- website/docs/api/top-level.md | 52 ++++---- website/docs/api/vocab.md | 22 ++-- website/docs/usage/rule-based-matching.md | 6 +- website/docs/usage/saving-loading.md | 12 +- 13 files changed, 305 insertions(+), 306 deletions(-) diff --git a/website/README.md b/website/README.md index db050cf03..66bc20ad9 100644 --- a/website/README.md +++ b/website/README.md @@ -155,7 +155,7 @@ import Tag from 'components/tag' > ```jsx > method -> 2.1 +> 4 > tagger, parser > ``` @@ -170,7 +170,7 @@ installed. -method 2 tagger, +method 4 tagger, parser diff --git a/website/docs/api/cli.md b/website/docs/api/cli.md index fc2c46022..024450920 100644 --- a/website/docs/api/cli.md +++ b/website/docs/api/cli.md @@ -53,7 +53,7 @@ $ python -m spacy download [model] [--direct] [--sdist] [pip_args] | `--direct`, `-D` | Force direct download of exact package version. ~~bool (flag)~~ | | `--sdist`, `-S` 3 | Download the source package (`.tar.gz` archive) instead of the default pre-built binary wheel. ~~bool (flag)~~ | | `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | -| pip args 2.1 | Additional installation options to be passed to `pip install` when installing the pipeline package. For example, `--user` to install to the user home directory or `--no-deps` to not install package dependencies. ~~Any (option/flag)~~ | +| pip args | Additional installation options to be passed to `pip install` when installing the pipeline package. For example, `--user` to install to the user home directory or `--no-deps` to not install package dependencies. ~~Any (option/flag)~~ | | **CREATES** | The installed pipeline package in your `site-packages` directory. | ## info {#info tag="command"} @@ -77,15 +77,15 @@ $ python -m spacy info [--markdown] [--silent] [--exclude] $ python -m spacy info [model] [--markdown] [--silent] [--exclude] ``` -| Name | Description | -| ------------------------------------------------ | ----------------------------------------------------------------------------------------------------------------------- | -| `model` | A trained pipeline, i.e. package name or path (optional). ~~Optional[str] \(option)~~ | -| `--markdown`, `-md` | Print information as Markdown. ~~bool (flag)~~ | -| `--silent`, `-s` 2.0.12 | Don't print anything, just return the values. ~~bool (flag)~~ | -| `--exclude`, `-e` | Comma-separated keys to exclude from the print-out. Defaults to `"labels"`. ~~Optional[str]~~ | -| `--url`, `-u` 3.5.0 | Print the URL to download the most recent compatible version of the pipeline. Requires a pipeline name. ~~bool (flag)~~ | -| `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | -| **PRINTS** | Information about your spaCy installation. | +| Name | Description | +| -------------------------------------------- | ----------------------------------------------------------------------------------------------------------------------- | +| `model` | A trained pipeline, i.e. package name or path (optional). ~~Optional[str] \(option)~~ | +| `--markdown`, `-md` | Print information as Markdown. ~~bool (flag)~~ | +| `--silent`, `-s` | Don't print anything, just return the values. ~~bool (flag)~~ | +| `--exclude`, `-e` | Comma-separated keys to exclude from the print-out. Defaults to `"labels"`. ~~Optional[str]~~ | +| `--url`, `-u` 3.5.0 | Print the URL to download the most recent compatible version of the pipeline. Requires a pipeline name. ~~bool (flag)~~ | +| `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | +| **PRINTS** | Information about your spaCy installation. | ## validate {#validate new="2" tag="command"} @@ -260,22 +260,22 @@ chosen based on the file extension of the input file. $ python -m spacy convert [input_file] [output_dir] [--converter] [--file-type] [--n-sents] [--seg-sents] [--base] [--morphology] [--merge-subtokens] [--ner-map] [--lang] ``` -| Name | Description | -| ------------------------------------------------ | ----------------------------------------------------------------------------------------------------------------------------------------- | -| `input_path` | Input file or directory. ~~Path (positional)~~ | -| `output_dir` | Output directory for converted file. Defaults to `"-"`, meaning data will be written to `stdout`. ~~Optional[Path] \(option)~~ | -| `--converter`, `-c` 2 | Name of converter to use (see below). ~~str (option)~~ | -| `--file-type`, `-t` 2.1 | Type of file to create. Either `spacy` (default) for binary [`DocBin`](/api/docbin) data or `json` for v2.x JSON format. ~~str (option)~~ | -| `--n-sents`, `-n` | Number of sentences per document. Supported for: `conll`, `conllu`, `iob`, `ner` ~~int (option)~~ | -| `--seg-sents`, `-s` 2.2 | Segment sentences. Supported for: `conll`, `ner` ~~bool (flag)~~ | -| `--base`, `-b`, `--model` | Trained spaCy pipeline for sentence segmentation to use as base (for `--seg-sents`). ~~Optional[str](option)~~ | -| `--morphology`, `-m` | Enable appending morphology to tags. Supported for: `conllu` ~~bool (flag)~~ | -| `--merge-subtokens`, `-T` | Merge CoNLL-U subtokens ~~bool (flag)~~ | -| `--ner-map`, `-nm` | NER tag mapping (as JSON-encoded dict of entity types). Supported for: `conllu` ~~Optional[Path](option)~~ | -| `--lang`, `-l` 2.1 | Language code (if tokenizer required). ~~Optional[str] \(option)~~ | -| `--concatenate`, `-C` | Concatenate output to a single file ~~bool (flag)~~ | -| `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | -| **CREATES** | Binary [`DocBin`](/api/docbin) training data that can be used with [`spacy train`](/api/cli#train). | +| Name | Description | +| ------------------------- | ----------------------------------------------------------------------------------------------------------------------------------------- | +| `input_path` | Input file or directory. ~~Path (positional)~~ | +| `output_dir` | Output directory for converted file. Defaults to `"-"`, meaning data will be written to `stdout`. ~~Optional[Path] \(option)~~ | +| `--converter`, `-c` | Name of converter to use (see below). ~~str (option)~~ | +| `--file-type`, `-t` | Type of file to create. Either `spacy` (default) for binary [`DocBin`](/api/docbin) data or `json` for v2.x JSON format. ~~str (option)~~ | +| `--n-sents`, `-n` | Number of sentences per document. Supported for: `conll`, `conllu`, `iob`, `ner` ~~int (option)~~ | +| `--seg-sents`, `-s` | Segment sentences. Supported for: `conll`, `ner` ~~bool (flag)~~ | +| `--base`, `-b`, `--model` | Trained spaCy pipeline for sentence segmentation to use as base (for `--seg-sents`). ~~Optional[str](option)~~ | +| `--morphology`, `-m` | Enable appending morphology to tags. Supported for: `conllu` ~~bool (flag)~~ | +| `--merge-subtokens`, `-T` | Merge CoNLL-U subtokens ~~bool (flag)~~ | +| `--ner-map`, `-nm` | NER tag mapping (as JSON-encoded dict of entity types). Supported for: `conllu` ~~Optional[Path](option)~~ | +| `--lang`, `-l` | Language code (if tokenizer required). ~~Optional[str] \(option)~~ | +| `--concatenate`, `-C` | Concatenate output to a single file ~~bool (flag)~~ | +| `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | +| **CREATES** | Binary [`DocBin`](/api/docbin) training data that can be used with [`spacy train`](/api/cli#train). | ### Converters {#converters} @@ -474,8 +474,7 @@ report span characteristics such as the average span length and the span (or span boundary) distinctiveness. The distinctiveness measure shows how different the tokens are with respect to the rest of the corpus using the KL-divergence of the token distributions. To learn more, you can check out Papay et al.'s work on -[*Dissecting Span Identification Tasks with Performance Prediction* (EMNLP -2020)](https://aclanthology.org/2020.emnlp-main.396/). +[*Dissecting Span Identification Tasks with Performance Prediction* (EMNLP 2020)](https://aclanthology.org/2020.emnlp-main.396/). @@ -1229,19 +1228,19 @@ $ python -m spacy package [input_dir] [output_dir] [--code] [--meta-path] [--cre > $ pip install dist/en_pipeline-0.0.0.tar.gz > ``` -| Name | Description | -| ------------------------------------------------ | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `input_dir` | Path to directory containing pipeline data. ~~Path (positional)~~ | -| `output_dir` | Directory to create package folder in. ~~Path (positional)~~ | -| `--code`, `-c` 3 | Comma-separated paths to Python files to be included in the package and imported in its `__init__.py`. This allows including [registering functions](/usage/training#custom-functions) and [custom components](/usage/processing-pipelines#custom-components). ~~str (option)~~ | -| `--meta-path`, `-m` 2 | Path to [`meta.json`](/api/data-formats#meta) file (optional). ~~Optional[Path] \(option)~~ | -| `--create-meta`, `-C` 2 | Create a `meta.json` file on the command line, even if one already exists in the directory. If an existing file is found, its entries will be shown as the defaults in the command line prompt. ~~bool (flag)~~ | -| `--build`, `-b` 3 | Comma-separated artifact formats to build. Can be `sdist` (for a `.tar.gz` archive) and/or `wheel` (for a binary `.whl` file), or `none` if you want to run this step manually. The generated artifacts can be installed by `pip install`. Defaults to `sdist`. ~~str (option)~~ | -| `--name`, `-n` 3 | Package name to override in meta. ~~Optional[str] \(option)~~ | -| `--version`, `-v` 3 | Package version to override in meta. Useful when training new versions, as it doesn't require editing the meta template. ~~Optional[str] \(option)~~ | -| `--force`, `-f` | Force overwriting of existing folder in output directory. ~~bool (flag)~~ | -| `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | -| **CREATES** | A Python package containing the spaCy pipeline. | +| Name | Description | +| -------------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `input_dir` | Path to directory containing pipeline data. ~~Path (positional)~~ | +| `output_dir` | Directory to create package folder in. ~~Path (positional)~~ | +| `--code`, `-c` 3 | Comma-separated paths to Python files to be included in the package and imported in its `__init__.py`. This allows including [registering functions](/usage/training#custom-functions) and [custom components](/usage/processing-pipelines#custom-components). ~~str (option)~~ | +| `--meta-path`, `-m` | Path to [`meta.json`](/api/data-formats#meta) file (optional). ~~Optional[Path] \(option)~~ | +| `--create-meta`, `-C` | Create a `meta.json` file on the command line, even if one already exists in the directory. If an existing file is found, its entries will be shown as the defaults in the command line prompt. ~~bool (flag)~~ | +| `--build`, `-b` 3 | Comma-separated artifact formats to build. Can be `sdist` (for a `.tar.gz` archive) and/or `wheel` (for a binary `.whl` file), or `none` if you want to run this step manually. The generated artifacts can be installed by `pip install`. Defaults to `sdist`. ~~str (option)~~ | +| `--name`, `-n` 3 | Package name to override in meta. ~~Optional[str] \(option)~~ | +| `--version`, `-v` 3 | Package version to override in meta. Useful when training new versions, as it doesn't require editing the meta template. ~~Optional[str] \(option)~~ | +| `--force`, `-f` | Force overwriting of existing folder in output directory. ~~bool (flag)~~ | +| `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | +| **CREATES** | A Python package containing the spaCy pipeline. | ## project {#project new="3"} diff --git a/website/docs/api/doc.md b/website/docs/api/doc.md index f97ed4547..090489d83 100644 --- a/website/docs/api/doc.md +++ b/website/docs/api/doc.md @@ -209,15 +209,15 @@ alignment mode `"strict". > assert span.text == "New York" > ``` -| Name | Description | -| ------------------------------------ | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `start` | The index of the first character of the span. ~~int~~ | -| `end` | The index of the last character after the span. ~~int~~ | -| `label` | A label to attach to the span, e.g. for named entities. ~~Union[int, str]~~ | -| `kb_id` 2.2 | An ID from a knowledge base to capture the meaning of a named entity. ~~Union[int, str]~~ | -| `vector` | A meaning representation of the span. ~~numpy.ndarray[ndim=1, dtype=float32]~~ | -| `alignment_mode` | How character indices snap to token boundaries. Options: `"strict"` (no snapping), `"contract"` (span of all tokens completely within the character span), `"expand"` (span of all tokens at least partially covered by the character span). Defaults to `"strict"`. ~~str~~ | -| **RETURNS** | The newly constructed object or `None`. ~~Optional[Span]~~ | +| Name | Description | +| ---------------- | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `start` | The index of the first character of the span. ~~int~~ | +| `end` | The index of the last character after the span. ~~int~~ | +| `label` | A label to attach to the span, e.g. for named entities. ~~Union[int, str]~~ | +| `kb_id` | An ID from a knowledge base to capture the meaning of a named entity. ~~Union[int, str]~~ | +| `vector` | A meaning representation of the span. ~~numpy.ndarray[ndim=1, dtype=float32]~~ | +| `alignment_mode` | How character indices snap to token boundaries. Options: `"strict"` (no snapping), `"contract"` (span of all tokens completely within the character span), `"expand"` (span of all tokens at least partially covered by the character span). Defaults to `"strict"`. ~~str~~ | +| **RETURNS** | The newly constructed object or `None`. ~~Optional[Span]~~ | ## Doc.set_ents {#set_ents tag="method" new="3"} @@ -751,22 +751,22 @@ The L2 norm of the document's vector representation. ## Attributes {#attributes} -| Name | Description | -| ------------------------------------ | ----------------------------------------------------------------------------------------------------------------------------------- | -| `text` | A string representation of the document text. ~~str~~ | -| `text_with_ws` | An alias of `Doc.text`, provided for duck-type compatibility with `Span` and `Token`. ~~str~~ | -| `mem` | The document's local memory heap, for all C data it owns. ~~cymem.Pool~~ | -| `vocab` | The store of lexical types. ~~Vocab~~ | -| `tensor` 2 | Container for dense vector representations. ~~numpy.ndarray~~ | -| `user_data` | A generic storage area, for user custom data. ~~Dict[str, Any]~~ | -| `lang` 2.1 | Language of the document's vocabulary. ~~int~~ | -| `lang_` 2.1 | Language of the document's vocabulary. ~~str~~ | -| `sentiment` | The document's positivity/negativity score, if available. ~~float~~ | -| `user_hooks` | A dictionary that allows customization of the `Doc`'s properties. ~~Dict[str, Callable]~~ | -| `user_token_hooks` | A dictionary that allows customization of properties of `Token` children. ~~Dict[str, Callable]~~ | -| `user_span_hooks` | A dictionary that allows customization of properties of `Span` children. ~~Dict[str, Callable]~~ | -| `has_unknown_spaces` | Whether the document was constructed without known spacing between tokens (typically when created from gold tokenization). ~~bool~~ | -| `_` | User space for adding custom [attribute extensions](/usage/processing-pipelines#custom-components-attributes). ~~Underscore~~ | +| Name | Description | +| -------------------- | ----------------------------------------------------------------------------------------------------------------------------------- | +| `text` | A string representation of the document text. ~~str~~ | +| `text_with_ws` | An alias of `Doc.text`, provided for duck-type compatibility with `Span` and `Token`. ~~str~~ | +| `mem` | The document's local memory heap, for all C data it owns. ~~cymem.Pool~~ | +| `vocab` | The store of lexical types. ~~Vocab~~ | +| `tensor` | Container for dense vector representations. ~~numpy.ndarray~~ | +| `user_data` | A generic storage area, for user custom data. ~~Dict[str, Any]~~ | +| `lang` | Language of the document's vocabulary. ~~int~~ | +| `lang_` | Language of the document's vocabulary. ~~str~~ | +| `sentiment` | The document's positivity/negativity score, if available. ~~float~~ | +| `user_hooks` | A dictionary that allows customization of the `Doc`'s properties. ~~Dict[str, Callable]~~ | +| `user_token_hooks` | A dictionary that allows customization of properties of `Token` children. ~~Dict[str, Callable]~~ | +| `user_span_hooks` | A dictionary that allows customization of properties of `Span` children. ~~Dict[str, Callable]~~ | +| `has_unknown_spaces` | Whether the document was constructed without known spacing between tokens (typically when created from gold tokenization). ~~bool~~ | +| `_` | User space for adding custom [attribute extensions](/usage/processing-pipelines#custom-components-attributes). ~~Underscore~~ | ## Serialization fields {#serialization-fields} diff --git a/website/docs/api/language.md b/website/docs/api/language.md index 504640d57..ad0ac2a46 100644 --- a/website/docs/api/language.md +++ b/website/docs/api/language.md @@ -63,18 +63,18 @@ spaCy loads a model under the hood based on its > nlp = Language.from_config(config) > ``` -| Name | Description | -| ------------------------------------- | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `config` | The loaded config. ~~Union[Dict[str, Any], Config]~~ | -| _keyword-only_ | | -| `vocab` | A `Vocab` object. If `True`, a vocab is created using the default language data settings. ~~Vocab~~ | +| Name | Description | +| ------------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | +| `config` | The loaded config. ~~Union[Dict[str, Any], Config]~~ | +| _keyword-only_ | | +| `vocab` | A `Vocab` object. If `True`, a vocab is created using the default language data settings. ~~Vocab~~ | | `disable` | Name(s) of pipeline component(s) to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [nlp.enable_pipe](/api/language#enable_pipe). Is merged with the config entry `nlp.disabled`. ~~Union[str, Iterable[str]]~~ | -| `enable` 3.4 | Name(s) of pipeline component(s) to [enable](/usage/processing-pipelines#disabling). All other pipes will be disabled, but can be enabled again using [nlp.enable_pipe](/api/language#enable_pipe). ~~Union[str, Iterable[str]]~~ | -| `exclude` | Name(s) of pipeline component(s) to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~Union[str, Iterable[str]]~~ | -| `meta` | [Meta data](/api/data-formats#meta) overrides. ~~Dict[str, Any]~~ | -| `auto_fill` | Whether to automatically fill in missing values in the config, based on defaults and function argument annotations. Defaults to `True`. ~~bool~~ | -| `validate` | Whether to validate the component config and arguments against the types expected by the factory. Defaults to `True`. ~~bool~~ | -| **RETURNS** | The initialized object. ~~Language~~ | +| `enable` 3.4 | Name(s) of pipeline component(s) to [enable](/usage/processing-pipelines#disabling). All other pipes will be disabled, but can be enabled again using [nlp.enable_pipe](/api/language#enable_pipe). ~~Union[str, Iterable[str]]~~ | +| `exclude` | Name(s) of pipeline component(s) to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~Union[str, Iterable[str]]~~ | +| `meta` | [Meta data](/api/data-formats#meta) overrides. ~~Dict[str, Any]~~ | +| `auto_fill` | Whether to automatically fill in missing values in the config, based on defaults and function argument annotations. Defaults to `True`. ~~bool~~ | +| `validate` | Whether to validate the component config and arguments against the types expected by the factory. Defaults to `True`. ~~bool~~ | +| **RETURNS** | The initialized object. ~~Language~~ | ## Language.component {#component tag="classmethod" new="3"} @@ -198,16 +198,16 @@ tokenization is skipped but the rest of the pipeline is run. > assert doc.has_annotation("DEP") > ``` -| Name | Description | -| ------------------------------------------ | ------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `texts` | A sequence of strings (or `Doc` objects). ~~Iterable[Union[str, Doc]]~~ | -| _keyword-only_ | | -| `as_tuples` | If set to `True`, inputs should be a sequence of `(text, context)` tuples. Output will then be a sequence of `(doc, context)` tuples. Defaults to `False`. ~~bool~~ | -| `batch_size` | The number of texts to buffer. ~~Optional[int]~~ | -| `disable` | Names of pipeline components to [disable](/usage/processing-pipelines#disabling). ~~List[str]~~ | -| `component_cfg` | Optional dictionary of keyword arguments for components, keyed by component names. Defaults to `None`. ~~Optional[Dict[str, Dict[str, Any]]]~~ | -| `n_process` 2.2.2 | Number of processors to use. Defaults to `1`. ~~int~~ | -| **YIELDS** | Documents in the order of the original text. ~~Doc~~ | +| Name | Description | +| --------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `texts` | A sequence of strings (or `Doc` objects). ~~Iterable[Union[str, Doc]]~~ | +| _keyword-only_ | | +| `as_tuples` | If set to `True`, inputs should be a sequence of `(text, context)` tuples. Output will then be a sequence of `(doc, context)` tuples. Defaults to `False`. ~~bool~~ | +| `batch_size` | The number of texts to buffer. ~~Optional[int]~~ | +| `disable` | Names of pipeline components to [disable](/usage/processing-pipelines#disabling). ~~List[str]~~ | +| `component_cfg` | Optional dictionary of keyword arguments for components, keyed by component names. Defaults to `None`. ~~Optional[Dict[str, Dict[str, Any]]]~~ | +| `n_process` | Number of processors to use. Defaults to `1`. ~~int~~ | +| **YIELDS** | Documents in the order of the original text. ~~Doc~~ | ## Language.set_error_handler {#set_error_handler tag="method" new="3"} @@ -1030,21 +1030,21 @@ details. ## Attributes {#attributes} -| Name | Description | -| --------------------------------------------- | ---------------------------------------------------------------------------------------------------------------------------------------------- | -| `vocab` | A container for the lexical types. ~~Vocab~~ | -| `tokenizer` | The tokenizer. ~~Tokenizer~~ | -| `make_doc` | Callable that takes a string and returns a `Doc`. ~~Callable[[str], Doc]~~ | -| `pipeline` | List of `(name, component)` tuples describing the current processing pipeline, in order. ~~List[Tuple[str, Callable[[Doc], Doc]]]~~ | -| `pipe_names` 2 | List of pipeline component names, in order. ~~List[str]~~ | -| `pipe_labels` 2.2 | List of labels set by the pipeline components, if available, keyed by component name. ~~Dict[str, List[str]]~~ | -| `pipe_factories` 2.2 | Dictionary of pipeline component names, mapped to their factory names. ~~Dict[str, str]~~ | -| `factories` | All available factory functions, keyed by name. ~~Dict[str, Callable[[...], Callable[[Doc], Doc]]]~~ | -| `factory_names` 3 | List of all available factory names. ~~List[str]~~ | -| `components` 3 | List of all available `(name, component)` tuples, including components that are currently disabled. ~~List[Tuple[str, Callable[[Doc], Doc]]]~~ | -| `component_names` 3 | List of all available component names, including components that are currently disabled. ~~List[str]~~ | -| `disabled` 3 | Names of components that are currently disabled and don't run as part of the pipeline. ~~List[str]~~ | -| `path` 2 | Path to the pipeline data directory, if a pipeline is loaded from a path or package. Otherwise `None`. ~~Optional[Path]~~ | +| Name | Description | +| -------------------------------------------- | ---------------------------------------------------------------------------------------------------------------------------------------------- | +| `vocab` | A container for the lexical types. ~~Vocab~~ | +| `tokenizer` | The tokenizer. ~~Tokenizer~~ | +| `make_doc` | Callable that takes a string and returns a `Doc`. ~~Callable[[str], Doc]~~ | +| `pipeline` | List of `(name, component)` tuples describing the current processing pipeline, in order. ~~List[Tuple[str, Callable[[Doc], Doc]]]~~ | +| `pipe_names` | List of pipeline component names, in order. ~~List[str]~~ | +| `pipe_labels` | List of labels set by the pipeline components, if available, keyed by component name. ~~Dict[str, List[str]]~~ | +| `pipe_factories` | Dictionary of pipeline component names, mapped to their factory names. ~~Dict[str, str]~~ | +| `factories` | All available factory functions, keyed by name. ~~Dict[str, Callable[[...], Callable[[Doc], Doc]]]~~ | +| `factory_names` 3 | List of all available factory names. ~~List[str]~~ | +| `components` 3 | List of all available `(name, component)` tuples, including components that are currently disabled. ~~List[Tuple[str, Callable[[Doc], Doc]]]~~ | +| `component_names` 3 | List of all available component names, including components that are currently disabled. ~~List[str]~~ | +| `disabled` 3 | Names of components that are currently disabled and don't run as part of the pipeline. ~~List[str]~~ | +| `path` | Path to the pipeline data directory, if a pipeline is loaded from a path or package. Otherwise `None`. ~~Optional[Path]~~ | ## Class attributes {#class-attributes} diff --git a/website/docs/api/lexeme.md b/website/docs/api/lexeme.md index c5d4b7544..eb76afa90 100644 --- a/website/docs/api/lexeme.md +++ b/website/docs/api/lexeme.md @@ -121,44 +121,44 @@ The L2 norm of the lexeme's vector representation. ## Attributes {#attributes} -| Name | Description | -| -------------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `vocab` | The lexeme's vocabulary. ~~Vocab~~ | -| `text` | Verbatim text content. ~~str~~ | -| `orth` | ID of the verbatim text content. ~~int~~ | -| `orth_` | Verbatim text content (identical to `Lexeme.text`). Exists mostly for consistency with the other attributes. ~~str~~ | -| `rank` | Sequential ID of the lexeme's lexical type, used to index into tables, e.g. for word vectors. ~~int~~ | -| `flags` | Container of the lexeme's binary flags. ~~int~~ | -| `norm` | The lexeme's norm, i.e. a normalized form of the lexeme text. ~~int~~ | -| `norm_` | The lexeme's norm, i.e. a normalized form of the lexeme text. ~~str~~ | -| `lower` | Lowercase form of the word. ~~int~~ | -| `lower_` | Lowercase form of the word. ~~str~~ | -| `shape` | Transform of the word's string, to show orthographic features. Alphabetic characters are replaced by `x` or `X`, and numeric characters are replaced by `d`, and sequences of the same character are truncated after length 4. For example,`"Xxxx"`or`"dd"`. ~~int~~ | -| `shape_` | Transform of the word's string, to show orthographic features. Alphabetic characters are replaced by `x` or `X`, and numeric characters are replaced by `d`, and sequences of the same character are truncated after length 4. For example,`"Xxxx"`or`"dd"`. ~~str~~ | -| `prefix` | Length-N substring from the start of the word. Defaults to `N=1`. ~~int~~ | -| `prefix_` | Length-N substring from the start of the word. Defaults to `N=1`. ~~str~~ | -| `suffix` | Length-N substring from the end of the word. Defaults to `N=3`. ~~int~~ | -| `suffix_` | Length-N substring from the start of the word. Defaults to `N=3`. ~~str~~ | -| `is_alpha` | Does the lexeme consist of alphabetic characters? Equivalent to `lexeme.text.isalpha()`. ~~bool~~ | -| `is_ascii` | Does the lexeme consist of ASCII characters? Equivalent to `[any(ord(c) >= 128 for c in lexeme.text)]`. ~~bool~~ | -| `is_digit` | Does the lexeme consist of digits? Equivalent to `lexeme.text.isdigit()`. ~~bool~~ | -| `is_lower` | Is the lexeme in lowercase? Equivalent to `lexeme.text.islower()`. ~~bool~~ | -| `is_upper` | Is the lexeme in uppercase? Equivalent to `lexeme.text.isupper()`. ~~bool~~ | -| `is_title` | Is the lexeme in titlecase? Equivalent to `lexeme.text.istitle()`. ~~bool~~ | -| `is_punct` | Is the lexeme punctuation? ~~bool~~ | -| `is_left_punct` | Is the lexeme a left punctuation mark, e.g. `(`? ~~bool~~ | -| `is_right_punct` | Is the lexeme a right punctuation mark, e.g. `)`? ~~bool~~ | -| `is_space` | Does the lexeme consist of whitespace characters? Equivalent to `lexeme.text.isspace()`. ~~bool~~ | -| `is_bracket` | Is the lexeme a bracket? ~~bool~~ | -| `is_quote` | Is the lexeme a quotation mark? ~~bool~~ | -| `is_currency` 2.0.8 | Is the lexeme a currency symbol? ~~bool~~ | -| `like_url` | Does the lexeme resemble a URL? ~~bool~~ | -| `like_num` | Does the lexeme represent a number? e.g. "10.9", "10", "ten", etc. ~~bool~~ | -| `like_email` | Does the lexeme resemble an email address? ~~bool~~ | -| `is_oov` | Is the lexeme out-of-vocabulary (i.e. does it not have a word vector)? ~~bool~~ | -| `is_stop` | Is the lexeme part of a "stop list"? ~~bool~~ | -| `lang` | Language of the parent vocabulary. ~~int~~ | -| `lang_` | Language of the parent vocabulary. ~~str~~ | -| `prob` | Smoothed log probability estimate of the lexeme's word type (context-independent entry in the vocabulary). ~~float~~ | -| `cluster` | Brown cluster ID. ~~int~~ | -| `sentiment` | A scalar value indicating the positivity or negativity of the lexeme. ~~float~~ | +| Name | Description | +| ---------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `vocab` | The lexeme's vocabulary. ~~Vocab~~ | +| `text` | Verbatim text content. ~~str~~ | +| `orth` | ID of the verbatim text content. ~~int~~ | +| `orth_` | Verbatim text content (identical to `Lexeme.text`). Exists mostly for consistency with the other attributes. ~~str~~ | +| `rank` | Sequential ID of the lexeme's lexical type, used to index into tables, e.g. for word vectors. ~~int~~ | +| `flags` | Container of the lexeme's binary flags. ~~int~~ | +| `norm` | The lexeme's norm, i.e. a normalized form of the lexeme text. ~~int~~ | +| `norm_` | The lexeme's norm, i.e. a normalized form of the lexeme text. ~~str~~ | +| `lower` | Lowercase form of the word. ~~int~~ | +| `lower_` | Lowercase form of the word. ~~str~~ | +| `shape` | Transform of the word's string, to show orthographic features. Alphabetic characters are replaced by `x` or `X`, and numeric characters are replaced by `d`, and sequences of the same character are truncated after length 4. For example,`"Xxxx"`or`"dd"`. ~~int~~ | +| `shape_` | Transform of the word's string, to show orthographic features. Alphabetic characters are replaced by `x` or `X`, and numeric characters are replaced by `d`, and sequences of the same character are truncated after length 4. For example,`"Xxxx"`or`"dd"`. ~~str~~ | +| `prefix` | Length-N substring from the start of the word. Defaults to `N=1`. ~~int~~ | +| `prefix_` | Length-N substring from the start of the word. Defaults to `N=1`. ~~str~~ | +| `suffix` | Length-N substring from the end of the word. Defaults to `N=3`. ~~int~~ | +| `suffix_` | Length-N substring from the start of the word. Defaults to `N=3`. ~~str~~ | +| `is_alpha` | Does the lexeme consist of alphabetic characters? Equivalent to `lexeme.text.isalpha()`. ~~bool~~ | +| `is_ascii` | Does the lexeme consist of ASCII characters? Equivalent to `[any(ord(c) >= 128 for c in lexeme.text)]`. ~~bool~~ | +| `is_digit` | Does the lexeme consist of digits? Equivalent to `lexeme.text.isdigit()`. ~~bool~~ | +| `is_lower` | Is the lexeme in lowercase? Equivalent to `lexeme.text.islower()`. ~~bool~~ | +| `is_upper` | Is the lexeme in uppercase? Equivalent to `lexeme.text.isupper()`. ~~bool~~ | +| `is_title` | Is the lexeme in titlecase? Equivalent to `lexeme.text.istitle()`. ~~bool~~ | +| `is_punct` | Is the lexeme punctuation? ~~bool~~ | +| `is_left_punct` | Is the lexeme a left punctuation mark, e.g. `(`? ~~bool~~ | +| `is_right_punct` | Is the lexeme a right punctuation mark, e.g. `)`? ~~bool~~ | +| `is_space` | Does the lexeme consist of whitespace characters? Equivalent to `lexeme.text.isspace()`. ~~bool~~ | +| `is_bracket` | Is the lexeme a bracket? ~~bool~~ | +| `is_quote` | Is the lexeme a quotation mark? ~~bool~~ | +| `is_currency` | Is the lexeme a currency symbol? ~~bool~~ | +| `like_url` | Does the lexeme resemble a URL? ~~bool~~ | +| `like_num` | Does the lexeme represent a number? e.g. "10.9", "10", "ten", etc. ~~bool~~ | +| `like_email` | Does the lexeme resemble an email address? ~~bool~~ | +| `is_oov` | Is the lexeme out-of-vocabulary (i.e. does it not have a word vector)? ~~bool~~ | +| `is_stop` | Is the lexeme part of a "stop list"? ~~bool~~ | +| `lang` | Language of the parent vocabulary. ~~int~~ | +| `lang_` | Language of the parent vocabulary. ~~str~~ | +| `prob` | Smoothed log probability estimate of the lexeme's word type (context-independent entry in the vocabulary). ~~float~~ | +| `cluster` | Brown cluster ID. ~~int~~ | +| `sentiment` | A scalar value indicating the positivity or negativity of the lexeme. ~~float~~ | diff --git a/website/docs/api/matcher.md b/website/docs/api/matcher.md index 8cc446c6a..cd7bfa070 100644 --- a/website/docs/api/matcher.md +++ b/website/docs/api/matcher.md @@ -33,7 +33,7 @@ rule-based matching are: | Attribute | Description | | ---------------------------------------------- | ------------------------------------------------------------------------------------------------------------------------- | | `ORTH` | The exact verbatim text of a token. ~~str~~ | -| `TEXT` 2.1 | The exact verbatim text of a token. ~~str~~ | +| `TEXT` | The exact verbatim text of a token. ~~str~~ | | `NORM` | The normalized form of the token text. ~~str~~ | | `LOWER` | The lowercase form of the token text. ~~str~~ | | `LENGTH` | The length of the token text. ~~int~~ | @@ -48,7 +48,7 @@ rule-based matching are: | `ENT_IOB` | The IOB part of the token's entity tag. ~~str~~ | | `ENT_ID` | The token's entity ID (`ent_id`). ~~str~~ | | `ENT_KB_ID` | The token's entity knowledge base ID (`ent_kb_id`). ~~str~~ | -| `_` 2.1 | Properties in [custom extension attributes](/usage/processing-pipelines#custom-components-attributes). ~~Dict[str, Any]~~ | +| `_` | Properties in [custom extension attributes](/usage/processing-pipelines#custom-components-attributes). ~~Dict[str, Any]~~ | | `OP` | Operator or quantifier to determine how often to match a token pattern. ~~str~~ | Operators and quantifiers define **how often** a token pattern should be @@ -64,7 +64,7 @@ matched: > ``` | OP | Description | -|---------|------------------------------------------------------------------------| +| ------- | ---------------------------------------------------------------------- | | `!` | Negate the pattern, by requiring it to match exactly 0 times. | | `?` | Make the pattern optional, by allowing it to match 0 or 1 times. | | `+` | Require the pattern to match 1 or more times. | @@ -109,10 +109,10 @@ string where an integer is expected) or unexpected property names. > matcher = Matcher(nlp.vocab) > ``` -| Name | Description | -| --------------------------------------- | ----------------------------------------------------------------------------------------------------- | -| `vocab` | The vocabulary object, which must be shared with the documents the matcher will operate on. ~~Vocab~~ | -| `validate` 2.1 | Validate all patterns added to this matcher. ~~bool~~ | +| Name | Description | +| ---------- | ----------------------------------------------------------------------------------------------------- | +| `vocab` | The vocabulary object, which must be shared with the documents the matcher will operate on. ~~Vocab~~ | +| `validate` | Validate all patterns added to this matcher. ~~bool~~ | ## Matcher.\_\_call\_\_ {#call tag="method"} diff --git a/website/docs/api/phrasematcher.md b/website/docs/api/phrasematcher.md index 2cef9ac2a..cd419ae5c 100644 --- a/website/docs/api/phrasematcher.md +++ b/website/docs/api/phrasematcher.md @@ -36,11 +36,11 @@ be shown. > matcher = PhraseMatcher(nlp.vocab) > ``` -| Name | Description | -| --------------------------------------- | ------------------------------------------------------------------------------------------------------ | -| `vocab` | The vocabulary object, which must be shared with the documents the matcher will operate on. ~~Vocab~~ | -| `attr` 2.1 | The token attribute to match on. Defaults to `ORTH`, i.e. the verbatim token text. ~~Union[int, str]~~ | -| `validate` 2.1 | Validate patterns added to the matcher. ~~bool~~ | +| Name | Description | +| ---------- | ------------------------------------------------------------------------------------------------------ | +| `vocab` | The vocabulary object, which must be shared with the documents the matcher will operate on. ~~Vocab~~ | +| `attr` | The token attribute to match on. Defaults to `ORTH`, i.e. the verbatim token text. ~~Union[int, str]~~ | +| `validate` | Validate patterns added to the matcher. ~~bool~~ | ## PhraseMatcher.\_\_call\_\_ {#call tag="method"} diff --git a/website/docs/api/span.md b/website/docs/api/span.md index 89f608994..69bbe8db1 100644 --- a/website/docs/api/span.md +++ b/website/docs/api/span.md @@ -186,14 +186,14 @@ the character indices don't map to a valid span. > assert span.text == "New York" > ``` -| Name | Description | -| ------------------------------------ | ----------------------------------------------------------------------------------------- | -| `start` | The index of the first character of the span. ~~int~~ | -| `end` | The index of the last character after the span. ~~int~~ | -| `label` | A label to attach to the span, e.g. for named entities. ~~Union[int, str]~~ | -| `kb_id` 2.2 | An ID from a knowledge base to capture the meaning of a named entity. ~~Union[int, str]~~ | -| `vector` | A meaning representation of the span. ~~numpy.ndarray[ndim=1, dtype=float32]~~ | -| **RETURNS** | The newly constructed object or `None`. ~~Optional[Span]~~ | +| Name | Description | +| ----------- | ----------------------------------------------------------------------------------------- | +| `start` | The index of the first character of the span. ~~int~~ | +| `end` | The index of the last character after the span. ~~int~~ | +| `label` | A label to attach to the span, e.g. for named entities. ~~Union[int, str]~~ | +| `kb_id` | An ID from a knowledge base to capture the meaning of a named entity. ~~Union[int, str]~~ | +| `vector` | A meaning representation of the span. ~~numpy.ndarray[ndim=1, dtype=float32]~~ | +| **RETURNS** | The newly constructed object or `None`. ~~Optional[Span]~~ | ## Span.similarity {#similarity tag="method" model="vectors"} @@ -544,26 +544,26 @@ overlaps with will be returned. ## Attributes {#attributes} -| Name | Description | -| --------------------------------------- | ----------------------------------------------------------------------------------------------------------------------------- | -| `doc` | The parent document. ~~Doc~~ | -| `tensor` 2.1.7 | The span's slice of the parent `Doc`'s tensor. ~~numpy.ndarray~~ | -| `start` | The token offset for the start of the span. ~~int~~ | -| `end` | The token offset for the end of the span. ~~int~~ | -| `start_char` | The character offset for the start of the span. ~~int~~ | -| `end_char` | The character offset for the end of the span. ~~int~~ | -| `text` | A string representation of the span text. ~~str~~ | -| `text_with_ws` | The text content of the span with a trailing whitespace character if the last token has one. ~~str~~ | -| `orth` | ID of the verbatim text content. ~~int~~ | -| `orth_` | Verbatim text content (identical to `Span.text`). Exists mostly for consistency with the other attributes. ~~str~~ | -| `label` | The hash value of the span's label. ~~int~~ | -| `label_` | The span's label. ~~str~~ | -| `lemma_` | The span's lemma. Equivalent to `"".join(token.text_with_ws for token in span)`. ~~str~~ | -| `kb_id` | The hash value of the knowledge base ID referred to by the span. ~~int~~ | -| `kb_id_` | The knowledge base ID referred to by the span. ~~str~~ | -| `ent_id` | The hash value of the named entity the root token is an instance of. ~~int~~ | -| `ent_id_` | The string ID of the named entity the root token is an instance of. ~~str~~ | -| `id` | The hash value of the span's ID. ~~int~~ | -| `id_` | The span's ID. ~~str~~ | -| `sentiment` | A scalar value indicating the positivity or negativity of the span. ~~float~~ | -| `_` | User space for adding custom [attribute extensions](/usage/processing-pipelines#custom-components-attributes). ~~Underscore~~ | +| Name | Description | +| -------------- | ----------------------------------------------------------------------------------------------------------------------------- | +| `doc` | The parent document. ~~Doc~~ | +| `tensor` | The span's slice of the parent `Doc`'s tensor. ~~numpy.ndarray~~ | +| `start` | The token offset for the start of the span. ~~int~~ | +| `end` | The token offset for the end of the span. ~~int~~ | +| `start_char` | The character offset for the start of the span. ~~int~~ | +| `end_char` | The character offset for the end of the span. ~~int~~ | +| `text` | A string representation of the span text. ~~str~~ | +| `text_with_ws` | The text content of the span with a trailing whitespace character if the last token has one. ~~str~~ | +| `orth` | ID of the verbatim text content. ~~int~~ | +| `orth_` | Verbatim text content (identical to `Span.text`). Exists mostly for consistency with the other attributes. ~~str~~ | +| `label` | The hash value of the span's label. ~~int~~ | +| `label_` | The span's label. ~~str~~ | +| `lemma_` | The span's lemma. Equivalent to `"".join(token.text_with_ws for token in span)`. ~~str~~ | +| `kb_id` | The hash value of the knowledge base ID referred to by the span. ~~int~~ | +| `kb_id_` | The knowledge base ID referred to by the span. ~~str~~ | +| `ent_id` | The hash value of the named entity the root token is an instance of. ~~int~~ | +| `ent_id_` | The string ID of the named entity the root token is an instance of. ~~str~~ | +| `id` | The hash value of the span's ID. ~~int~~ | +| `id_` | The span's ID. ~~str~~ | +| `sentiment` | A scalar value indicating the positivity or negativity of the span. ~~float~~ | +| `_` | User space for adding custom [attribute extensions](/usage/processing-pipelines#custom-components-attributes). ~~Underscore~~ | diff --git a/website/docs/api/token.md b/website/docs/api/token.md index d43cd3ff1..89bd77447 100644 --- a/website/docs/api/token.md +++ b/website/docs/api/token.md @@ -403,75 +403,75 @@ The L2 norm of the token's vector representation. ## Attributes {#attributes} -| Name | Description | -| -------------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `doc` | The parent document. ~~Doc~~ | -| `lex` 3 | The underlying lexeme. ~~Lexeme~~ | -| `sent` 2.0.12 | The sentence span that this token is a part of. ~~Span~~ | -| `text` | Verbatim text content. ~~str~~ | -| `text_with_ws` | Text content, with trailing space character if present. ~~str~~ | -| `whitespace_` | Trailing space character if present. ~~str~~ | -| `orth` | ID of the verbatim text content. ~~int~~ | -| `orth_` | Verbatim text content (identical to `Token.text`). Exists mostly for consistency with the other attributes. ~~str~~ | -| `vocab` | The vocab object of the parent `Doc`. ~~vocab~~ | -| `tensor` 2.1.7 | The token's slice of the parent `Doc`'s tensor. ~~numpy.ndarray~~ | -| `head` | The syntactic parent, or "governor", of this token. ~~Token~~ | -| `left_edge` | The leftmost token of this token's syntactic descendants. ~~Token~~ | -| `right_edge` | The rightmost token of this token's syntactic descendants. ~~Token~~ | -| `i` | The index of the token within the parent document. ~~int~~ | -| `ent_type` | Named entity type. ~~int~~ | -| `ent_type_` | Named entity type. ~~str~~ | -| `ent_iob` | IOB code of named entity tag. `3` means the token begins an entity, `2` means it is outside an entity, `1` means it is inside an entity, and `0` means no entity tag is set. ~~int~~ | -| `ent_iob_` | IOB code of named entity tag. "B" means the token begins an entity, "I" means it is inside an entity, "O" means it is outside an entity, and "" means no entity tag is set. ~~str~~ | -| `ent_kb_id` 2.2 | Knowledge base ID that refers to the named entity this token is a part of, if any. ~~int~~ | -| `ent_kb_id_` 2.2 | Knowledge base ID that refers to the named entity this token is a part of, if any. ~~str~~ | -| `ent_id` | ID of the entity the token is an instance of, if any. Currently not used, but potentially for coreference resolution. ~~int~~ | -| `ent_id_` | ID of the entity the token is an instance of, if any. Currently not used, but potentially for coreference resolution. ~~str~~ | -| `lemma` | Base form of the token, with no inflectional suffixes. ~~int~~ | -| `lemma_` | Base form of the token, with no inflectional suffixes. ~~str~~ | -| `norm` | The token's norm, i.e. a normalized form of the token text. Can be set in the language's [tokenizer exceptions](/usage/linguistic-features#language-data). ~~int~~ | -| `norm_` | The token's norm, i.e. a normalized form of the token text. Can be set in the language's [tokenizer exceptions](/usage/linguistic-features#language-data). ~~str~~ | -| `lower` | Lowercase form of the token. ~~int~~ | -| `lower_` | Lowercase form of the token text. Equivalent to `Token.text.lower()`. ~~str~~ | -| `shape` | Transform of the token's string to show orthographic features. Alphabetic characters are replaced by `x` or `X`, and numeric characters are replaced by `d`, and sequences of the same character are truncated after length 4. For example,`"Xxxx"`or`"dd"`. ~~int~~ | -| `shape_` | Transform of the token's string to show orthographic features. Alphabetic characters are replaced by `x` or `X`, and numeric characters are replaced by `d`, and sequences of the same character are truncated after length 4. For example,`"Xxxx"`or`"dd"`. ~~str~~ | -| `prefix` | Hash value of a length-N substring from the start of the token. Defaults to `N=1`. ~~int~~ | -| `prefix_` | A length-N substring from the start of the token. Defaults to `N=1`. ~~str~~ | -| `suffix` | Hash value of a length-N substring from the end of the token. Defaults to `N=3`. ~~int~~ | -| `suffix_` | Length-N substring from the end of the token. Defaults to `N=3`. ~~str~~ | -| `is_alpha` | Does the token consist of alphabetic characters? Equivalent to `token.text.isalpha()`. ~~bool~~ | -| `is_ascii` | Does the token consist of ASCII characters? Equivalent to `all(ord(c) < 128 for c in token.text)`. ~~bool~~ | -| `is_digit` | Does the token consist of digits? Equivalent to `token.text.isdigit()`. ~~bool~~ | -| `is_lower` | Is the token in lowercase? Equivalent to `token.text.islower()`. ~~bool~~ | -| `is_upper` | Is the token in uppercase? Equivalent to `token.text.isupper()`. ~~bool~~ | -| `is_title` | Is the token in titlecase? Equivalent to `token.text.istitle()`. ~~bool~~ | -| `is_punct` | Is the token punctuation? ~~bool~~ | -| `is_left_punct` | Is the token a left punctuation mark, e.g. `"("` ? ~~bool~~ | -| `is_right_punct` | Is the token a right punctuation mark, e.g. `")"` ? ~~bool~~ | -| `is_sent_start` | Does the token start a sentence? ~~bool~~ or `None` if unknown. Defaults to `True` for the first token in the `Doc`. | -| `is_sent_end` | Does the token end a sentence? ~~bool~~ or `None` if unknown. | -| `is_space` | Does the token consist of whitespace characters? Equivalent to `token.text.isspace()`. ~~bool~~ | -| `is_bracket` | Is the token a bracket? ~~bool~~ | -| `is_quote` | Is the token a quotation mark? ~~bool~~ | -| `is_currency` 2.0.8 | Is the token a currency symbol? ~~bool~~ | -| `like_url` | Does the token resemble a URL? ~~bool~~ | -| `like_num` | Does the token represent a number? e.g. "10.9", "10", "ten", etc. ~~bool~~ | -| `like_email` | Does the token resemble an email address? ~~bool~~ | -| `is_oov` | Is the token out-of-vocabulary (i.e. does it not have a word vector)? ~~bool~~ | -| `is_stop` | Is the token part of a "stop list"? ~~bool~~ | -| `pos` | Coarse-grained part-of-speech from the [Universal POS tag set](https://universaldependencies.org/u/pos/). ~~int~~ | -| `pos_` | Coarse-grained part-of-speech from the [Universal POS tag set](https://universaldependencies.org/u/pos/). ~~str~~ | -| `tag` | Fine-grained part-of-speech. ~~int~~ | -| `tag_` | Fine-grained part-of-speech. ~~str~~ | -| `morph` 3 | Morphological analysis. ~~MorphAnalysis~~ | -| `dep` | Syntactic dependency relation. ~~int~~ | -| `dep_` | Syntactic dependency relation. ~~str~~ | -| `lang` | Language of the parent document's vocabulary. ~~int~~ | -| `lang_` | Language of the parent document's vocabulary. ~~str~~ | -| `prob` | Smoothed log probability estimate of token's word type (context-independent entry in the vocabulary). ~~float~~ | -| `idx` | The character offset of the token within the parent document. ~~int~~ | -| `sentiment` | A scalar value indicating the positivity or negativity of the token. ~~float~~ | -| `lex_id` | Sequential ID of the token's lexical type, used to index into tables, e.g. for word vectors. ~~int~~ | -| `rank` | Sequential ID of the token's lexical type, used to index into tables, e.g. for word vectors. ~~int~~ | -| `cluster` | Brown cluster ID. ~~int~~ | -| `_` | User space for adding custom [attribute extensions](/usage/processing-pipelines#custom-components-attributes). ~~Underscore~~ | +| Name | Description | +| ---------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `doc` | The parent document. ~~Doc~~ | +| `lex` 3 | The underlying lexeme. ~~Lexeme~~ | +| `sent` | The sentence span that this token is a part of. ~~Span~~ | +| `text` | Verbatim text content. ~~str~~ | +| `text_with_ws` | Text content, with trailing space character if present. ~~str~~ | +| `whitespace_` | Trailing space character if present. ~~str~~ | +| `orth` | ID of the verbatim text content. ~~int~~ | +| `orth_` | Verbatim text content (identical to `Token.text`). Exists mostly for consistency with the other attributes. ~~str~~ | +| `vocab` | The vocab object of the parent `Doc`. ~~vocab~~ | +| `tensor` | The token's slice of the parent `Doc`'s tensor. ~~numpy.ndarray~~ | +| `head` | The syntactic parent, or "governor", of this token. ~~Token~~ | +| `left_edge` | The leftmost token of this token's syntactic descendants. ~~Token~~ | +| `right_edge` | The rightmost token of this token's syntactic descendants. ~~Token~~ | +| `i` | The index of the token within the parent document. ~~int~~ | +| `ent_type` | Named entity type. ~~int~~ | +| `ent_type_` | Named entity type. ~~str~~ | +| `ent_iob` | IOB code of named entity tag. `3` means the token begins an entity, `2` means it is outside an entity, `1` means it is inside an entity, and `0` means no entity tag is set. ~~int~~ | +| `ent_iob_` | IOB code of named entity tag. "B" means the token begins an entity, "I" means it is inside an entity, "O" means it is outside an entity, and "" means no entity tag is set. ~~str~~ | +| `ent_kb_id` | Knowledge base ID that refers to the named entity this token is a part of, if any. ~~int~~ | +| `ent_kb_id_` | Knowledge base ID that refers to the named entity this token is a part of, if any. ~~str~~ | +| `ent_id` | ID of the entity the token is an instance of, if any. Currently not used, but potentially for coreference resolution. ~~int~~ | +| `ent_id_` | ID of the entity the token is an instance of, if any. Currently not used, but potentially for coreference resolution. ~~str~~ | +| `lemma` | Base form of the token, with no inflectional suffixes. ~~int~~ | +| `lemma_` | Base form of the token, with no inflectional suffixes. ~~str~~ | +| `norm` | The token's norm, i.e. a normalized form of the token text. Can be set in the language's [tokenizer exceptions](/usage/linguistic-features#language-data). ~~int~~ | +| `norm_` | The token's norm, i.e. a normalized form of the token text. Can be set in the language's [tokenizer exceptions](/usage/linguistic-features#language-data). ~~str~~ | +| `lower` | Lowercase form of the token. ~~int~~ | +| `lower_` | Lowercase form of the token text. Equivalent to `Token.text.lower()`. ~~str~~ | +| `shape` | Transform of the token's string to show orthographic features. Alphabetic characters are replaced by `x` or `X`, and numeric characters are replaced by `d`, and sequences of the same character are truncated after length 4. For example,`"Xxxx"`or`"dd"`. ~~int~~ | +| `shape_` | Transform of the token's string to show orthographic features. Alphabetic characters are replaced by `x` or `X`, and numeric characters are replaced by `d`, and sequences of the same character are truncated after length 4. For example,`"Xxxx"`or`"dd"`. ~~str~~ | +| `prefix` | Hash value of a length-N substring from the start of the token. Defaults to `N=1`. ~~int~~ | +| `prefix_` | A length-N substring from the start of the token. Defaults to `N=1`. ~~str~~ | +| `suffix` | Hash value of a length-N substring from the end of the token. Defaults to `N=3`. ~~int~~ | +| `suffix_` | Length-N substring from the end of the token. Defaults to `N=3`. ~~str~~ | +| `is_alpha` | Does the token consist of alphabetic characters? Equivalent to `token.text.isalpha()`. ~~bool~~ | +| `is_ascii` | Does the token consist of ASCII characters? Equivalent to `all(ord(c) < 128 for c in token.text)`. ~~bool~~ | +| `is_digit` | Does the token consist of digits? Equivalent to `token.text.isdigit()`. ~~bool~~ | +| `is_lower` | Is the token in lowercase? Equivalent to `token.text.islower()`. ~~bool~~ | +| `is_upper` | Is the token in uppercase? Equivalent to `token.text.isupper()`. ~~bool~~ | +| `is_title` | Is the token in titlecase? Equivalent to `token.text.istitle()`. ~~bool~~ | +| `is_punct` | Is the token punctuation? ~~bool~~ | +| `is_left_punct` | Is the token a left punctuation mark, e.g. `"("` ? ~~bool~~ | +| `is_right_punct` | Is the token a right punctuation mark, e.g. `")"` ? ~~bool~~ | +| `is_sent_start` | Does the token start a sentence? ~~bool~~ or `None` if unknown. Defaults to `True` for the first token in the `Doc`. | +| `is_sent_end` | Does the token end a sentence? ~~bool~~ or `None` if unknown. | +| `is_space` | Does the token consist of whitespace characters? Equivalent to `token.text.isspace()`. ~~bool~~ | +| `is_bracket` | Is the token a bracket? ~~bool~~ | +| `is_quote` | Is the token a quotation mark? ~~bool~~ | +| `is_currency` | Is the token a currency symbol? ~~bool~~ | +| `like_url` | Does the token resemble a URL? ~~bool~~ | +| `like_num` | Does the token represent a number? e.g. "10.9", "10", "ten", etc. ~~bool~~ | +| `like_email` | Does the token resemble an email address? ~~bool~~ | +| `is_oov` | Is the token out-of-vocabulary (i.e. does it not have a word vector)? ~~bool~~ | +| `is_stop` | Is the token part of a "stop list"? ~~bool~~ | +| `pos` | Coarse-grained part-of-speech from the [Universal POS tag set](https://universaldependencies.org/u/pos/). ~~int~~ | +| `pos_` | Coarse-grained part-of-speech from the [Universal POS tag set](https://universaldependencies.org/u/pos/). ~~str~~ | +| `tag` | Fine-grained part-of-speech. ~~int~~ | +| `tag_` | Fine-grained part-of-speech. ~~str~~ | +| `morph` 3 | Morphological analysis. ~~MorphAnalysis~~ | +| `dep` | Syntactic dependency relation. ~~int~~ | +| `dep_` | Syntactic dependency relation. ~~str~~ | +| `lang` | Language of the parent document's vocabulary. ~~int~~ | +| `lang_` | Language of the parent document's vocabulary. ~~str~~ | +| `prob` | Smoothed log probability estimate of token's word type (context-independent entry in the vocabulary). ~~float~~ | +| `idx` | The character offset of the token within the parent document. ~~int~~ | +| `sentiment` | A scalar value indicating the positivity or negativity of the token. ~~float~~ | +| `lex_id` | Sequential ID of the token's lexical type, used to index into tables, e.g. for word vectors. ~~int~~ | +| `rank` | Sequential ID of the token's lexical type, used to index into tables, e.g. for word vectors. ~~int~~ | +| `cluster` | Brown cluster ID. ~~int~~ | +| `_` | User space for adding custom [attribute extensions](/usage/processing-pipelines#custom-components-attributes). ~~Underscore~~ | diff --git a/website/docs/api/top-level.md b/website/docs/api/top-level.md index c798f2a8d..211affa4a 100644 --- a/website/docs/api/top-level.md +++ b/website/docs/api/top-level.md @@ -45,16 +45,16 @@ specified separately using the new `exclude` keyword argument. > nlp = spacy.load("en_core_web_sm", exclude=["parser", "tagger"]) > ``` -| Name | Description | -| ------------------------------------- | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `name` | Pipeline to load, i.e. package name or path. ~~Union[str, Path]~~ | -| _keyword-only_ | | -| `vocab` | Optional shared vocab to pass in on initialization. If `True` (default), a new `Vocab` object will be created. ~~Union[Vocab, bool]~~ | +| Name | Description | +| ------------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | +| `name` | Pipeline to load, i.e. package name or path. ~~Union[str, Path]~~ | +| _keyword-only_ | | +| `vocab` | Optional shared vocab to pass in on initialization. If `True` (default), a new `Vocab` object will be created. ~~Union[Vocab, bool]~~ | | `disable` | Name(s) of pipeline component(s) to [disable](/usage/processing-pipelines#disabling). Disabled pipes will be loaded but they won't be run unless you explicitly enable them by calling [nlp.enable_pipe](/api/language#enable_pipe). Is merged with the config entry `nlp.disabled`. ~~Union[str, Iterable[str]]~~ | -| `enable` 3.4 | Name(s) of pipeline component(s) to [enable](/usage/processing-pipelines#disabling). All other pipes will be disabled. ~~Union[str, Iterable[str]]~~ | -| `exclude` 3 | Name(s) of pipeline component(s) to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~Union[str, Iterable[str]]~~ | -| `config` 3 | Optional config overrides, either as nested dict or dict keyed by section value in dot notation, e.g. `"components.name.value"`. ~~Union[Dict[str, Any], Config]~~ | -| **RETURNS** | A `Language` object with the loaded pipeline. ~~Language~~ | +| `enable` 3.4 | Name(s) of pipeline component(s) to [enable](/usage/processing-pipelines#disabling). All other pipes will be disabled. ~~Union[str, Iterable[str]]~~ | +| `exclude` 3 | Name(s) of pipeline component(s) to [exclude](/usage/processing-pipelines#disabling). Excluded components won't be loaded. ~~Union[str, Iterable[str]]~~ | +| `config` 3 | Optional config overrides, either as nested dict or dict keyed by section value in dot notation, e.g. `"components.name.value"`. ~~Union[Dict[str, Any], Config]~~ | +| **RETURNS** | A `Language` object with the loaded pipeline. ~~Language~~ | Essentially, `spacy.load()` is a convenience wrapper that reads the pipeline's [`config.cfg`](/api/data-formats#config), uses the language and pipeline @@ -354,22 +354,22 @@ If a setting is not present in the options, the default value will be used. > displacy.serve(doc, style="dep", options=options) > ``` -| Name | Description | -| ------------------------------------------ | -------------------------------------------------------------------------------------------------------------------------------------------- | -| `fine_grained` | Use fine-grained part-of-speech tags (`Token.tag_`) instead of coarse-grained tags (`Token.pos_`). Defaults to `False`. ~~bool~~ | -| `add_lemma` 2.2.4 | Print the lemmas in a separate row below the token texts. Defaults to `False`. ~~bool~~ | -| `collapse_punct` | Attach punctuation to tokens. Can make the parse more readable, as it prevents long arcs to attach punctuation. Defaults to `True`. ~~bool~~ | -| `collapse_phrases` | Merge noun phrases into one token. Defaults to `False`. ~~bool~~ | -| `compact` | "Compact mode" with square arrows that takes up less space. Defaults to `False`. ~~bool~~ | -| `color` | Text color (HEX, RGB or color names). Defaults to `"#000000"`. ~~str~~ | -| `bg` | Background color (HEX, RGB or color names). Defaults to `"#ffffff"`. ~~str~~ | -| `font` | Font name or font family for all text. Defaults to `"Arial"`. ~~str~~ | -| `offset_x` | Spacing on left side of the SVG in px. Defaults to `50`. ~~int~~ | -| `arrow_stroke` | Width of arrow path in px. Defaults to `2`. ~~int~~ | -| `arrow_width` | Width of arrow head in px. Defaults to `10` in regular mode and `8` in compact mode. ~~int~~ | -| `arrow_spacing` | Spacing between arrows in px to avoid overlaps. Defaults to `20` in regular mode and `12` in compact mode. ~~int~~ | -| `word_spacing` | Vertical spacing between words and arcs in px. Defaults to `45`. ~~int~~ | -| `distance` | Distance between words in px. Defaults to `175` in regular mode and `150` in compact mode. ~~int~~ | +| Name | Description | +| ------------------ | -------------------------------------------------------------------------------------------------------------------------------------------- | +| `fine_grained` | Use fine-grained part-of-speech tags (`Token.tag_`) instead of coarse-grained tags (`Token.pos_`). Defaults to `False`. ~~bool~~ | +| `add_lemma` | Print the lemmas in a separate row below the token texts. Defaults to `False`. ~~bool~~ | +| `collapse_punct` | Attach punctuation to tokens. Can make the parse more readable, as it prevents long arcs to attach punctuation. Defaults to `True`. ~~bool~~ | +| `collapse_phrases` | Merge noun phrases into one token. Defaults to `False`. ~~bool~~ | +| `compact` | "Compact mode" with square arrows that takes up less space. Defaults to `False`. ~~bool~~ | +| `color` | Text color (HEX, RGB or color names). Defaults to `"#000000"`. ~~str~~ | +| `bg` | Background color (HEX, RGB or color names). Defaults to `"#ffffff"`. ~~str~~ | +| `font` | Font name or font family for all text. Defaults to `"Arial"`. ~~str~~ | +| `offset_x` | Spacing on left side of the SVG in px. Defaults to `50`. ~~int~~ | +| `arrow_stroke` | Width of arrow path in px. Defaults to `2`. ~~int~~ | +| `arrow_width` | Width of arrow head in px. Defaults to `10` in regular mode and `8` in compact mode. ~~int~~ | +| `arrow_spacing` | Spacing between arrows in px to avoid overlaps. Defaults to `20` in regular mode and `12` in compact mode. ~~int~~ | +| `word_spacing` | Vertical spacing between words and arcs in px. Defaults to `45`. ~~int~~ | +| `distance` | Distance between words in px. Defaults to `175` in regular mode and `150` in compact mode. ~~int~~ | #### Named Entity Visualizer options {#displacy_options-ent} @@ -385,7 +385,7 @@ If a setting is not present in the options, the default value will be used. | ------------------------------------------------ | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | | `ents` | Entity types to highlight or `None` for all types (default). ~~Optional[List[str]]~~ | | `colors` | Color overrides. Entity types should be mapped to color names or values. ~~Dict[str, str]~~ | -| `template` 2.2 | Optional template to overwrite the HTML used to render entity spans. Should be a format string and can use `{bg}`, `{text}` and `{label}`. See [`templates.py`](%%GITHUB_SPACY/spacy/displacy/templates.py) for examples. ~~Optional[str]~~ | +| `template` | Optional template to overwrite the HTML used to render entity spans. Should be a format string and can use `{bg}`, `{text}` and `{label}`. See [`templates.py`](%%GITHUB_SPACY/spacy/displacy/templates.py) for examples. ~~Optional[str]~~ | | `kb_url_template` 3.2.1 | Optional template to construct the KB url for the entity to link to. Expects a python f-string format with single field to fill in. ~~Optional[str]~~ | #### Span Visualizer options {#displacy_options-span} diff --git a/website/docs/api/vocab.md b/website/docs/api/vocab.md index 2e4a206ec..afbd1301d 100644 --- a/website/docs/api/vocab.md +++ b/website/docs/api/vocab.md @@ -21,15 +21,15 @@ Create the vocabulary. > vocab = Vocab(strings=["hello", "world"]) > ``` -| Name | Description | -| ------------------------------------------- | ----------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `lex_attr_getters` | A dictionary mapping attribute IDs to functions to compute them. Defaults to `None`. ~~Optional[Dict[str, Callable[[str], Any]]]~~ | -| `strings` | A [`StringStore`](/api/stringstore) that maps strings to hash values, and vice versa, or a list of strings. ~~Union[List[str], StringStore]~~ | -| `lookups` | A [`Lookups`](/api/lookups) that stores the `lexeme_norm` and other large lookup tables. Defaults to `None`. ~~Optional[Lookups]~~ | -| `oov_prob` | The default OOV probability. Defaults to `-20.0`. ~~float~~ | -| `vectors_name` 2.2 | A name to identify the vectors table. ~~str~~ | -| `writing_system` | A dictionary describing the language's writing system. Typically provided by [`Language.Defaults`](/api/language#defaults). ~~Dict[str, Any]~~ | -| `get_noun_chunks` | A function that yields base noun phrases used for [`Doc.noun_chunks`](/api/doc#noun_chunks). ~~Optional[Callable[[Union[Doc, Span], Iterator[Tuple[int, int, int]]]]]~~ | +| Name | Description | +| ------------------ | ----------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `lex_attr_getters` | A dictionary mapping attribute IDs to functions to compute them. Defaults to `None`. ~~Optional[Dict[str, Callable[[str], Any]]]~~ | +| `strings` | A [`StringStore`](/api/stringstore) that maps strings to hash values, and vice versa, or a list of strings. ~~Union[List[str], StringStore]~~ | +| `lookups` | A [`Lookups`](/api/lookups) that stores the `lexeme_norm` and other large lookup tables. Defaults to `None`. ~~Optional[Lookups]~~ | +| `oov_prob` | The default OOV probability. Defaults to `-20.0`. ~~float~~ | +| `vectors_name` | A name to identify the vectors table. ~~str~~ | +| `writing_system` | A dictionary describing the language's writing system. Typically provided by [`Language.Defaults`](/api/language#defaults). ~~Dict[str, Any]~~ | +| `get_noun_chunks` | A function that yields base noun phrases used for [`Doc.noun_chunks`](/api/doc#noun_chunks). ~~Optional[Callable[[Union[Doc, Span], Iterator[Tuple[int, int, int]]]]]~~ | ## Vocab.\_\_len\_\_ {#len tag="method"} @@ -311,10 +311,10 @@ Load state from a binary string. | Name | Description | | ---------------------------------------------- | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------- | | `strings` | A table managing the string-to-int mapping. ~~StringStore~~ | -| `vectors` 2 | A table associating word IDs to word vectors. ~~Vectors~~ | +| `vectors` | A table associating word IDs to word vectors. ~~Vectors~~ | | `vectors_length` | Number of dimensions for each word vector. ~~int~~ | | `lookups` | The available lookup tables in this vocab. ~~Lookups~~ | -| `writing_system` 2.1 | A dict with information about the language's writing system. ~~Dict[str, Any]~~ | +| `writing_system` | A dict with information about the language's writing system. ~~Dict[str, Any]~~ | | `get_noun_chunks` 3.0 | A function that yields base noun phrases used for [`Doc.noun_chunks`](/ap/doc#noun_chunks). ~~Optional[Callable[[Union[Doc, Span], Iterator[Tuple[int, int, int]]]]]~~ | ## Serialization fields {#serialization-fields} diff --git a/website/docs/usage/rule-based-matching.md b/website/docs/usage/rule-based-matching.md index 64bbf8e7b..ad8ea27f3 100644 --- a/website/docs/usage/rule-based-matching.md +++ b/website/docs/usage/rule-based-matching.md @@ -162,7 +162,7 @@ rule-based matching are: | Attribute | Description | | ---------------------------------------------- | --------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | | `ORTH` | The exact verbatim text of a token. ~~str~~ | -| `TEXT` 2.1 | The exact verbatim text of a token. ~~str~~ | +| `TEXT` | The exact verbatim text of a token. ~~str~~ | | `NORM` | The normalized form of the token text. ~~str~~ | | `LOWER` | The lowercase form of the token text. ~~str~~ | | `LENGTH` | The length of the token text. ~~int~~ | @@ -174,7 +174,7 @@ rule-based matching are: | `SPACY` | Token has a trailing space. ~~bool~~ | | `POS`, `TAG`, `MORPH`, `DEP`, `LEMMA`, `SHAPE` | The token's simple and extended part-of-speech tag, morphological analysis, dependency label, lemma, shape. Note that the values of these attributes are case-sensitive. For a list of available part-of-speech tags and dependency labels, see the [Annotation Specifications](/api/annotation). ~~str~~ | | `ENT_TYPE` | The token's entity label. ~~str~~ | -| `_` 2.1 | Properties in [custom extension attributes](/usage/processing-pipelines#custom-components-attributes). ~~Dict[str, Any]~~ | +| `_` | Properties in [custom extension attributes](/usage/processing-pipelines#custom-components-attributes). ~~Dict[str, Any]~~ | | `OP` | [Operator or quantifier](#quantifiers) to determine how often to match a token pattern. ~~str~~ | @@ -375,7 +375,7 @@ scoped quantifiers – instead, you can build those behaviors with `on_match` callbacks. | OP | Description | -|---------|------------------------------------------------------------------------| +| ------- | ---------------------------------------------------------------------- | | `!` | Negate the pattern, by requiring it to match exactly 0 times. | | `?` | Make the pattern optional, by allowing it to match 0 or 1 times. | | `+` | Require the pattern to match 1 or more times. | diff --git a/website/docs/usage/saving-loading.md b/website/docs/usage/saving-loading.md index 0fd713a49..29870a2e3 100644 --- a/website/docs/usage/saving-loading.md +++ b/website/docs/usage/saving-loading.md @@ -306,12 +306,12 @@ pipeline component factories, language classes and other settings. To make spaCy use your entry points, your package needs to expose them and it needs to be installed in the same environment – that's it. -| Entry point | Description | -| ------------------------------------------------------------------------------ | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| [`spacy_factories`](#entry-points-components) | Group of entry points for pipeline component factories, keyed by component name. Can be used to expose custom components defined by another package. | -| [`spacy_languages`](#entry-points-languages) | Group of entry points for custom [`Language` subclasses](/usage/linguistic-features#language-data), keyed by language shortcut. | -| `spacy_lookups` 2.2 | Group of entry points for custom [`Lookups`](/api/lookups), including lemmatizer data. Used by spaCy's [`spacy-lookups-data`](https://github.com/explosion/spacy-lookups-data) package. | -| [`spacy_displacy_colors`](#entry-points-displacy) 2.2 | Group of entry points of custom label colors for the [displaCy visualizer](/usage/visualizers#ent). The key name doesn't matter, but it should point to a dict of labels and color values. Useful for custom models that predict different entity types. | +| Entry point | Description | +| ------------------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| [`spacy_factories`](#entry-points-components) | Group of entry points for pipeline component factories, keyed by component name. Can be used to expose custom components defined by another package. | +| [`spacy_languages`](#entry-points-languages) | Group of entry points for custom [`Language` subclasses](/usage/linguistic-features#language-data), keyed by language shortcut. | +| `spacy_lookups` | Group of entry points for custom [`Lookups`](/api/lookups), including lemmatizer data. Used by spaCy's [`spacy-lookups-data`](https://github.com/explosion/spacy-lookups-data) package. | +| [`spacy_displacy_colors`](#entry-points-displacy) | Group of entry points of custom label colors for the [displaCy visualizer](/usage/visualizers#ent). The key name doesn't matter, but it should point to a dict of labels and color values. Useful for custom models that predict different entity types. | ### Custom components via entry points {#entry-points-components} From bb523d4d9105d417e240e6f8f83b63ed3dcc565e Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Mon, 14 Nov 2022 19:58:38 +0900 Subject: [PATCH 081/161] Remove spacy-ray from docs (#11781) * Remove spacy ray from cli docs * Remove more ray docs * Remove ray from universe --- website/docs/api/cli.md | 45 --------------------- website/docs/usage/index.md | 1 - website/docs/usage/projects.md | 48 ----------------------- website/docs/usage/training.md | 71 ---------------------------------- website/meta/universe.json | 11 ------ 5 files changed, 176 deletions(-) diff --git a/website/docs/api/cli.md b/website/docs/api/cli.md index 024450920..6e581b903 100644 --- a/website/docs/api/cli.md +++ b/website/docs/api/cli.md @@ -15,7 +15,6 @@ menu: - ['assemble', 'assemble'] - ['package', 'package'] - ['project', 'project'] - - ['ray', 'ray'] - ['huggingface-hub', 'huggingface-hub'] --- @@ -1502,50 +1501,6 @@ $ python -m spacy project dvc [project_dir] [workflow] [--force] [--verbose] [-- | `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | | **CREATES** | A `dvc.yaml` file in the project directory, based on the steps defined in the given workflow. | -## ray {#ray new="3"} - -The `spacy ray` CLI includes commands for parallel and distributed computing via -[Ray](https://ray.io). - - - -To use this command, you need the -[`spacy-ray`](https://github.com/explosion/spacy-ray) package installed. -Installing the package will automatically add the `ray` command to the spaCy -CLI. - - - -### ray train {#ray-train tag="command"} - -Train a spaCy pipeline using [Ray](https://ray.io) for parallel training. The -command works just like [`spacy train`](/api/cli#train). For more details and -examples, see the usage guide on -[parallel training](/usage/training#parallel-training) and the spaCy project -[integration](/usage/projects#ray). - -```cli -$ python -m spacy ray train [config_path] [--code] [--output] [--n-workers] [--address] [--gpu-id] [--verbose] [overrides] -``` - -> #### Example -> -> ```cli -> $ python -m spacy ray train config.cfg --n-workers 2 -> ``` - -| Name | Description | -| ------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | -| `config_path` | Path to [training config](/api/data-formats#config) file containing all settings and hyperparameters. ~~Path (positional)~~ | -| `--code`, `-c` | Path to Python file with additional code to be imported. Allows [registering custom functions](/usage/training#custom-functions) for new architectures. ~~Optional[Path] \(option)~~ | -| `--output`, `-o` | Directory or remote storage URL for saving trained pipeline. The directory will be created if it doesn't exist. ~~Optional[Path] \(option)~~ | -| `--n-workers`, `-n` | The number of workers. Defaults to `1`. ~~int (option)~~ | -| `--address`, `-a` | Optional address of the Ray cluster. If not set (default), Ray will run locally. ~~Optional[str] \(option)~~ | -| `--gpu-id`, `-g` | GPU ID or `-1` for CPU. Defaults to `-1`. ~~int (option)~~ | -| `--verbose`, `-V` | Display more information for debugging purposes. ~~bool (flag)~~ | -| `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | -| overrides | Config parameters to override. Should be options starting with `--` that correspond to the config section and value to override, e.g. `--paths.train ./train.spacy`. ~~Any (option/flag)~~ | - ## huggingface-hub {#huggingface-hub new="3.1"} The `spacy huggingface-cli` CLI includes commands for uploading your trained diff --git a/website/docs/usage/index.md b/website/docs/usage/index.md index 1f4869606..dff5a16ba 100644 --- a/website/docs/usage/index.md +++ b/website/docs/usage/index.md @@ -75,7 +75,6 @@ spaCy's [`setup.cfg`](%%GITHUB_SPACY/setup.cfg) for details on what's included. | ---------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | | `lookups` | Install [`spacy-lookups-data`](https://github.com/explosion/spacy-lookups-data) for data tables for lemmatization and lexeme normalization. The data is serialized with trained pipelines, so you only need this package if you want to train your own models. | | `transformers` | Install [`spacy-transformers`](https://github.com/explosion/spacy-transformers). The package will be installed automatically when you install a transformer-based pipeline. | -| `ray` | Install [`spacy-ray`](https://github.com/explosion/spacy-ray) to add CLI commands for [parallel training](/usage/training#parallel-training). | | `cuda`, ... | Install spaCy with GPU support provided by [CuPy](https://cupy.chainer.org) for your given CUDA version. See the GPU [installation instructions](#gpu) for details and options. | | `apple` | Install [`thinc-apple-ops`](https://github.com/explosion/thinc-apple-ops) to improve performance on an Apple M1. | | `ja`, `ko`, `th` | Install additional dependencies required for tokenization for the [languages](/usage/models#languages). | diff --git a/website/docs/usage/projects.md b/website/docs/usage/projects.md index 90b612358..34315e4e7 100644 --- a/website/docs/usage/projects.md +++ b/website/docs/usage/projects.md @@ -1014,54 +1014,6 @@ https://github.com/explosion/projects/blob/v3/integrations/fastapi/scripts/main. --- -### Ray {#ray} - -> #### Installation -> -> ```cli -> $ pip install -U %%SPACY_PKG_NAME[ray]%%SPACY_PKG_FLAGS -> # Check that the CLI is registered -> $ python -m spacy ray --help -> ``` - -[Ray](https://ray.io/) is a fast and simple framework for building and running -**distributed applications**. You can use Ray for parallel and distributed -training with spaCy via our lightweight -[`spacy-ray`](https://github.com/explosion/spacy-ray) extension package. If the -package is installed in the same environment as spaCy, it will automatically add -[`spacy ray`](/api/cli#ray) commands to your spaCy CLI. See the usage guide on -[parallel training](/usage/training#parallel-training) for more details on how -it works under the hood. - - - -Get started with parallel training using our project template. It trains a -simple model on a Universal Dependencies Treebank and lets you parallelize the -training with Ray. - - - -You can integrate [`spacy ray train`](/api/cli#ray-train) into your -`project.yml` just like the regular training command and pass it the config, and -optional output directory or remote storage URL and config overrides if needed. - - -```yaml -### project.yml -commands: - - name: "ray" - help: "Train a model via parallel training with Ray" - script: - - "python -m spacy ray train configs/config.cfg -o training/ --paths.train corpus/train.spacy --paths.dev corpus/dev.spacy" - deps: - - "corpus/train.spacy" - - "corpus/dev.spacy" - outputs: - - "training/model-best" -``` - ---- - ### Weights & Biases {#wandb} [Weights & Biases](https://www.wandb.com/) is a popular platform for experiment diff --git a/website/docs/usage/training.md b/website/docs/usage/training.md index 27a8bbca7..e40a395c4 100644 --- a/website/docs/usage/training.md +++ b/website/docs/usage/training.md @@ -1572,77 +1572,6 @@ token-based annotations like the dependency parse or entity labels, you'll need to take care to adjust the `Example` object so its annotations match and remain valid. -## Parallel & distributed training with Ray {#parallel-training} - -> #### Installation -> -> ```cli -> $ pip install -U %%SPACY_PKG_NAME[ray]%%SPACY_PKG_FLAGS -> # Check that the CLI is registered -> $ python -m spacy ray --help -> ``` - -[Ray](https://ray.io/) is a fast and simple framework for building and running -**distributed applications**. You can use Ray to train spaCy on one or more -remote machines, potentially speeding up your training process. Parallel -training won't always be faster though – it depends on your batch size, models, -and hardware. - - - -To use Ray with spaCy, you need the -[`spacy-ray`](https://github.com/explosion/spacy-ray) package installed. -Installing the package will automatically add the `ray` command to the spaCy -CLI. - - - -The [`spacy ray train`](/api/cli#ray-train) command follows the same API as -[`spacy train`](/api/cli#train), with a few extra options to configure the Ray -setup. You can optionally set the `--address` option to point to your Ray -cluster. If it's not set, Ray will run locally. - -```cli -python -m spacy ray train config.cfg --n-workers 2 -``` - - - -Get started with parallel training using our project template. It trains a -simple model on a Universal Dependencies Treebank and lets you parallelize the -training with Ray. - - - -### How parallel training works {#parallel-training-details} - -Each worker receives a shard of the **data** and builds a copy of the **model -and optimizer** from the [`config.cfg`](#config). It also has a communication -channel to **pass gradients and parameters** to the other workers. Additionally, -each worker is given ownership of a subset of the parameter arrays. Every -parameter array is owned by exactly one worker, and the workers are given a -mapping so they know which worker owns which parameter. - -![Illustration of setup](../images/spacy-ray.svg) - -As training proceeds, every worker will be computing gradients for **all** of -the model parameters. When they compute gradients for parameters they don't own, -they'll **send them to the worker** that does own that parameter, along with a -version identifier so that the owner can decide whether to discard the gradient. -Workers use the gradients they receive and the ones they compute locally to -update the parameters they own, and then broadcast the updated array and a new -version ID to the other workers. - -This training procedure is **asynchronous** and **non-blocking**. Workers always -push their gradient increments and parameter updates, they do not have to pull -them and block on the result, so the transfers can happen in the background, -overlapped with the actual training work. The workers also do not have to stop -and wait for each other ("synchronize") at the start of each batch. This is very -useful for spaCy, because spaCy is often trained on long documents, which means -**batches can vary in size** significantly. Uneven workloads make synchronous -gradient descent inefficient, because if one batch is slow, all of the other -workers are stuck waiting for it to complete before they can continue. - ## Internal training API {#api} diff --git a/website/meta/universe.json b/website/meta/universe.json index fa765f640..661f5da12 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -557,17 +557,6 @@ "tags": ["sentiment", "textblob"], "spacy_version": 3 }, - { - "id": "spacy-ray", - "title": "spacy-ray", - "slogan": "Parallel and distributed training with spaCy and Ray", - "description": "[Ray](https://ray.io/) is a fast and simple framework for building and running **distributed applications**. This very lightweight extension package lets you use Ray for parallel and distributed training with spaCy. If `spacy-ray` is installed in the same environment as spaCy, it will automatically add `spacy ray` commands to your spaCy CLI.", - "github": "explosion/spacy-ray", - "pip": "spacy-ray", - "category": ["training"], - "author": "Explosion / Anyscale", - "thumb": "https://i.imgur.com/7so6ZpS.png" - }, { "id": "spacy-sentence-bert", "title": "spaCy - sentence-transformers", From 9baa686f827eeaecf28bf6d75836eeaec090cd69 Mon Sep 17 00:00:00 2001 From: Peter Baumgartner <5107405+pmbaumgartner@users.noreply.github.com> Date: Mon, 14 Nov 2022 10:53:14 -0500 Subject: [PATCH 082/161] remove migration support form (#11802) --- website/docs/usage/v3.md | 12 ------------ 1 file changed, 12 deletions(-) diff --git a/website/docs/usage/v3.md b/website/docs/usage/v3.md index 971779ed3..64f93b7c0 100644 --- a/website/docs/usage/v3.md +++ b/website/docs/usage/v3.md @@ -15,18 +15,6 @@ menu: > To help you make the transition from v2.x to v3.0, we've uploaded the old > website to [**v2.spacy.io**](https://v2.spacy.io/docs). - - -Want to make the transition from spaCy v2 to spaCy v3 as smooth as possible for -you and your organization? We're now offering commercial **migration support** -for your spaCy pipelines! We've put a lot of work into making it easy to upgrade -your existing code and training workflows – but custom projects may always need -some custom work, especially when it comes to taking advantage of the new -capabilities. -[**Details & application →**](https://form.typeform.com/to/vMs2zSjM) - - -
From 7e684ad691992e759e71026a11c1ddd77c401f39 Mon Sep 17 00:00:00 2001 From: Denis Bezykornov Date: Tue, 15 Nov 2022 13:37:25 +0300 Subject: [PATCH 083/161] Update russian tokenizer exceptions (#11753) * Fix typos, add couple of new abbreviations, remove nonbreaking spaces * Remove space from abbreviation Co-authored-by: Adriane Boyd --- spacy/lang/ru/tokenizer_exceptions.py | 18 ++++++++++++------ 1 file changed, 12 insertions(+), 6 deletions(-) diff --git a/spacy/lang/ru/tokenizer_exceptions.py b/spacy/lang/ru/tokenizer_exceptions.py index f3756e26c..e1889f785 100644 --- a/spacy/lang/ru/tokenizer_exceptions.py +++ b/spacy/lang/ru/tokenizer_exceptions.py @@ -61,6 +61,11 @@ for abbr in [ {ORTH: "2к23", NORM: "2023"}, {ORTH: "2к24", NORM: "2024"}, {ORTH: "2к25", NORM: "2025"}, + {ORTH: "2к26", NORM: "2026"}, + {ORTH: "2к27", NORM: "2027"}, + {ORTH: "2к28", NORM: "2028"}, + {ORTH: "2к29", NORM: "2029"}, + {ORTH: "2к30", NORM: "2030"}, ]: _exc[abbr[ORTH]] = [abbr] @@ -268,8 +273,8 @@ for abbr in [ {ORTH: "з-ка", NORM: "заимка"}, {ORTH: "п-к", NORM: "починок"}, {ORTH: "киш.", NORM: "кишлак"}, - {ORTH: "п. ст. ", NORM: "поселок станция"}, - {ORTH: "п. ж/д ст. ", NORM: "поселок при железнодорожной станции"}, + {ORTH: "п. ст.", NORM: "поселок станция"}, + {ORTH: "п. ж/д ст.", NORM: "поселок при железнодорожной станции"}, {ORTH: "ж/д бл-ст", NORM: "железнодорожный блокпост"}, {ORTH: "ж/д б-ка", NORM: "железнодорожная будка"}, {ORTH: "ж/д в-ка", NORM: "железнодорожная ветка"}, @@ -280,12 +285,12 @@ for abbr in [ {ORTH: "ж/д п.п.", NORM: "железнодорожный путевой пост"}, {ORTH: "ж/д о.п.", NORM: "железнодорожный остановочный пункт"}, {ORTH: "ж/д рзд.", NORM: "железнодорожный разъезд"}, - {ORTH: "ж/д ст. ", NORM: "железнодорожная станция"}, + {ORTH: "ж/д ст.", NORM: "железнодорожная станция"}, {ORTH: "м-ко", NORM: "местечко"}, {ORTH: "д.", NORM: "деревня"}, {ORTH: "с.", NORM: "село"}, {ORTH: "сл.", NORM: "слобода"}, - {ORTH: "ст. ", NORM: "станция"}, + {ORTH: "ст.", NORM: "станция"}, {ORTH: "ст-ца", NORM: "станица"}, {ORTH: "у.", NORM: "улус"}, {ORTH: "х.", NORM: "хутор"}, @@ -388,8 +393,9 @@ for abbr in [ {ORTH: "прим.", NORM: "примечание"}, {ORTH: "прим.ред.", NORM: "примечание редакции"}, {ORTH: "см. также", NORM: "смотри также"}, - {ORTH: "кв.м.", NORM: "квадрантный метр"}, - {ORTH: "м2", NORM: "квадрантный метр"}, + {ORTH: "см.", NORM: "смотри"}, + {ORTH: "кв.м.", NORM: "квадратный метр"}, + {ORTH: "м2", NORM: "квадратный метр"}, {ORTH: "б/у", NORM: "бывший в употреблении"}, {ORTH: "сокр.", NORM: "сокращение"}, {ORTH: "чел.", NORM: "человек"}, From caa9efad5991d574cf2bdc69fabfc6d952d5cba9 Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Tue, 15 Nov 2022 14:15:00 +0100 Subject: [PATCH 084/161] prevent rewriting an already raw URL (#11810) --- spacy/cli/project/assets.py | 6 +++++- 1 file changed, 5 insertions(+), 1 deletion(-) diff --git a/spacy/cli/project/assets.py b/spacy/cli/project/assets.py index 61438d1a8..8f35b2d23 100644 --- a/spacy/cli/project/assets.py +++ b/spacy/cli/project/assets.py @@ -189,7 +189,11 @@ def convert_asset_url(url: str) -> str: RETURNS (str): The converted URL. """ # If the asset URL is a regular GitHub URL it's likely a mistake - if re.match(r"(http(s?)):\/\/github.com", url) and "releases/download" not in url: + if ( + re.match(r"(http(s?)):\/\/github.com", url) + and "releases/download" not in url + and "/raw/" not in url + ): converted = url.replace("github.com", "raw.githubusercontent.com") converted = re.sub(r"/(tree|blob)/", "/", converted) msg.warn( From c0c54e44bc70ca737b421def1f6ce3c30809a54b Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Wed, 16 Nov 2022 17:44:42 +0900 Subject: [PATCH 085/161] Add equality definition for vectors (#11806) * Add equality definition for vectors This re-uses the check from sourcing components. * Use the equality check * Format Co-authored-by: Adriane Boyd --- spacy/language.py | 8 +------- spacy/tests/vocab_vectors/test_vectors.py | 20 ++++++++++++++++++++ spacy/vectors.pyx | 9 +++++++++ 3 files changed, 30 insertions(+), 7 deletions(-) diff --git a/spacy/language.py b/spacy/language.py index 967af1e62..836f3abf9 100644 --- a/spacy/language.py +++ b/spacy/language.py @@ -706,13 +706,7 @@ class Language: # Check source type if not isinstance(source, Language): raise ValueError(Errors.E945.format(name=source_name, source=type(source))) - # Check vectors, with faster checks first - if ( - self.vocab.vectors.shape != source.vocab.vectors.shape - or self.vocab.vectors.key2row != source.vocab.vectors.key2row - or self.vocab.vectors.to_bytes(exclude=["strings"]) - != source.vocab.vectors.to_bytes(exclude=["strings"]) - ): + if self.vocab.vectors != source.vocab.vectors: warnings.warn(Warnings.W113.format(name=source_name)) if source_name not in source.component_names: raise KeyError( diff --git a/spacy/tests/vocab_vectors/test_vectors.py b/spacy/tests/vocab_vectors/test_vectors.py index dd2cfc596..70835816d 100644 --- a/spacy/tests/vocab_vectors/test_vectors.py +++ b/spacy/tests/vocab_vectors/test_vectors.py @@ -626,3 +626,23 @@ def test_floret_vectors(floret_vectors_vec_str, floret_vectors_hashvec_str): OPS.to_numpy(vocab_r[word].vector), decimal=6, ) + + +def test_equality(): + vectors1 = Vectors(shape=(10, 10)) + vectors2 = Vectors(shape=(10, 8)) + + assert vectors1 != vectors2 + + vectors2 = Vectors(shape=(10, 10)) + assert vectors1 == vectors2 + + vectors1.add("hello", row=2) + assert vectors1 != vectors2 + + vectors2.add("hello", row=2) + assert vectors1 == vectors2 + + vectors1.resize((5, 9)) + vectors2.resize((5, 9)) + assert vectors1 == vectors2 diff --git a/spacy/vectors.pyx b/spacy/vectors.pyx index 8300220c1..be0f6db09 100644 --- a/spacy/vectors.pyx +++ b/spacy/vectors.pyx @@ -243,6 +243,15 @@ cdef class Vectors: else: return key in self.key2row + def __eq__(self, other): + # Check for equality, with faster checks first + return ( + self.shape == other.shape + and self.key2row == other.key2row + and self.to_bytes(exclude=["strings"]) + == other.to_bytes(exclude=["strings"]) + ) + def resize(self, shape, inplace=False): """Resize the underlying vectors array. If inplace=True, the memory is reallocated. This may cause other references to the data to become From 317b6ef99c0e3512466d31a8274f9fe6a2894355 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Wed, 16 Nov 2022 14:09:10 +0100 Subject: [PATCH 086/161] Update to mypy 0.990 (#11801) --- requirements.txt | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/requirements.txt b/requirements.txt index d91a3b3d4..23bfa6f14 100644 --- a/requirements.txt +++ b/requirements.txt @@ -30,7 +30,7 @@ pytest-timeout>=1.3.0,<2.0.0 mock>=2.0.0,<3.0.0 flake8>=3.8.0,<6.0.0 hypothesis>=3.27.0,<7.0.0 -mypy>=0.980,<0.990; platform_machine != "aarch64" and python_version >= "3.7" +mypy>=0.990,<0.1000; platform_machine != "aarch64" and python_version >= "3.7" types-dataclasses>=0.1.3; python_version < "3.7" types-mock>=0.1.1 types-setuptools>=57.0.0 From 75bb7ad541a94c74127b57ffd6d674841767478c Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Thu, 17 Nov 2022 18:25:01 +0900 Subject: [PATCH 087/161] Check textcat values for validity (#11763) * Check textcat values for validity * Fix error numbers * Clean up vals reference * Check category value validity through training The _validate_categories is called in update, which for multilabel is inherited from the single label component. * Formatting --- spacy/errors.py | 2 ++ spacy/pipeline/textcat.py | 10 +++++++--- spacy/pipeline/textcat_multilabel.py | 8 +++++++- spacy/tests/pipeline/test_textcat.py | 24 ++++++++++++++++++++++++ 4 files changed, 40 insertions(+), 4 deletions(-) diff --git a/spacy/errors.py b/spacy/errors.py index 278e5496a..1d29f0e17 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -544,6 +544,8 @@ class Errors(metaclass=ErrorsWithCodes): "during training, make sure to include it in 'annotating components'") # New errors added in v3.x + E851 = ("The 'textcat' component labels should only have values of 0 or 1, " + "but found value of '{val}'.") E852 = ("The tar file pulled from the remote attempted an unsafe path " "traversal.") E853 = ("Unsupported component factory name '{name}'. The character '.' is " diff --git a/spacy/pipeline/textcat.py b/spacy/pipeline/textcat.py index 4023c4456..a86eb99d2 100644 --- a/spacy/pipeline/textcat.py +++ b/spacy/pipeline/textcat.py @@ -293,7 +293,7 @@ class TextCategorizer(TrainablePipe): bp_scores(gradient) if sgd is not None: self.finish_update(sgd) - losses[self.name] += (gradient**2).sum() + losses[self.name] += (gradient ** 2).sum() return losses def _examples_to_truth( @@ -327,7 +327,7 @@ class TextCategorizer(TrainablePipe): not_missing = self.model.ops.asarray(not_missing) # type: ignore d_scores = scores - truths d_scores *= not_missing - mean_square_error = (d_scores**2).mean() + mean_square_error = (d_scores ** 2).mean() return float(mean_square_error), d_scores def add_label(self, label: str) -> int: @@ -401,5 +401,9 @@ class TextCategorizer(TrainablePipe): def _validate_categories(self, examples: Iterable[Example]): """Check whether the provided examples all have single-label cats annotations.""" for ex in examples: - if list(ex.reference.cats.values()).count(1.0) > 1: + vals = list(ex.reference.cats.values()) + if vals.count(1.0) > 1: raise ValueError(Errors.E895.format(value=ex.reference.cats)) + for val in vals: + if not (val == 1.0 or val == 0.0): + raise ValueError(Errors.E851.format(val=val)) diff --git a/spacy/pipeline/textcat_multilabel.py b/spacy/pipeline/textcat_multilabel.py index eb83d9cb7..ef9bd6557 100644 --- a/spacy/pipeline/textcat_multilabel.py +++ b/spacy/pipeline/textcat_multilabel.py @@ -192,6 +192,8 @@ class MultiLabel_TextCategorizer(TextCategorizer): for label in labels: self.add_label(label) subbatch = list(islice(get_examples(), 10)) + self._validate_categories(subbatch) + doc_sample = [eg.reference for eg in subbatch] label_sample, _ = self._examples_to_truth(subbatch) self._require_labels() @@ -202,4 +204,8 @@ class MultiLabel_TextCategorizer(TextCategorizer): def _validate_categories(self, examples: Iterable[Example]): """This component allows any type of single- or multi-label annotations. This method overwrites the more strict one from 'textcat'.""" - pass + # check that annotation values are valid + for ex in examples: + for val in ex.reference.cats.values(): + if not (val == 1.0 or val == 0.0): + raise ValueError(Errors.E851.format(val=val)) diff --git a/spacy/tests/pipeline/test_textcat.py b/spacy/tests/pipeline/test_textcat.py index d359b77db..2eda9deaf 100644 --- a/spacy/tests/pipeline/test_textcat.py +++ b/spacy/tests/pipeline/test_textcat.py @@ -360,6 +360,30 @@ def test_label_types(name): nlp.initialize() +@pytest.mark.parametrize( + "name,get_examples", + [ + ("textcat", make_get_examples_single_label), + ("textcat_multilabel", make_get_examples_multi_label), + ], +) +def test_invalid_label_value(name, get_examples): + nlp = Language() + textcat = nlp.add_pipe(name) + example_getter = get_examples(nlp) + + def invalid_examples(): + # make one example with an invalid score + examples = example_getter() + ref = examples[0].reference + key = list(ref.cats.keys())[0] + ref.cats[key] = 2.0 + return examples + + with pytest.raises(ValueError): + nlp.initialize(get_examples=invalid_examples) + + @pytest.mark.parametrize("name", ["textcat", "textcat_multilabel"]) def test_no_label(name): nlp = Language() From a83463c5e07035ae5832e6790a0c0170e3746bd1 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Fri, 18 Nov 2022 08:15:27 +0100 Subject: [PATCH 088/161] Add transformer recommendation for ca (#11819) Model recommendation from @cayorodriguez. --- .../templates/quickstart_training_recommendations.yml | 9 +++++++++ 1 file changed, 9 insertions(+) diff --git a/spacy/cli/templates/quickstart_training_recommendations.yml b/spacy/cli/templates/quickstart_training_recommendations.yml index 27945e27a..4f214d22d 100644 --- a/spacy/cli/templates/quickstart_training_recommendations.yml +++ b/spacy/cli/templates/quickstart_training_recommendations.yml @@ -37,6 +37,15 @@ bn: accuracy: name: sagorsarker/bangla-bert-base size_factor: 3 +ca: + word_vectors: null + transformer: + efficiency: + name: projecte-aina/roberta-base-ca-v2 + size_factor: 3 + accuracy: + name: projecte-aina/roberta-base-ca-v2 + size_factor: 3 da: word_vectors: da_core_news_lg transformer: From e3173bd86d65a534f92578b85b0e5058a5c845f4 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Fri, 18 Nov 2022 16:24:22 +0900 Subject: [PATCH 089/161] Remove spikex from Universe (#11825) --- website/meta/universe.json | 31 ------------------------------- 1 file changed, 31 deletions(-) diff --git a/website/meta/universe.json b/website/meta/universe.json index 661f5da12..57bf2d3e3 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -461,37 +461,6 @@ }, "category": ["standalone"] }, - { - "id": "spikex", - "title": "SpikeX - SpaCy Pipes for Knowledge Extraction", - "slogan": "Use SpikeX to build knowledge extraction tools with almost-zero effort", - "description": "SpikeX is a collection of pipes ready to be plugged in a spaCy pipeline. It aims to help in building knowledge extraction tools with almost-zero effort.", - "github": "erre-quadro/spikex", - "pip": "spikex", - "code_example": [ - "from spacy import load as spacy_load", - "from spikex.wikigraph import load as wg_load", - "from spikex.pipes import WikiPageX", - "", - "# load a spacy model and get a doc", - "nlp = spacy_load('en_core_web_sm')", - "doc = nlp('An apple a day keeps the doctor away')", - "# load a WikiGraph", - "wg = wg_load('simplewiki_core')", - "# get a WikiPageX and extract all pages", - "wikipagex = WikiPageX(wg)", - "doc = wikipagex(doc)", - "# see all pages extracted from the doc", - "for span in doc._.wiki_spans:", - " print(span._.wiki_pages)" - ], - "category": ["pipeline", "standalone"], - "author": "Erre Quadro", - "author_links": { - "github": "erre-quadro", - "website": "https://www.errequadrosrl.com" - } - }, { "id": "spacy-dbpedia-spotlight", "title": "DBpedia Spotlight for SpaCy", From 89bfd06fbd89cc00ca2007bf795326538126f937 Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 18 Nov 2022 18:24:13 +0900 Subject: [PATCH 090/161] Auto-format code with black (#11826) Co-authored-by: explosion-bot --- spacy/pipeline/textcat.py | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/spacy/pipeline/textcat.py b/spacy/pipeline/textcat.py index a86eb99d2..9490e3cb1 100644 --- a/spacy/pipeline/textcat.py +++ b/spacy/pipeline/textcat.py @@ -293,7 +293,7 @@ class TextCategorizer(TrainablePipe): bp_scores(gradient) if sgd is not None: self.finish_update(sgd) - losses[self.name] += (gradient ** 2).sum() + losses[self.name] += (gradient**2).sum() return losses def _examples_to_truth( @@ -327,7 +327,7 @@ class TextCategorizer(TrainablePipe): not_missing = self.model.ops.asarray(not_missing) # type: ignore d_scores = scores - truths d_scores *= not_missing - mean_square_error = (d_scores ** 2).mean() + mean_square_error = (d_scores**2).mean() return float(mean_square_error), d_scores def add_label(self, label: str) -> int: From f0d8309a289015ae44f994e8c0207cdfe41583ec Mon Sep 17 00:00:00 2001 From: Marco Edward Gorelli <33491632+MarcoGorelli@users.noreply.github.com> Date: Mon, 21 Nov 2022 07:12:03 +0000 Subject: [PATCH 091/161] fix comparison of constants (#11834) Co-authored-by: MarcoGorelli <> --- .pre-commit-config.yaml | 2 +- spacy/tests/vocab_vectors/test_vocab_api.py | 21 +++++++++++++++++++++ spacy/vocab.pyx | 4 ++-- 3 files changed, 24 insertions(+), 3 deletions(-) diff --git a/.pre-commit-config.yaml b/.pre-commit-config.yaml index df59697b1..e2c5e98fd 100644 --- a/.pre-commit-config.yaml +++ b/.pre-commit-config.yaml @@ -5,7 +5,7 @@ repos: - id: black language_version: python3.7 additional_dependencies: ['click==8.0.4'] -- repo: https://gitlab.com/pycqa/flake8 +- repo: https://github.com/pycqa/flake8 rev: 5.0.4 hooks: - id: flake8 diff --git a/spacy/tests/vocab_vectors/test_vocab_api.py b/spacy/tests/vocab_vectors/test_vocab_api.py index 16cf80a08..b9c386eb8 100644 --- a/spacy/tests/vocab_vectors/test_vocab_api.py +++ b/spacy/tests/vocab_vectors/test_vocab_api.py @@ -1,8 +1,13 @@ +import os + import pytest from spacy.attrs import IS_ALPHA, LEMMA, ORTH +from spacy.lang.en import English from spacy.parts_of_speech import NOUN, VERB from spacy.vocab import Vocab +from ..util import make_tempdir + @pytest.mark.issue(1868) def test_issue1868(): @@ -59,3 +64,19 @@ def test_vocab_api_contains(en_vocab, text): def test_vocab_writing_system(en_vocab): assert en_vocab.writing_system["direction"] == "ltr" assert en_vocab.writing_system["has_case"] is True + + +def test_to_disk(): + nlp = English() + with make_tempdir() as d: + nlp.vocab.to_disk(d) + assert "vectors" in os.listdir(d) + assert "lookups.bin" in os.listdir(d) + + +def test_to_disk_exclude(): + nlp = English() + with make_tempdir() as d: + nlp.vocab.to_disk(d, exclude=("vectors", "lookups")) + assert "vectors" not in os.listdir(d) + assert "lookups.bin" not in os.listdir(d) diff --git a/spacy/vocab.pyx b/spacy/vocab.pyx index 428cadd82..27f8e5f98 100644 --- a/spacy/vocab.pyx +++ b/spacy/vocab.pyx @@ -468,9 +468,9 @@ cdef class Vocab: setters = ["strings", "vectors"] if "strings" not in exclude: self.strings.to_disk(path / "strings.json") - if "vectors" not in "exclude": + if "vectors" not in exclude: self.vectors.to_disk(path, exclude=["strings"]) - if "lookups" not in "exclude": + if "lookups" not in exclude: self.lookups.to_disk(path) def from_disk(self, path, *, exclude=tuple()): From 9d96e44a87fc2646bddc7e4e8d0357d48caf42e7 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Marcus=20Bl=C3=A4ttermann?= Date: Sun, 11 Sep 2022 22:04:00 +0200 Subject: [PATCH 092/161] Apply Prettier to `README.md` --- website/README.md | 27 ++++++++++++++------------- 1 file changed, 14 insertions(+), 13 deletions(-) diff --git a/website/README.md b/website/README.md index 66bc20ad9..42419fbb7 100644 --- a/website/README.md +++ b/website/README.md @@ -555,13 +555,13 @@ extensions for your code editor. The file in the root defines the settings used in this codebase. ## Building & developing the site with Docker {#docker} -Sometimes it's hard to get a local environment working due to rapid updates to node dependencies, -so it may be easier to use docker for building the docs. -If you'd like to do this, -**be sure you do *not* include your local `node_modules` folder**, -since there are some dependencies that need to be built for the image system. -Rename it before using. +Sometimes it's hard to get a local environment working due to rapid updates to +node dependencies, so it may be easier to use docker for building the docs. + +If you'd like to do this, **be sure you do _not_ include your local +`node_modules` folder**, since there are some dependencies that need to be built +for the image system. Rename it before using. ```bash docker run -it \ @@ -571,13 +571,13 @@ docker run -it \ gatsby develop -H 0.0.0.0 ``` -This will allow you to access the built website at http://0.0.0.0:8000/ -in your browser, and still edit code in your editor while having the site -reflect those changes. +This will allow you to access the built website at http://0.0.0.0:8000/ in your +browser, and still edit code in your editor while having the site reflect those +changes. -**Note**: If you're working on a Mac with an M1 processor, -you might see segfault errors from `qemu` if you use the default image. -To fix this use the `arm64` tagged image in the `docker run` command +**Note**: If you're working on a Mac with an M1 processor, you might see +segfault errors from `qemu` if you use the default image. To fix this use the +`arm64` tagged image in the `docker run` command (ghcr.io/explosion/spacy-io:arm64). ### Building the Docker image {#docker-build} @@ -588,7 +588,8 @@ If you'd like to build the image locally, you can do so like this: docker build -t spacy-io . ``` -This will take some time, so if you want to use the prebuilt image you'll save a bit of time. +This will take some time, so if you want to use the prebuilt image you'll save a +bit of time. ## Markdown reference {#markdown} From 96218a1e8f3af6a2ebcfaf6a28c7cadb4a60c203 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Marcus=20Bl=C3=A4ttermann?= Date: Tue, 22 Nov 2022 15:55:39 +0100 Subject: [PATCH 093/161] Delete `styleguide.md` This is in intermediate commit, so the content of `/README.md`can be moved to the styleguid, but the history is kept --- website/docs/styleguide.md | 30 ------------------------------ 1 file changed, 30 deletions(-) delete mode 100644 website/docs/styleguide.md diff --git a/website/docs/styleguide.md b/website/docs/styleguide.md deleted file mode 100644 index ed6f9d99b..000000000 --- a/website/docs/styleguide.md +++ /dev/null @@ -1,30 +0,0 @@ ---- -title: Styleguide -section: styleguide -search_exclude: true -menu: - - ['Logo', 'logo'] - - ['Colors', 'colors'] - - ['Typography', 'typography'] - - ['Elements', 'elements'] - - ['Components', 'components'] - - ['Setup & Installation', 'setup'] - - ['Markdown Reference', 'markdown'] - - ['Project Structure', 'structure'] - - ['Editorial', 'editorial'] -sidebar: - - label: Styleguide - items: - - text: '' - url: '/styleguide' - - label: Resources - items: - - text: Website Source - url: https://github.com/explosion/spacy/tree/master/website - - text: Contributing Guide - url: https://github.com/explosion/spaCy/blob/master/CONTRIBUTING.md ---- - -import Readme from 'README.md' - - From 0794e5c6cce6282434576cd311126b0c3bfebc35 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Marcus=20Bl=C3=A4ttermann?= Date: Wed, 23 Nov 2022 01:22:27 +0100 Subject: [PATCH 094/161] Add missing files to project structure in `README.md` --- website/README.md | 4 ++++ 1 file changed, 4 insertions(+) diff --git a/website/README.md b/website/README.md index 42419fbb7..b2f640543 100644 --- a/website/README.md +++ b/website/README.md @@ -648,8 +648,10 @@ In addition to the native markdown elements, you can use the components | ├── languages.json # supported languages and statistical models | ├── sidebars.json # sidebar navigations for different sections | ├── site.json # general site metadata +| ├── type-annotations.json # Type annotations | └── universe.json # data for the spaCy universe section ├── public # compiled site +├── setup # Jinja setup ├── src # source | ├── components # React components | ├── fonts # webfonts @@ -662,6 +664,8 @@ In addition to the native markdown elements, you can use the components | | ├── models.js # layout template for model pages | | └── universe.js # layout templates for universe | └── widgets # non-reusable components with content, e.g. changelog +├── .eslintrc.json # ESLint config file +├── .prettierrc # Prettier config file ├── gatsby-browser.js # browser-specific hooks for Gatsby ├── gatsby-config.js # Gatsby configuration ├── gatsby-node.js # Node-specific hooks for Gatsby From 8c0ceca637d486624cb32fbf9c875e69f81dcf83 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Marcus=20Bl=C3=A4ttermann?= Date: Tue, 22 Nov 2022 15:56:21 +0100 Subject: [PATCH 095/161] Move `README.md` content to styleguide --- website/{README.md => docs/styleguide.md} | 0 1 file changed, 0 insertions(+), 0 deletions(-) rename website/{README.md => docs/styleguide.md} (100%) diff --git a/website/README.md b/website/docs/styleguide.md similarity index 100% rename from website/README.md rename to website/docs/styleguide.md From 5659eeaadd750e404152c731728ebf922c824226 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Marcus=20Bl=C3=A4ttermann?= Date: Tue, 22 Nov 2022 15:58:39 +0100 Subject: [PATCH 096/161] Remove styleguide content from `README.md` --- website/README.md | 608 ---------------------------------------------- 1 file changed, 608 deletions(-) diff --git a/website/README.md b/website/README.md index b2f640543..743e61acd 100644 --- a/website/README.md +++ b/website/README.md @@ -11,520 +11,6 @@ rendered version is available at https://spacy.io/styleguide._ -The [spacy.io](https://spacy.io) website is implemented using -[Gatsby](https://www.gatsbyjs.org) with -[Remark](https://github.com/remarkjs/remark) and [MDX](https://mdxjs.com/). This -allows authoring content in **straightforward Markdown** without the usual -limitations. Standard elements can be overwritten with powerful -[React](http://reactjs.org/) components and wherever Markdown syntax isn't -enough, JSX components can be used. - -> #### Contributing to the site -> -> The docs can always use another example or more detail, and they should always -> be up to date and not misleading. We always appreciate a -> [pull request](https://github.com/explosion/spaCy/pulls). To quickly find the -> correct file to edit, simply click on the "Suggest edits" button at the bottom -> of a page. -> -> For more details on editing the site locally, see the installation -> instructions and markdown reference below. - -## Logo {#logo source="website/src/images/logo.svg"} - -import { Logos } from 'widgets/styleguide' - -If you would like to use the spaCy logo on your site, please get in touch and -ask us first. However, if you want to show support and tell others that your -project is using spaCy, you can grab one of our -[spaCy badges](/usage/spacy-101#faq-project-with-spacy). - - - -## Colors {#colors} - -import { Colors, Patterns } from 'widgets/styleguide' - - - -### Patterns - - - -## Typography {#typography} - -import { H1, H2, H3, H4, H5, Label, InlineList, Comment } from -'components/typography' - -> #### Markdown -> -> ```markdown_ -> ## Headline 2 -> ## Headline 2 {#some_id} -> ## Headline 2 {#some_id tag="method"} -> ``` -> -> #### JSX -> -> ```jsx ->

Headline 2

->

Headline 2

->

Headline 2

-> ``` - -Headlines are set in -[HK Grotesk](http://cargocollective.com/hanken/HK-Grotesk-Open-Source-Font) by -Hanken Design. All other body text and code uses the best-matching default -system font to provide a "native" reading experience. All code uses the -[JetBrains Mono](https://www.jetbrains.com/lp/mono/) typeface by JetBrains. - - - -Level 2 headings are automatically wrapped in `
` elements at compile -time, using a custom -[Markdown transformer](https://github.com/explosion/spaCy/tree/master/website/plugins/remark-wrap-section.js). -This makes it easier to highlight the section that's currently in the viewpoint -in the sidebar menu. - - - -
-

Headline 1

-

Headline 2

-

Headline 3

-

Headline 4

-
Headline 5
- -
- ---- - -The following optional attributes can be set on the headline to modify it. For -example, to add a tag for the documented type or mark features that have been -introduced in a specific version or require statistical models to be loaded. -Tags are also available as standalone `` components. - -| Argument | Example | Result | -| -------- | -------------------------- | ----------------------------------------- | -| `tag` | `{tag="method"}` | method | -| `new` | `{new="3"}` | 3 | -| `model` | `{model="tagger, parser"}` | tagger, parser | -| `hidden` | `{hidden="true"}` | | - -## Elements {#elements} - -### Links {#links} - -> #### Markdown -> -> ```markdown -> [I am a link](https://spacy.io) -> ``` -> -> #### JSX -> -> ```jsx -> I am a link -> ``` - -Special link styles are used depending on the link URL. - -- [I am a regular external link](https://explosion.ai) -- [I am a link to the documentation](/api/doc) -- [I am a link to an architecture](/api/architectures#HashEmbedCNN) -- [I am a link to a model](/models/en#en_core_web_sm) -- [I am a link to GitHub](https://github.com/explosion/spaCy) - -### Abbreviations {#abbr} - -import { Abbr } from 'components/typography' - -> #### JSX -> -> ```jsx -> Abbreviation -> ``` - -Some text with an abbreviation. On small -screens, I collapse and the explanation text is displayed next to the -abbreviation. - -### Tags {#tags} - -import Tag from 'components/tag' - -> ```jsx -> method -> 4 -> tagger, parser -> ``` - -Tags can be used together with headlines, or next to properties across the -documentation, and combined with tooltips to provide additional information. An -optional `variant` argument can be used for special tags. `variant="new"` makes -the tag take a version number to mark new features. Using the component, -visibility of this tag can later be toggled once the feature isn't considered -new anymore. Setting `variant="model"` takes a description of model capabilities -and can be used to mark features that require a respective model to be -installed. - - - -method 4 tagger, -parser - - - -### Buttons {#buttons} - -import Button from 'components/button' - -> ```jsx -> -> -> ``` - -Link buttons come in two variants, `primary` and `secondary` and two sizes, with -an optional `large` size modifier. Since they're mostly used as enhanced links, -the buttons are implemented as styled links instead of native button elements. - - - - -
- - - - -## Components - -### Table {#table} - -> #### Markdown -> -> ```markdown_ -> | Header 1 | Header 2 | -> | -------- | -------- | -> | Column 1 | Column 2 | -> ``` -> -> #### JSX -> -> ```markup -> -> -> ->
Header 1Header 2
Column 1Column 2
-> ``` - -Tables are used to present data and API documentation. Certain keywords can be -used to mark a footer row with a distinct style, for example to visualize the -return values of a documented function. - -| Header 1 | Header 2 | Header 3 | Header 4 | -| ----------- | -------- | :------: | -------: | -| Column 1 | Column 2 | Column 3 | Column 4 | -| Column 1 | Column 2 | Column 3 | Column 4 | -| Column 1 | Column 2 | Column 3 | Column 4 | -| Column 1 | Column 2 | Column 3 | Column 4 | -| **RETURNS** | Column 2 | Column 3 | Column 4 | - -Tables also support optional "divider" rows that are typically used to denote -keyword-only arguments in API documentation. To turn a row into a dividing -headline, it should only include content in its first cell, and its value should -be italicized: - -> #### Markdown -> -> ```markdown_ -> | Header 1 | Header 2 | Header 3 | -> | -------- | -------- | -------- | -> | Column 1 | Column 2 | Column 3 | -> | _Hello_ | | | -> | Column 1 | Column 2 | Column 3 | -> ``` - -| Header 1 | Header 2 | Header 3 | -| -------- | -------- | -------- | -| Column 1 | Column 2 | Column 3 | -| _Hello_ | | | -| Column 1 | Column 2 | Column 3 | - -### Type Annotations {#type-annotations} - -> #### Markdown -> -> ```markdown_ -> ~~Model[List[Doc], Floats2d]~~ -> ``` -> -> #### JSX -> -> ```markup -> Model[List[Doc], Floats2d] -> ``` - -Type annotations are special inline code blocks are used to describe Python -types in the [type hints](https://docs.python.org/3/library/typing.html) format. -The special component will split the type, apply syntax highlighting and link -all types that specify links in `meta/type-annotations.json`. Types can link to -internal or external documentation pages. To make it easy to represent the type -annotations in Markdown, the rendering "hijacks" the `~~` tags that would -typically be converted to a `` element – but in this case, text surrounded -by `~~` becomes a type annotation. - -- ~~Dict[str, List[Union[Doc, Span]]]~~ -- ~~Model[List[Doc], List[numpy.ndarray]]~~ - -Type annotations support a special visual style in tables and will render as a -separate row, under the cell text. This allows the API docs to display complex -types without taking up too much space in the cell. The type annotation should -always be the **last element** in the row. - -> #### Markdown -> -> ```markdown_ -> | Header 1 | Header 2 | -> | -------- | ----------------------- | -> | Column 1 | Column 2 ~~List[Doc]~~ | -> ``` - -| Name | Description | -| ----------------------- | --------------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `vocab` | The shared vocabulary. ~~Vocab~~ | -| `model` | The Thinc [`Model`](https://thinc.ai/docs/api-model) wrapping the transformer. ~~Model[List[Doc], FullTransformerBatch]~~ | -| `set_extra_annotations` | Function that takes a batch of `Doc` objects and transformer outputs and can set additional annotations on the `Doc`. ~~Callable[[List[Doc], FullTransformerBatch], None]~~ | - -### List {#list} - -> #### Markdown -> -> ```markdown_ -> 1. One -> 2. Two -> ``` -> -> #### JSX -> -> ```markup ->
    ->
  1. One
  2. ->
  3. Two
  4. ->
-> ``` - -Lists are available as bulleted and numbered. Markdown lists are transformed -automatically. - -- I am a bulleted list -- I have nice bullets -- Lorem ipsum dolor -- consectetur adipiscing elit - -1. I am an ordered list -2. I have nice numbers -3. Lorem ipsum dolor -4. consectetur adipiscing elit - -### Aside {#aside} - -> #### Markdown -> -> ```markdown_ -> > #### Aside title -> > This is aside text. -> ``` -> -> #### JSX -> -> ```jsx -> -> ``` - -Asides can be used to display additional notes and content in the right-hand -column. Asides can contain text, code and other elements if needed. Visually, -asides are moved to the side on the X-axis, and displayed at the same level they -were inserted. On small screens, they collapse and are rendered in their -original position, in between the text. - -To make them easier to use in Markdown, paragraphs formatted as blockquotes will -turn into asides by default. Level 4 headlines (with a leading `####`) will -become aside titles. - -### Code Block {#code-block} - -> #### Markdown -> -> ````markdown_ -> ```python -> ### This is a title -> import spacy -> ``` -> ```` -> -> #### JSX -> -> ```jsx -> -> import spacy -> -> ``` - -Code blocks use the [Prism](http://prismjs.com/) syntax highlighter with a -custom theme. The language can be set individually on each block, and defaults -to raw text with no highlighting. An optional label can be added as the first -line with the prefix `####` (Python-like) and `///` (JavaScript-like). the -indented block as plain text and preserve whitespace. - -```python -### Using spaCy -import spacy -nlp = spacy.load("en_core_web_sm") -doc = nlp("This is a sentence.") -for token in doc: - print(token.text, token.pos_) -``` - -Code blocks and also specify an optional range of line numbers to highlight by -adding `{highlight="..."}` to the headline. Acceptable ranges are spans like -`5-7`, but also `5-7,10` or `5-7,10,13-14`. - -> #### Markdown -> -> ````markdown_ -> ```python -> ### This is a title {highlight="1-2"} -> import spacy -> nlp = spacy.load("en_core_web_sm") -> ``` -> ```` - -```python -### Using the matcher {highlight="5-7"} -import spacy -from spacy.matcher import Matcher - -nlp = spacy.load('en_core_web_sm') -matcher = Matcher(nlp.vocab) -pattern = [{"LOWER": "hello"}, {"IS_PUNCT": True}, {"LOWER": "world"}] -matcher.add("HelloWorld", None, pattern) -doc = nlp("Hello, world! Hello world!") -matches = matcher(doc) -``` - -Adding `{executable="true"}` to the title turns the code into an executable -block, powered by [Binder](https://mybinder.org) and -[Juniper](https://github.com/ines/juniper). If JavaScript is disabled, the -interactive widget defaults to a regular code block. - -> #### Markdown -> -> ````markdown_ -> ```python -> ### {executable="true"} -> import spacy -> nlp = spacy.load("en_core_web_sm") -> ``` -> ```` - -```python -### {executable="true"} -import spacy -nlp = spacy.load("en_core_web_sm") -doc = nlp("This is a sentence.") -for token in doc: - print(token.text, token.pos_) -``` - -If a code block only contains a URL to a GitHub file, the raw file contents are -embedded automatically and syntax highlighting is applied. The link to the -original file is shown at the top of the widget. - -> #### Markdown -> -> ````markdown_ -> ```python -> https://github.com/... -> ``` -> ```` -> -> #### JSX -> -> ```jsx -> -> ``` - -```python -https://github.com/explosion/spaCy/tree/master/spacy/language.py -``` - -### Infobox {#infobox} - -import Infobox from 'components/infobox' - -> #### JSX -> -> ```jsx -> Regular infobox -> This is a warning. -> This is dangerous. -> ``` - -Infoboxes can be used to add notes, updates, warnings or additional information -to a page or section. Semantically, they're implemented and interpreted as an -`aside` element. Infoboxes can take an optional `title` argument, as well as an -optional `variant` (either `"warning"` or `"danger"`). - - - -If needed, an infobox can contain regular text, `inline code`, lists and other -blocks. - - - - - -If needed, an infobox can contain regular text, `inline code`, lists and other -blocks. - - - - - -If needed, an infobox can contain regular text, `inline code`, lists and other -blocks. - - - -### Accordion {#accordion} - -import Accordion from 'components/accordion' - -> #### JSX -> -> ```jsx -> -> Accordion content goes here. -> -> ``` - -Accordions are collapsible sections that are mostly used for lengthy tables, -like the tag and label annotation schemes for different languages. They all need -to be presented – but chances are the user doesn't actually care about _all_ of -them, especially not at the same time. So it's fairly reasonable to hide them -begin a click. This particular implementation was inspired by the amazing -[Inclusive Components blog](https://inclusive-components.design/collapsible-sections/). - - - -Lorem ipsum dolor sit amet, consectetur adipiscing elit. Quisque enim ante, -pretium a orci eget, varius dignissim augue. Nam eu dictum mauris, id tincidunt -nisi. Integer commodo pellentesque tincidunt. Nam at turpis finibus tortor -gravida sodales tincidunt sit amet est. Nullam euismod arcu in tortor auctor, -sit amet dignissim justo congue. - - - ## Setup and installation {#setup} Before running the setup, make sure your versions of @@ -591,54 +77,6 @@ docker build -t spacy-io . This will take some time, so if you want to use the prebuilt image you'll save a bit of time. -## Markdown reference {#markdown} - -All page content and page meta lives in the `.md` files in the `/docs` -directory. The frontmatter block at the top of each file defines the page title -and other settings like the sidebar menu. - -````markdown ---- -title: Page title ---- - -## Headline starting a section {#some_id} - -This is a regular paragraph with a [link](https://spacy.io) and **bold text**. - -> #### This is an aside title -> -> This is aside text. - -### Subheadline - -| Header 1 | Header 2 | -| -------- | -------- | -| Column 1 | Column 2 | - -```python -### Code block title {highlight="2-3"} -import spacy -nlp = spacy.load("en_core_web_sm") -doc = nlp("Hello world") -``` - - - -This is content in the infobox. - - -```` - -In addition to the native markdown elements, you can use the components -[``][infobox], [``][accordion], [``][abbr] and -[``][tag] via their JSX syntax. - -[infobox]: https://spacy.io/styleguide#infobox -[accordion]: https://spacy.io/styleguide#accordion -[abbr]: https://spacy.io/styleguide#abbr -[tag]: https://spacy.io/styleguide#tag - ## Project structure {#structure} ```yaml @@ -671,49 +109,3 @@ In addition to the native markdown elements, you can use the components ├── gatsby-node.js # Node-specific hooks for Gatsby └── package.json # package settings and dependencies ``` - -## Editorial {#editorial} - -- "spaCy" should always be spelled with a lowercase "s" and a capital "C", - unless it specifically refers to the Python package or Python import `spacy` - (in which case it should be formatted as code). - - ✅ spaCy is a library for advanced NLP in Python. - - ❌ Spacy is a library for advanced NLP in Python. - - ✅ First, you need to install the `spacy` package from pip. -- Mentions of code, like function names, classes, variable names etc. in inline - text should be formatted as `code`. - - ✅ "Calling the `nlp` object on a text returns a `Doc`." -- Objects that have pages in the [API docs](/api) should be linked – for - example, [`Doc`](/api/doc) or [`Language.to_disk`](/api/language#to_disk). The - mentions should still be formatted as code within the link. Links pointing to - the API docs will automatically receive a little icon. However, if a paragraph - includes many references to the API, the links can easily get messy. In that - case, we typically only link the first mention of an object and not any - subsequent ones. - - ✅ The [`Span`](/api/span) and [`Token`](/api/token) objects are views of a - [`Doc`](/api/doc). [`Span.as_doc`](/api/span#as_doc) creates a `Doc` object - from a `Span`. - - ❌ The [`Span`](/api/span) and [`Token`](/api/token) objects are views of a - [`Doc`](/api/doc). [`Span.as_doc`](/api/span#as_doc) creates a - [`Doc`](/api/doc) object from a [`Span`](/api/span). - -* Other things we format as code are: references to trained pipeline packages - like `en_core_web_sm` or file names like `code.py` or `meta.json`. - - - ✅ After training, the `config.cfg` is saved to disk. - -* [Type annotations](#type-annotations) are a special type of code formatting, - expressed by wrapping the text in `~~` instead of backticks. The result looks - like this: ~~List[Doc]~~. All references to known types will be linked - automatically. - - - ✅ The model has the input type ~~List[Doc]~~ and it outputs a - ~~List[Array2d]~~. - -* We try to keep links meaningful but short. - - ✅ For details, see the usage guide on - [training with custom code](/usage/training#custom-code). - - ❌ For details, see - [the usage guide on training with custom code](/usage/training#custom-code). - - ❌ For details, see the usage guide on training with custom code - [here](/usage/training#custom-code). From ecbf052abde2ab9373be1d7652e20d50b096e49d Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Marcus=20Bl=C3=A4ttermann?= Date: Tue, 22 Nov 2022 16:00:08 +0100 Subject: [PATCH 097/161] Remove `README.md` content from styleguide --- website/docs/styleguide.md | 112 ------------------------------------- 1 file changed, 112 deletions(-) diff --git a/website/docs/styleguide.md b/website/docs/styleguide.md index b2f640543..dbc5258db 100644 --- a/website/docs/styleguide.md +++ b/website/docs/styleguide.md @@ -1,16 +1,3 @@ - - -# spacy.io website and docs - -![Netlify Status](https://api.netlify.com/api/v1/badges/d65fe97d-99ab-47f8-a339-1d8987251da0/deploy-status) - -_This page contains the documentation and styleguide for the spaCy website. Its -rendered version is available at https://spacy.io/styleguide._ - ---- - - - The [spacy.io](https://spacy.io) website is implemented using [Gatsby](https://www.gatsbyjs.org) with [Remark](https://github.com/remarkjs/remark) and [MDX](https://mdxjs.com/). This @@ -525,72 +512,6 @@ sit amet dignissim justo congue. -## Setup and installation {#setup} - -Before running the setup, make sure your versions of -[Node](https://nodejs.org/en/) and [npm](https://www.npmjs.com/) are up to date. -Node v10.15 or later is required. - -```bash -# Clone the repository -git clone https://github.com/explosion/spaCy -cd spaCy/website - -# Install Gatsby's command-line tool -npm install --global gatsby-cli - -# Install the dependencies -npm install - -# Start the development server -npm run dev -``` - -If you are planning on making edits to the site, you should also set up the -[Prettier](https://prettier.io/) code formatter. It takes care of formatting -Markdown and other files automatically. -[See here](https://prettier.io/docs/en/editors.html) for the available -extensions for your code editor. The -[`.prettierrc`](https://github.com/explosion/spaCy/tree/master/website/.prettierrc) -file in the root defines the settings used in this codebase. - -## Building & developing the site with Docker {#docker} - -Sometimes it's hard to get a local environment working due to rapid updates to -node dependencies, so it may be easier to use docker for building the docs. - -If you'd like to do this, **be sure you do _not_ include your local -`node_modules` folder**, since there are some dependencies that need to be built -for the image system. Rename it before using. - -```bash -docker run -it \ - -v $(pwd):/spacy-io/website \ - -p 8000:8000 \ - ghcr.io/explosion/spacy-io \ - gatsby develop -H 0.0.0.0 -``` - -This will allow you to access the built website at http://0.0.0.0:8000/ in your -browser, and still edit code in your editor while having the site reflect those -changes. - -**Note**: If you're working on a Mac with an M1 processor, you might see -segfault errors from `qemu` if you use the default image. To fix this use the -`arm64` tagged image in the `docker run` command -(ghcr.io/explosion/spacy-io:arm64). - -### Building the Docker image {#docker-build} - -If you'd like to build the image locally, you can do so like this: - -```bash -docker build -t spacy-io . -``` - -This will take some time, so if you want to use the prebuilt image you'll save a -bit of time. - ## Markdown reference {#markdown} All page content and page meta lives in the `.md` files in the `/docs` @@ -639,39 +560,6 @@ In addition to the native markdown elements, you can use the components [abbr]: https://spacy.io/styleguide#abbr [tag]: https://spacy.io/styleguide#tag -## Project structure {#structure} - -```yaml -### Directory structure -├── docs # the actual markdown content -├── meta # JSON-formatted site metadata -| ├── languages.json # supported languages and statistical models -| ├── sidebars.json # sidebar navigations for different sections -| ├── site.json # general site metadata -| ├── type-annotations.json # Type annotations -| └── universe.json # data for the spaCy universe section -├── public # compiled site -├── setup # Jinja setup -├── src # source -| ├── components # React components -| ├── fonts # webfonts -| ├── images # images used in the layout -| ├── plugins # custom plugins to transform Markdown -| ├── styles # CSS modules and global styles -| ├── templates # page layouts -| | ├── docs.js # layout template for documentation pages -| | ├── index.js # global layout template -| | ├── models.js # layout template for model pages -| | └── universe.js # layout templates for universe -| └── widgets # non-reusable components with content, e.g. changelog -├── .eslintrc.json # ESLint config file -├── .prettierrc # Prettier config file -├── gatsby-browser.js # browser-specific hooks for Gatsby -├── gatsby-config.js # Gatsby configuration -├── gatsby-node.js # Node-specific hooks for Gatsby -└── package.json # package settings and dependencies -``` - ## Editorial {#editorial} - "spaCy" should always be spelled with a lowercase "s" and a capital "C", From f1ddac187de7e67923e8ee63192787179f70fa4c Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Wed, 23 Nov 2022 18:51:31 +0900 Subject: [PATCH 098/161] Remove unused error object (#11837) --- spacy/language.py | 8 -------- 1 file changed, 8 deletions(-) diff --git a/spacy/language.py b/spacy/language.py index 836f3abf9..2789b6690 100644 --- a/spacy/language.py +++ b/spacy/language.py @@ -784,14 +784,6 @@ class Language: factory_name, source, name=name ) else: - if not self.has_factory(factory_name): - err = Errors.E002.format( - name=factory_name, - opts=", ".join(self.factory_names), - method="add_pipe", - lang=util.get_object_name(self), - lang_code=self.lang, - ) pipe_component = self.create_pipe( factory_name, name=name, From 8271cfb4cd8a907ff11f12841ee1ceb171b3f528 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Wed, 23 Nov 2022 19:03:18 +0900 Subject: [PATCH 099/161] Remove Learning Path spaCy (#11846) --- website/meta/universe.json | 11 ----------- 1 file changed, 11 deletions(-) diff --git a/website/meta/universe.json b/website/meta/universe.json index 57bf2d3e3..97b53e9c5 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -1993,17 +1993,6 @@ }, "category": ["books"] }, - { - "type": "education", - "id": "learning-path-spacy", - "title": "Learning Path: Mastering spaCy for Natural Language Processing", - "slogan": "O'Reilly, 2017", - "description": "spaCy, a fast, user-friendly library for teaching computers to understand text, simplifies NLP techniques, such as speech tagging and syntactic dependencies, so you can easily extract information, attributes, and objects from massive amounts of text to then document, measure, and analyze. This Learning Path is a hands-on introduction to using spaCy to discover insights through natural language processing. While end-to-end natural language processing solutions can be complex, you’ll learn the linguistics, algorithms, and machine learning skills to get the job done.", - "url": "https://www.safaribooksonline.com/library/view/learning-path-mastering/9781491986653/", - "thumb": "https://i.imgur.com/9MIgMAc.jpg", - "author": "Aaron Kramer", - "category": ["courses"] - }, { "type": "education", "id": "introduction-into-spacy-3", From e79910d57ec4f2f5d02e0c8d137a7ae8cd608135 Mon Sep 17 00:00:00 2001 From: Edward <43848523+thomashacker@users.noreply.github.com> Date: Wed, 23 Nov 2022 13:09:32 +0100 Subject: [PATCH 100/161] Remove sentiment extension (#11722) * remove sentiment attribute * remove sentiment from docs * add test for backwards compatibility * replace from_disk with from_bytes * Fix docs and format file * Fix formatting --- spacy/lexeme.pyi | 1 - spacy/lexeme.pyx | 13 ----------- spacy/tests/README.md | 2 +- spacy/tests/doc/test_doc_api.py | 13 ++++++++--- spacy/tests/doc/test_span.py | 25 ---------------------- spacy/tests/matcher/test_matcher_api.py | 3 --- spacy/tokens/doc.pxd | 2 -- spacy/tokens/doc.pyi | 1 - spacy/tokens/doc.pyx | 5 ----- spacy/tokens/span.pyi | 2 -- spacy/tokens/span.pyx | 10 --------- spacy/tokens/token.pyi | 2 -- spacy/tokens/token.pyx | 8 ------- website/docs/api/doc.md | 2 -- website/docs/api/lexeme.md | 1 - website/docs/api/span.md | 1 - website/docs/api/token.md | 1 - website/docs/usage/processing-pipelines.md | 2 +- website/docs/usage/rule-based-matching.md | 14 +++++++----- 19 files changed, 21 insertions(+), 87 deletions(-) diff --git a/spacy/lexeme.pyi b/spacy/lexeme.pyi index 4fcaa82cf..4942b18aa 100644 --- a/spacy/lexeme.pyi +++ b/spacy/lexeme.pyi @@ -20,7 +20,6 @@ class Lexeme: def vector_norm(self) -> float: ... vector: Floats1d rank: int - sentiment: float @property def orth_(self) -> str: ... @property diff --git a/spacy/lexeme.pyx b/spacy/lexeme.pyx index 6c66effde..73bf28dc2 100644 --- a/spacy/lexeme.pyx +++ b/spacy/lexeme.pyx @@ -173,19 +173,6 @@ cdef class Lexeme: def __set__(self, value): self.c.id = value - property sentiment: - """RETURNS (float): A scalar value indicating the positivity or - negativity of the lexeme.""" - def __get__(self): - sentiment_table = self.vocab.lookups.get_table("lexeme_sentiment", {}) - return sentiment_table.get(self.c.orth, 0.0) - - def __set__(self, float x): - if "lexeme_sentiment" not in self.vocab.lookups: - self.vocab.lookups.add_table("lexeme_sentiment") - sentiment_table = self.vocab.lookups.get_table("lexeme_sentiment") - sentiment_table[self.c.orth] = x - @property def orth_(self): """RETURNS (str): The original verbatim text of the lexeme diff --git a/spacy/tests/README.md b/spacy/tests/README.md index 82fabcc77..f3c96a39e 100644 --- a/spacy/tests/README.md +++ b/spacy/tests/README.md @@ -40,7 +40,7 @@ py.test spacy/tests/tokenizer/test_exceptions.py::test_tokenizer_handles_emoji # To keep the behavior of the tests consistent and predictable, we try to follow a few basic conventions: -- **Test names** should follow a pattern of `test_[module]_[tested behaviour]`. For example: `test_tokenizer_keeps_email` or `test_spans_override_sentiment`. +- **Test names** should follow a pattern of `test_[module]_[tested behaviour]`. For example: `test_tokenizer_keeps_email`. - If you're testing for a bug reported in a specific issue, always create a **regression test**. Regression tests should be named `test_issue[ISSUE NUMBER]` and live in the [`regression`](regression) directory. - Only use `@pytest.mark.xfail` for tests that **should pass, but currently fail**. To test for desired negative behavior, use `assert not` in your test. - Very **extensive tests** that take a long time to run should be marked with `@pytest.mark.slow`. If your slow test is testing important behavior, consider adding an additional simpler version. diff --git a/spacy/tests/doc/test_doc_api.py b/spacy/tests/doc/test_doc_api.py index 38003dea9..f77d54493 100644 --- a/spacy/tests/doc/test_doc_api.py +++ b/spacy/tests/doc/test_doc_api.py @@ -380,9 +380,7 @@ def test_doc_api_serialize(en_tokenizer, text): assert [t.text for t in tokens] == [t.text for t in new_tokens] assert [t.orth for t in tokens] == [t.orth for t in new_tokens] - new_tokens = Doc(tokens.vocab).from_bytes( - tokens.to_bytes(exclude=["sentiment"]), exclude=["sentiment"] - ) + new_tokens = Doc(tokens.vocab).from_bytes(tokens.to_bytes()) assert tokens.text == new_tokens.text assert [t.text for t in tokens] == [t.text for t in new_tokens] assert [t.orth for t in tokens] == [t.orth for t in new_tokens] @@ -990,3 +988,12 @@ def test_doc_spans_setdefault(en_tokenizer): assert len(doc.spans["key2"]) == 1 doc.spans.setdefault("key3", default=SpanGroup(doc, spans=[doc[0:1], doc[1:2]])) assert len(doc.spans["key3"]) == 2 + + +def test_doc_sentiment_from_bytes_v3_to_v4(): + """Test if a doc with sentiment attribute created in v3.x works with '.from_bytes' in v4.x without throwing errors. The sentiment attribute was removed in v4""" + doc_bytes = b"\x89\xa4text\xa5happy\xaaarray_head\x9fGQACKOLMN\xcd\x01\xc4\xcd\x01\xc6I\xcd\x01\xc5JP\xaaarray_body\x85\xc4\x02nd\xc3\xc4\x04type\xa3 FloatsXd: ... @property - def sentiment(self) -> float: ... - @property def text(self) -> str: ... @property def text_with_ws(self) -> str: ... diff --git a/spacy/tokens/span.pyx b/spacy/tokens/span.pyx index 89d9727e9..5530dd127 100644 --- a/spacy/tokens/span.pyx +++ b/spacy/tokens/span.pyx @@ -566,16 +566,6 @@ cdef class Span: return None return self.doc.tensor[self.start : self.end] - @property - def sentiment(self): - """RETURNS (float): A scalar value indicating the positivity or - negativity of the span. - """ - if "sentiment" in self.doc.user_span_hooks: - return self.doc.user_span_hooks["sentiment"](self) - else: - return sum([token.sentiment for token in self]) / len(self) - @property def text(self): """RETURNS (str): The original verbatim text of the span.""" diff --git a/spacy/tokens/token.pyi b/spacy/tokens/token.pyi index bd585d034..6de7e984a 100644 --- a/spacy/tokens/token.pyi +++ b/spacy/tokens/token.pyi @@ -79,8 +79,6 @@ class Token: @property def prob(self) -> float: ... @property - def sentiment(self) -> float: ... - @property def lang(self) -> int: ... @property def idx(self) -> int: ... diff --git a/spacy/tokens/token.pyx b/spacy/tokens/token.pyx index cee903f48..64c707acd 100644 --- a/spacy/tokens/token.pyx +++ b/spacy/tokens/token.pyx @@ -283,14 +283,6 @@ cdef class Token: """RETURNS (float): Smoothed log probability estimate of token type.""" return self.vocab[self.c.lex.orth].prob - @property - def sentiment(self): - """RETURNS (float): A scalar value indicating the positivity or - negativity of the token.""" - if "sentiment" in self.doc.user_token_hooks: - return self.doc.user_token_hooks["sentiment"](self) - return self.vocab[self.c.lex.orth].sentiment - @property def lang(self): """RETURNS (uint64): ID of the language of the parent document's diff --git a/website/docs/api/doc.md b/website/docs/api/doc.md index 19eb5052e..433134278 100644 --- a/website/docs/api/doc.md +++ b/website/docs/api/doc.md @@ -761,7 +761,6 @@ The L2 norm of the document's vector representation. | `user_data` | A generic storage area, for user custom data. ~~Dict[str, Any]~~ | | `lang` 2.1 | Language of the document's vocabulary. ~~int~~ | | `lang_` 2.1 | Language of the document's vocabulary. ~~str~~ | -| `sentiment` | The document's positivity/negativity score, if available. ~~float~~ | | `user_hooks` | A dictionary that allows customization of the `Doc`'s properties. ~~Dict[str, Callable]~~ | | `user_token_hooks` | A dictionary that allows customization of properties of `Token` children. ~~Dict[str, Callable]~~ | | `user_span_hooks` | A dictionary that allows customization of properties of `Span` children. ~~Dict[str, Callable]~~ | @@ -785,7 +784,6 @@ serialization by passing in the string names via the `exclude` argument. | Name | Description | | ------------------ | --------------------------------------------- | | `text` | The value of the `Doc.text` attribute. | -| `sentiment` | The value of the `Doc.sentiment` attribute. | | `tensor` | The value of the `Doc.tensor` attribute. | | `user_data` | The value of the `Doc.user_data` dictionary. | | `user_data_keys` | The keys of the `Doc.user_data` dictionary. | diff --git a/website/docs/api/lexeme.md b/website/docs/api/lexeme.md index c5d4b7544..db1aba7aa 100644 --- a/website/docs/api/lexeme.md +++ b/website/docs/api/lexeme.md @@ -161,4 +161,3 @@ The L2 norm of the lexeme's vector representation. | `lang_` | Language of the parent vocabulary. ~~str~~ | | `prob` | Smoothed log probability estimate of the lexeme's word type (context-independent entry in the vocabulary). ~~float~~ | | `cluster` | Brown cluster ID. ~~int~~ | -| `sentiment` | A scalar value indicating the positivity or negativity of the lexeme. ~~float~~ | diff --git a/website/docs/api/span.md b/website/docs/api/span.md index be522c31f..9bca0c410 100644 --- a/website/docs/api/span.md +++ b/website/docs/api/span.md @@ -565,5 +565,4 @@ overlaps with will be returned. | `ent_id_` | Alias for `id_`: the span's ID. ~~str~~ | | `id` | The hash value of the span's ID. ~~int~~ | | `id_` | The span's ID. ~~str~~ | -| `sentiment` | A scalar value indicating the positivity or negativity of the span. ~~float~~ | | `_` | User space for adding custom [attribute extensions](/usage/processing-pipelines#custom-components-attributes). ~~Underscore~~ | diff --git a/website/docs/api/token.md b/website/docs/api/token.md index 73447e4d3..6c35d47b1 100644 --- a/website/docs/api/token.md +++ b/website/docs/api/token.md @@ -470,7 +470,6 @@ The L2 norm of the token's vector representation. | `lang_` | Language of the parent document's vocabulary. ~~str~~ | | `prob` | Smoothed log probability estimate of token's word type (context-independent entry in the vocabulary). ~~float~~ | | `idx` | The character offset of the token within the parent document. ~~int~~ | -| `sentiment` | A scalar value indicating the positivity or negativity of the token. ~~float~~ | | `lex_id` | Sequential ID of the token's lexical type, used to index into tables, e.g. for word vectors. ~~int~~ | | `rank` | Sequential ID of the token's lexical type, used to index into tables, e.g. for word vectors. ~~int~~ | | `cluster` | Brown cluster ID. ~~int~~ | diff --git a/website/docs/usage/processing-pipelines.md b/website/docs/usage/processing-pipelines.md index 2463b523f..67c88700d 100644 --- a/website/docs/usage/processing-pipelines.md +++ b/website/docs/usage/processing-pipelines.md @@ -1400,7 +1400,7 @@ separation and makes it easier to ensure backwards compatibility. For example, if you've implemented your own `.coref` property and spaCy claims it one day, it'll break your code. Similarly, just by looking at the code, you'll immediately know what's built-in and what's custom – for example, -`doc.sentiment` is spaCy, while `doc._.sent_score` isn't. +`doc.lang` is spaCy, while `doc._.language` isn't. diff --git a/website/docs/usage/rule-based-matching.md b/website/docs/usage/rule-based-matching.md index 8e55d54d6..77461c495 100644 --- a/website/docs/usage/rule-based-matching.md +++ b/website/docs/usage/rule-based-matching.md @@ -776,6 +776,9 @@ whitespace, making them easy to match as well. ### {executable="true"} from spacy.lang.en import English from spacy.matcher import Matcher +from spacy.tokens import Doc + +Doc.set_extension("sentiment", default=0.0) nlp = English() # We only want the tokenizer, so no need to load a pipeline matcher = Matcher(nlp.vocab) @@ -791,9 +794,9 @@ neg_patterns = [[{"ORTH": emoji}] for emoji in neg_emoji] def label_sentiment(matcher, doc, i, matches): match_id, start, end = matches[i] if doc.vocab.strings[match_id] == "HAPPY": # Don't forget to get string! - doc.sentiment += 0.1 # Add 0.1 for positive sentiment + doc._.sentiment += 0.1 # Add 0.1 for positive sentiment elif doc.vocab.strings[match_id] == "SAD": - doc.sentiment -= 0.1 # Subtract 0.1 for negative sentiment + doc._.sentiment -= 0.1 # Subtract 0.1 for negative sentiment matcher.add("HAPPY", pos_patterns, on_match=label_sentiment) # Add positive pattern matcher.add("SAD", neg_patterns, on_match=label_sentiment) # Add negative pattern @@ -823,16 +826,17 @@ the emoji span will make it available as `span._.emoji_desc`. ```python from emojipedia import Emojipedia # Installation: pip install emojipedia -from spacy.tokens import Span # Get the global Span object +from spacy.tokens import Doc, Span # Get the global Doc and Span object Span.set_extension("emoji_desc", default=None) # Register the custom attribute +Doc.set_extension("sentiment", default=0.0) def label_sentiment(matcher, doc, i, matches): match_id, start, end = matches[i] if doc.vocab.strings[match_id] == "HAPPY": # Don't forget to get string! - doc.sentiment += 0.1 # Add 0.1 for positive sentiment + doc._.sentiment += 0.1 # Add 0.1 for positive sentiment elif doc.vocab.strings[match_id] == "SAD": - doc.sentiment -= 0.1 # Subtract 0.1 for negative sentiment + doc._.sentiment -= 0.1 # Subtract 0.1 for negative sentiment span = doc[start:end] emoji = Emojipedia.search(span[0].text) # Get data for emoji span._.emoji_desc = emoji.title # Assign emoji description From 5ea14af32b4203bc3087dec63091e63fe4ac95b7 Mon Sep 17 00:00:00 2001 From: Madeesh Kannan Date: Wed, 23 Nov 2022 17:54:58 +0100 Subject: [PATCH 101/161] Add `training.before_update` callback (#11739) * Add `training.before_update` callback This callback can be used to implement training paradigms like gradual (un)freezing of components (e.g: the Transformer) after a certain number of training steps to mitigate catastrophic forgetting during fine-tuning. * Fix type annotation, default config value * Generalize arguments passed to the callback * Update schema * Pass `epoch` to callback, rename `current_step` to `step` * Add test * Simplify test * Replace config string with `spacy.blank` * Apply suggestions from code review Co-authored-by: Adriane Boyd * Cleanup imports Co-authored-by: Adriane Boyd --- spacy/default_config.cfg | 2 ++ spacy/schemas.py | 1 + spacy/tests/training/test_training.py | 40 ++++++++++++++++++++++++++- spacy/training/loop.py | 6 ++++ website/docs/api/data-formats.md | 1 + 5 files changed, 49 insertions(+), 1 deletion(-) diff --git a/spacy/default_config.cfg b/spacy/default_config.cfg index 86a72926e..694fb732f 100644 --- a/spacy/default_config.cfg +++ b/spacy/default_config.cfg @@ -90,6 +90,8 @@ dev_corpus = "corpora.dev" train_corpus = "corpora.train" # Optional callback before nlp object is saved to disk after training before_to_disk = null +# Optional callback that is invoked at the start of each training step +before_update = null [training.logger] @loggers = "spacy.ConsoleLogger.v1" diff --git a/spacy/schemas.py b/spacy/schemas.py index c824d76b9..e48fe1702 100644 --- a/spacy/schemas.py +++ b/spacy/schemas.py @@ -329,6 +329,7 @@ class ConfigSchemaTraining(BaseModel): frozen_components: List[str] = Field(..., title="Pipeline components that shouldn't be updated during training") annotating_components: List[str] = Field(..., title="Pipeline components that should set annotations during training") before_to_disk: Optional[Callable[["Language"], "Language"]] = Field(..., title="Optional callback to modify nlp object after training, before it's saved to disk") + before_update: Optional[Callable[["Language", Dict[str, Any]], None]] = Field(..., title="Optional callback that is invoked at the start of each training step") # fmt: on class Config: diff --git a/spacy/tests/training/test_training.py b/spacy/tests/training/test_training.py index 4384a796d..7933ea31f 100644 --- a/spacy/tests/training/test_training.py +++ b/spacy/tests/training/test_training.py @@ -2,6 +2,7 @@ import random import numpy import pytest +import spacy import srsly from spacy.lang.en import English from spacy.tokens import Doc, DocBin @@ -11,9 +12,10 @@ from spacy.training import offsets_to_biluo_tags from spacy.training.alignment_array import AlignmentArray from spacy.training.align import get_alignments from spacy.training.converters import json_to_docs +from spacy.training.loop import train_while_improving from spacy.util import get_words_and_spaces, load_model_from_path, minibatch from spacy.util import load_config_from_str -from thinc.api import compounding +from thinc.api import compounding, Adam from ..util import make_tempdir @@ -1112,3 +1114,39 @@ def test_retokenized_docs(doc): retokenizer.merge(doc1[0:2]) retokenizer.merge(doc1[5:7]) assert example.get_aligned("ORTH", as_string=True) == expected2 + + +def test_training_before_update(doc): + def before_update(nlp, args): + assert args["step"] == 0 + assert args["epoch"] == 1 + + # Raise an error here as the rest of the loop + # will not run to completion due to uninitialized + # models. + raise ValueError("ran_before_update") + + def generate_batch(): + yield 1, [Example(doc, doc)] + + nlp = spacy.blank("en") + nlp.add_pipe("tagger") + optimizer = Adam() + generator = train_while_improving( + nlp, + optimizer, + generate_batch(), + lambda: None, + dropout=0.1, + eval_frequency=100, + accumulate_gradient=10, + patience=10, + max_steps=100, + exclude=[], + annotating_components=[], + before_update=before_update, + ) + + with pytest.raises(ValueError, match="ran_before_update"): + for _ in generator: + pass diff --git a/spacy/training/loop.py b/spacy/training/loop.py index 06372cbb0..885257772 100644 --- a/spacy/training/loop.py +++ b/spacy/training/loop.py @@ -59,6 +59,7 @@ def train( batcher = T["batcher"] train_logger = T["logger"] before_to_disk = create_before_to_disk_callback(T["before_to_disk"]) + before_update = T["before_update"] # Helper function to save checkpoints. This is a closure for convenience, # to avoid passing in all the args all the time. @@ -89,6 +90,7 @@ def train( eval_frequency=T["eval_frequency"], exclude=frozen_components, annotating_components=annotating_components, + before_update=before_update, ) clean_output_dir(output_path) stdout.write(msg.info(f"Pipeline: {nlp.pipe_names}") + "\n") @@ -150,6 +152,7 @@ def train_while_improving( max_steps: int, exclude: List[str], annotating_components: List[str], + before_update: Optional[Callable[["Language", Dict[str, Any]], None]], ): """Train until an evaluation stops improving. Works as a generator, with each iteration yielding a tuple `(batch, info, is_best_checkpoint)`, @@ -198,6 +201,9 @@ def train_while_improving( words_seen = 0 start_time = timer() for step, (epoch, batch) in enumerate(train_data): + if before_update: + before_update_args = {"step": step, "epoch": epoch} + before_update(nlp, before_update_args) dropout = next(dropouts) # type: ignore for subbatch in subdivide_batch(batch, accumulate_gradient): nlp.update( diff --git a/website/docs/api/data-formats.md b/website/docs/api/data-formats.md index ce06c4ea8..768844cf3 100644 --- a/website/docs/api/data-formats.md +++ b/website/docs/api/data-formats.md @@ -186,6 +186,7 @@ process that are used when you run [`spacy train`](/api/cli#train). | `accumulate_gradient` | Whether to divide the batch up into substeps. Defaults to `1`. ~~int~~ | | `batcher` | Callable that takes an iterator of [`Doc`](/api/doc) objects and yields batches of `Doc`s. Defaults to [`batch_by_words`](/api/top-level#batch_by_words). ~~Callable[[Iterator[Doc], Iterator[List[Doc]]]]~~ | | `before_to_disk` | Optional callback to modify `nlp` object right before it is saved to disk during and after training. Can be used to remove or reset config values or disable components. Defaults to `null`. ~~Optional[Callable[[Language], Language]]~~ | +| `before_update` | Optional callback that is invoked at the start of each training step with the `nlp` object and a `Dict` containing the following entries: `step`, `epoch`. Can be used to make deferred changes to components. Defaults to `null`. ~~Optional[Callable[[Language, Dict[str, Any]], None]]~~ | | `dev_corpus` | Dot notation of the config location defining the dev corpus. Defaults to `corpora.dev`. ~~str~~ | | `dropout` | The dropout rate. Defaults to `0.1`. ~~float~~ | | `eval_frequency` | How often to evaluate during training (steps). Defaults to `200`. ~~int~~ | From 8f062b849c846ecdf59263c82632b9fbd4eca9d0 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Thu, 24 Nov 2022 16:03:42 +0100 Subject: [PATCH 102/161] Fix Matcher cython profile=True header (#11867) --- spacy/matcher/matcher.pyx | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/matcher/matcher.pyx b/spacy/matcher/matcher.pyx index e1dba01a2..c4a057ca0 100644 --- a/spacy/matcher/matcher.pyx +++ b/spacy/matcher/matcher.pyx @@ -1,4 +1,4 @@ -# cython: infer_types=True, cython: profile=True +# cython: infer_types=True, profile=True from typing import List, Iterable from libcpp.vector cimport vector From 30d31fd335306921aa7e8be081ecb396880aa14b Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Fri, 25 Nov 2022 11:12:46 +0100 Subject: [PATCH 103/161] Update Russian and Ukrainian lemmatizers (#11811) * pymorph2 issues #11620, #11626, #11625: - #11620: pymorphy2_lookup - #11626: handle multiple forms pointing to the same normal form + handling empty POS tag - #11625: matching DET that are labelled as PRON by pymorhp2 * Move lemmatizer algorithm changes back into RussianLemmatizer * Fix uk pymorphy3_lookup mode init * Move and update tests for ru/uk lookup lemmatizer modes * Fix typo * Remove traces of previous behavior for uninflected POS * Refactor to private generic-looking pymorphy methods * Remove xfailed uk lemmatizer cases * Update spacy/lang/ru/lemmatizer.py Co-authored-by: Richard Hudson Co-authored-by: Dmytro S Lituiev Co-authored-by: Richard Hudson --- spacy/lang/ru/lemmatizer.py | 51 ++++++++++++++++++-------- spacy/lang/uk/lemmatizer.py | 2 +- spacy/tests/conftest.py | 18 ++++----- spacy/tests/lang/ru/test_lemmatizer.py | 15 ++++++++ spacy/tests/lang/uk/test_lemmatizer.py | 18 ++++++--- 5 files changed, 73 insertions(+), 31 deletions(-) diff --git a/spacy/lang/ru/lemmatizer.py b/spacy/lang/ru/lemmatizer.py index c37a3a91a..f4a35de38 100644 --- a/spacy/lang/ru/lemmatizer.py +++ b/spacy/lang/ru/lemmatizer.py @@ -28,34 +28,39 @@ class RussianLemmatizer(Lemmatizer): from pymorphy2 import MorphAnalyzer except ImportError: raise ImportError( - "The Russian lemmatizer mode 'pymorphy2' requires the " - "pymorphy2 library. Install it with: pip install pymorphy2" + "The lemmatizer mode 'pymorphy2' requires the " + "pymorphy2 library and dictionaries. Install them with: " + "pip install pymorphy2" + "# for Ukrainian dictionaries:" + "pip install pymorphy2-dicts-uk" ) from None if getattr(self, "_morph", None) is None: - self._morph = MorphAnalyzer() - elif mode == "pymorphy3": + self._morph = MorphAnalyzer(lang="ru") + elif mode in {"pymorphy3", "pymorphy3_lookup"}: try: from pymorphy3 import MorphAnalyzer except ImportError: raise ImportError( - "The Russian lemmatizer mode 'pymorphy3' requires the " - "pymorphy3 library. Install it with: pip install pymorphy3" + "The lemmatizer mode 'pymorphy3' requires the " + "pymorphy3 library and dictionaries. Install them with: " + "pip install pymorphy3" + "# for Ukrainian dictionaries:" + "pip install pymorphy3-dicts-uk" ) from None if getattr(self, "_morph", None) is None: - self._morph = MorphAnalyzer() + self._morph = MorphAnalyzer(lang="ru") super().__init__( vocab, model, name, mode=mode, overwrite=overwrite, scorer=scorer ) - def pymorphy2_lemmatize(self, token: Token) -> List[str]: + def _pymorphy_lemmatize(self, token: Token) -> List[str]: string = token.text univ_pos = token.pos_ morphology = token.morph.to_dict() if univ_pos == "PUNCT": return [PUNCT_RULES.get(string, string)] if univ_pos not in ("ADJ", "DET", "NOUN", "NUM", "PRON", "PROPN", "VERB"): - # Skip unchangeable pos - return [string.lower()] + return self._pymorphy_lookup_lemmatize(token) analyses = self._morph.parse(string) filtered_analyses = [] for analysis in analyses: @@ -63,8 +68,10 @@ class RussianLemmatizer(Lemmatizer): # Skip suggested parse variant for unknown word for pymorphy continue analysis_pos, _ = oc2ud(str(analysis.tag)) - if analysis_pos == univ_pos or ( - analysis_pos in ("NOUN", "PROPN") and univ_pos in ("NOUN", "PROPN") + if ( + analysis_pos == univ_pos + or (analysis_pos in ("NOUN", "PROPN") and univ_pos in ("NOUN", "PROPN")) + or ((analysis_pos == "PRON") and (univ_pos == "DET")) ): filtered_analyses.append(analysis) if not len(filtered_analyses): @@ -107,15 +114,27 @@ class RussianLemmatizer(Lemmatizer): dict.fromkeys([analysis.normal_form for analysis in filtered_analyses]) ) - def pymorphy2_lookup_lemmatize(self, token: Token) -> List[str]: + def _pymorphy_lookup_lemmatize(self, token: Token) -> List[str]: string = token.text analyses = self._morph.parse(string) - if len(analyses) == 1: - return [analyses[0].normal_form] + # often multiple forms would derive from the same normal form + # thus check _unique_ normal forms + normal_forms = set([an.normal_form for an in analyses]) + if len(normal_forms) == 1: + return [next(iter(normal_forms))] return [string] + def pymorphy2_lemmatize(self, token: Token) -> List[str]: + return self._pymorphy_lemmatize(token) + + def pymorphy2_lookup_lemmatize(self, token: Token) -> List[str]: + return self._pymorphy_lookup_lemmatize(token) + def pymorphy3_lemmatize(self, token: Token) -> List[str]: - return self.pymorphy2_lemmatize(token) + return self._pymorphy_lemmatize(token) + + def pymorphy3_lookup_lemmatize(self, token: Token) -> List[str]: + return self._pymorphy_lookup_lemmatize(token) def oc2ud(oc_tag: str) -> Tuple[str, Dict[str, str]]: diff --git a/spacy/lang/uk/lemmatizer.py b/spacy/lang/uk/lemmatizer.py index 8337e7328..37015cc2a 100644 --- a/spacy/lang/uk/lemmatizer.py +++ b/spacy/lang/uk/lemmatizer.py @@ -29,7 +29,7 @@ class UkrainianLemmatizer(RussianLemmatizer): ) from None if getattr(self, "_morph", None) is None: self._morph = MorphAnalyzer(lang="uk") - elif mode == "pymorphy3": + elif mode in {"pymorphy3", "pymorphy3_lookup"}: try: from pymorphy3 import MorphAnalyzer except ImportError: diff --git a/spacy/tests/conftest.py b/spacy/tests/conftest.py index 0fc74243d..3a5c8e451 100644 --- a/spacy/tests/conftest.py +++ b/spacy/tests/conftest.py @@ -337,17 +337,17 @@ def ru_tokenizer(): return get_lang_class("ru")().tokenizer -@pytest.fixture +@pytest.fixture(scope="session") def ru_lemmatizer(): pytest.importorskip("pymorphy3") return get_lang_class("ru")().add_pipe("lemmatizer") -@pytest.fixture +@pytest.fixture(scope="session") def ru_lookup_lemmatizer(): - pytest.importorskip("pymorphy2") + pytest.importorskip("pymorphy3") return get_lang_class("ru")().add_pipe( - "lemmatizer", config={"mode": "pymorphy2_lookup"} + "lemmatizer", config={"mode": "pymorphy3_lookup"} ) @@ -423,19 +423,19 @@ def uk_tokenizer(): return get_lang_class("uk")().tokenizer -@pytest.fixture +@pytest.fixture(scope="session") def uk_lemmatizer(): pytest.importorskip("pymorphy3") pytest.importorskip("pymorphy3_dicts_uk") return get_lang_class("uk")().add_pipe("lemmatizer") -@pytest.fixture +@pytest.fixture(scope="session") def uk_lookup_lemmatizer(): - pytest.importorskip("pymorphy2") - pytest.importorskip("pymorphy2_dicts_uk") + pytest.importorskip("pymorphy3") + pytest.importorskip("pymorphy3_dicts_uk") return get_lang_class("uk")().add_pipe( - "lemmatizer", config={"mode": "pymorphy2_lookup"} + "lemmatizer", config={"mode": "pymorphy3_lookup"} ) diff --git a/spacy/tests/lang/ru/test_lemmatizer.py b/spacy/tests/lang/ru/test_lemmatizer.py index e82fd4f8c..9a5a9ad68 100644 --- a/spacy/tests/lang/ru/test_lemmatizer.py +++ b/spacy/tests/lang/ru/test_lemmatizer.py @@ -81,6 +81,7 @@ def test_ru_lemmatizer_punct(ru_lemmatizer): def test_ru_doc_lookup_lemmatization(ru_lookup_lemmatizer): + assert ru_lookup_lemmatizer.mode == "pymorphy3_lookup" words = ["мама", "мыла", "раму"] pos = ["NOUN", "VERB", "NOUN"] morphs = [ @@ -92,3 +93,17 @@ def test_ru_doc_lookup_lemmatization(ru_lookup_lemmatizer): doc = ru_lookup_lemmatizer(doc) lemmas = [token.lemma_ for token in doc] assert lemmas == ["мама", "мыла", "раму"] + + +@pytest.mark.parametrize( + "word,lemma", + ( + ("бременем", "бремя"), + ("будешь", "быть"), + ("какая-то", "какой-то"), + ), +) +def test_ru_lookup_lemmatizer(ru_lookup_lemmatizer, word, lemma): + assert ru_lookup_lemmatizer.mode == "pymorphy3_lookup" + doc = Doc(ru_lookup_lemmatizer.vocab, words=[word]) + assert ru_lookup_lemmatizer(doc)[0].lemma_ == lemma diff --git a/spacy/tests/lang/uk/test_lemmatizer.py b/spacy/tests/lang/uk/test_lemmatizer.py index 788744aa1..a65bb25e5 100644 --- a/spacy/tests/lang/uk/test_lemmatizer.py +++ b/spacy/tests/lang/uk/test_lemmatizer.py @@ -8,12 +8,20 @@ pytestmark = pytest.mark.filterwarnings("ignore::DeprecationWarning") def test_uk_lemmatizer(uk_lemmatizer): """Check that the default uk lemmatizer runs.""" doc = Doc(uk_lemmatizer.vocab, words=["a", "b", "c"]) + assert uk_lemmatizer.mode == "pymorphy3" uk_lemmatizer(doc) assert [token.lemma for token in doc] -def test_uk_lookup_lemmatizer(uk_lookup_lemmatizer): - """Check that the lookup uk lemmatizer runs.""" - doc = Doc(uk_lookup_lemmatizer.vocab, words=["a", "b", "c"]) - uk_lookup_lemmatizer(doc) - assert [token.lemma for token in doc] +@pytest.mark.parametrize( + "word,lemma", + ( + ("якийсь", "якийсь"), + ("розповідають", "розповідати"), + ("розповіси", "розповісти"), + ), +) +def test_uk_lookup_lemmatizer(uk_lookup_lemmatizer, word, lemma): + assert uk_lookup_lemmatizer.mode == "pymorphy3_lookup" + doc = Doc(uk_lookup_lemmatizer.vocab, words=[word]) + assert uk_lookup_lemmatizer(doc)[0].lemma_ == lemma From dece775279955e4aa84f718675a72ff34174a7ee Mon Sep 17 00:00:00 2001 From: kadarakos Date: Fri, 25 Nov 2022 11:31:28 +0100 Subject: [PATCH 104/161] correct ndim in docs (#11869) --- website/docs/api/vectors.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/website/docs/api/vectors.md b/website/docs/api/vectors.md index 9636ea04c..d4702b592 100644 --- a/website/docs/api/vectors.md +++ b/website/docs/api/vectors.md @@ -50,7 +50,7 @@ modified later. | _keyword-only_ | | | `strings` | The string store. A new string store is created if one is not provided. Defaults to `None`. ~~Optional[StringStore]~~ | | `shape` | Size of the table as `(n_entries, n_columns)`, the number of entries and number of columns. Not required if you're initializing the object with `data` and `keys`. ~~Tuple[int, int]~~ | -| `data` | The vector data. ~~numpy.ndarray[ndim=1, dtype=float32]~~ | +| `data` | The vector data. ~~numpy.ndarray[ndim=2, dtype=float32]~~ | | `keys` | A sequence of keys aligned with the data. ~~Iterable[Union[str, int]]~~ | | `name` | A name to identify the vectors table. ~~str~~ | | `mode` 3.2 | Vectors mode: `"default"` or [`"floret"`](https://github.com/explosion/floret) (default: `"default"`). ~~str~~ | From c0fd8a2e71ce5eaad07e0b555fab8a152373fdc6 Mon Sep 17 00:00:00 2001 From: Raphael Mitsch Date: Fri, 25 Nov 2022 11:44:55 +0100 Subject: [PATCH 105/161] find-threshold: CLI command for multi-label classifier threshold tuning (#11280) * Add foundation for find-threshold CLI functionality. * Finish first draft for find-threshold. * Add tests. * Revert adjusted import statements. * Fix mypy errors. * Fix imports. * Harmonize arguments with spacy evaluate command. * Generalize component and threshold handling. Harmonize arguments with 'spacy evaluate' CLI. * Fix Spancat test. * Add beta parameter to Scorer and PRFScore. * Make beta a component scorer setting. * Remove beta. * Update nlp.config (workaround). * Reload pipeline on threshold change. Adjust tests. Remove confection reference. * Remove assumption of component being a Pipe object or having a .cfg attribute. * Adjust test output and reference values. * Remove beta references. Delete universe.json. * Reverting unnecessary changes. Removing unused default values. Renaming variables in find-cli tests. * Update spacy/cli/find_threshold.py Co-authored-by: Adriane Boyd * Remove adding labels in tests. * Remove unused error * Undo changes to PRFScorer * Change default value for n_trials. Log table iteratively. * Add warnings for pointless applications of find_threshold(). * Fix imports. * Adjust type check of TextCategorizer to exclude subclasses. * Change check of if there's only one unique value in scores. * Update spacy/cli/find_threshold.py Co-authored-by: Sofie Van Landeghem * Incorporate feedback. * Fix test issue. Update docstring. * Update docs & docstring. * Update spacy/tests/test_cli.py Co-authored-by: Adriane Boyd * Add examples to docs. Rename _nlp to nlp in tests. * Update spacy/cli/find_threshold.py Co-authored-by: Sofie Van Landeghem * Update spacy/cli/find_threshold.py Co-authored-by: Sofie Van Landeghem Co-authored-by: Adriane Boyd Co-authored-by: Sofie Van Landeghem --- spacy/cli/__init__.py | 1 + spacy/cli/find_threshold.py | 233 ++++++++++++++++++++++++++++++++++++ spacy/errors.py | 1 + spacy/pipeline/spancat.py | 4 +- spacy/tests/test_cli.py | 124 ++++++++++++++++++- website/docs/api/cli.md | 41 +++++++ 6 files changed, 399 insertions(+), 5 deletions(-) create mode 100644 spacy/cli/find_threshold.py diff --git a/spacy/cli/__init__.py b/spacy/cli/__init__.py index ce76ef9a9..aab2c8d12 100644 --- a/spacy/cli/__init__.py +++ b/spacy/cli/__init__.py @@ -27,6 +27,7 @@ from .project.dvc import project_update_dvc # noqa: F401 from .project.push import project_push # noqa: F401 from .project.pull import project_pull # noqa: F401 from .project.document import project_document # noqa: F401 +from .find_threshold import find_threshold # noqa: F401 @app.command("link", no_args_is_help=True, deprecated=True, hidden=True) diff --git a/spacy/cli/find_threshold.py b/spacy/cli/find_threshold.py new file mode 100644 index 000000000..efa664832 --- /dev/null +++ b/spacy/cli/find_threshold.py @@ -0,0 +1,233 @@ +import functools +import operator +from pathlib import Path +import logging +from typing import Optional, Tuple, Any, Dict, List + +import numpy +import wasabi.tables + +from ..pipeline import TextCategorizer, MultiLabel_TextCategorizer +from ..errors import Errors +from ..training import Corpus +from ._util import app, Arg, Opt, import_code, setup_gpu +from .. import util + +_DEFAULTS = { + "n_trials": 11, + "use_gpu": -1, + "gold_preproc": False, +} + + +@app.command( + "find-threshold", + context_settings={"allow_extra_args": False, "ignore_unknown_options": True}, +) +def find_threshold_cli( + # fmt: off + model: str = Arg(..., help="Model name or path"), + data_path: Path = Arg(..., help="Location of binary evaluation data in .spacy format", exists=True), + pipe_name: str = Arg(..., help="Name of pipe to examine thresholds for"), + threshold_key: str = Arg(..., help="Key of threshold attribute in component's configuration"), + scores_key: str = Arg(..., help="Metric to optimize"), + n_trials: int = Opt(_DEFAULTS["n_trials"], "--n_trials", "-n", help="Number of trials to determine optimal thresholds"), + code_path: Optional[Path] = Opt(None, "--code", "-c", help="Path to Python file with additional code (registered functions) to be imported"), + use_gpu: int = Opt(_DEFAULTS["use_gpu"], "--gpu-id", "-g", help="GPU ID or -1 for CPU"), + gold_preproc: bool = Opt(_DEFAULTS["gold_preproc"], "--gold-preproc", "-G", help="Use gold preprocessing"), + verbose: bool = Opt(False, "--silent", "-V", "-VV", help="Display more information for debugging purposes"), + # fmt: on +): + """ + Runs prediction trials for a trained model with varying tresholds to maximize + the specified metric. The search space for the threshold is traversed linearly + from 0 to 1 in `n_trials` steps. Results are displayed in a table on `stdout` + (the corresponding API call to `spacy.cli.find_threshold.find_threshold()` + returns all results). + + This is applicable only for components whose predictions are influenced by + thresholds - e.g. `textcat_multilabel` and `spancat`, but not `textcat`. Note + that the full path to the corresponding threshold attribute in the config has to + be provided. + + DOCS: https://spacy.io/api/cli#find-threshold + """ + + util.logger.setLevel(logging.DEBUG if verbose else logging.INFO) + import_code(code_path) + find_threshold( + model=model, + data_path=data_path, + pipe_name=pipe_name, + threshold_key=threshold_key, + scores_key=scores_key, + n_trials=n_trials, + use_gpu=use_gpu, + gold_preproc=gold_preproc, + silent=False, + ) + + +def find_threshold( + model: str, + data_path: Path, + pipe_name: str, + threshold_key: str, + scores_key: str, + *, + n_trials: int = _DEFAULTS["n_trials"], # type: ignore + use_gpu: int = _DEFAULTS["use_gpu"], # type: ignore + gold_preproc: bool = _DEFAULTS["gold_preproc"], # type: ignore + silent: bool = True, +) -> Tuple[float, float, Dict[float, float]]: + """ + Runs prediction trials for models with varying tresholds to maximize the specified metric. + model (Union[str, Path]): Pipeline to evaluate. Can be a package or a path to a data directory. + data_path (Path): Path to file with DocBin with docs to use for threshold search. + pipe_name (str): Name of pipe to examine thresholds for. + threshold_key (str): Key of threshold attribute in component's configuration. + scores_key (str): Name of score to metric to optimize. + n_trials (int): Number of trials to determine optimal thresholds. + use_gpu (int): GPU ID or -1 for CPU. + gold_preproc (bool): Whether to use gold preprocessing. Gold preprocessing helps the annotations align to the + tokenization, and may result in sequences of more consistent length. However, it may reduce runtime accuracy due + to train/test skew. + silent (bool): Whether to print non-error-related output to stdout. + RETURNS (Tuple[float, float, Dict[float, float]]): Best found threshold, the corresponding score, scores for all + evaluated thresholds. + """ + + setup_gpu(use_gpu, silent=silent) + data_path = util.ensure_path(data_path) + if not data_path.exists(): + wasabi.msg.fail("Evaluation data not found", data_path, exits=1) + nlp = util.load_model(model) + + if pipe_name not in nlp.component_names: + raise AttributeError( + Errors.E001.format(name=pipe_name, opts=nlp.component_names) + ) + pipe = nlp.get_pipe(pipe_name) + if not hasattr(pipe, "scorer"): + raise AttributeError(Errors.E1045) + + if type(pipe) == TextCategorizer: + wasabi.msg.warn( + "The `textcat` component doesn't use a threshold as it's not applicable to the concept of " + "exclusive classes. All thresholds will yield the same results." + ) + + if not silent: + wasabi.msg.info( + title=f"Optimizing for {scores_key} for component '{pipe_name}' with {n_trials} " + f"trials." + ) + + # Load evaluation corpus. + corpus = Corpus(data_path, gold_preproc=gold_preproc) + dev_dataset = list(corpus(nlp)) + config_keys = threshold_key.split(".") + + def set_nested_item( + config: Dict[str, Any], keys: List[str], value: float + ) -> Dict[str, Any]: + """Set item in nested dictionary. Adapted from https://stackoverflow.com/a/54138200. + config (Dict[str, Any]): Configuration dictionary. + keys (List[Any]): Path to value to set. + value (float): Value to set. + RETURNS (Dict[str, Any]): Updated dictionary. + """ + functools.reduce(operator.getitem, keys[:-1], config)[keys[-1]] = value + return config + + def filter_config( + config: Dict[str, Any], keys: List[str], full_key: str + ) -> Dict[str, Any]: + """Filters provided config dictionary so that only the specified keys path remains. + config (Dict[str, Any]): Configuration dictionary. + keys (List[Any]): Path to value to set. + full_key (str): Full user-specified key. + RETURNS (Dict[str, Any]): Filtered dictionary. + """ + if keys[0] not in config: + wasabi.msg.fail( + title=f"Failed to look up `{full_key}` in config: sub-key {[keys[0]]} not found.", + text=f"Make sure you specified {[keys[0]]} correctly. The following sub-keys are available instead: " + f"{list(config.keys())}", + exits=1, + ) + return { + keys[0]: filter_config(config[keys[0]], keys[1:], full_key) + if len(keys) > 1 + else config[keys[0]] + } + + # Evaluate with varying threshold values. + scores: Dict[float, float] = {} + config_keys_full = ["components", pipe_name, *config_keys] + table_col_widths = (10, 10) + thresholds = numpy.linspace(0, 1, n_trials) + print(wasabi.tables.row(["Threshold", f"{scores_key}"], widths=table_col_widths)) + for threshold in thresholds: + # Reload pipeline with overrides specifying the new threshold. + nlp = util.load_model( + model, + config=set_nested_item( + filter_config( + nlp.config, config_keys_full, ".".join(config_keys_full) + ).copy(), + config_keys_full, + threshold, + ), + ) + if hasattr(pipe, "cfg"): + setattr( + nlp.get_pipe(pipe_name), + "cfg", + set_nested_item(getattr(pipe, "cfg"), config_keys, threshold), + ) + + eval_scores = nlp.evaluate(dev_dataset) + if scores_key not in eval_scores: + wasabi.msg.fail( + title=f"Failed to look up score `{scores_key}` in evaluation results.", + text=f"Make sure you specified the correct value for `scores_key`. The following scores are " + f"available: {list(eval_scores.keys())}", + exits=1, + ) + scores[threshold] = eval_scores[scores_key] + + if not isinstance(scores[threshold], (float, int)): + wasabi.msg.fail( + f"Returned score for key '{scores_key}' is not numeric. Threshold optimization only works for numeric " + f"scores.", + exits=1, + ) + print( + wasabi.row( + [round(threshold, 3), round(scores[threshold], 3)], + widths=table_col_widths, + ) + ) + + best_threshold = max(scores.keys(), key=(lambda key: scores[key])) + + # If all scores are identical, emit warning. + if len(set(scores.values())) == 1: + wasabi.msg.warn( + title="All scores are identical. Verify that all settings are correct.", + text="" + if ( + not isinstance(pipe, MultiLabel_TextCategorizer) + or scores_key in ("cats_macro_f", "cats_micro_f") + ) + else "Use `cats_macro_f` or `cats_micro_f` when optimizing the threshold for `textcat_multilabel`.", + ) + + else: + if not silent: + print( + f"\nBest threshold: {round(best_threshold, ndigits=4)} with {scores_key} value of {scores[best_threshold]}." + ) + + return best_threshold, scores[best_threshold], scores diff --git a/spacy/errors.py b/spacy/errors.py index 1d29f0e17..a8de5fb90 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -956,6 +956,7 @@ class Errors(metaclass=ErrorsWithCodes): "sure it's overwritten on the subclass.") E1046 = ("{cls_name} is an abstract class and cannot be instantiated. If you are looking for spaCy's default " "knowledge base, use `InMemoryLookupKB`.") + E1047 = ("`find_threshold()` only supports components with a `scorer` attribute.") # Deprecated model shortcuts, only used in errors and warnings diff --git a/spacy/pipeline/spancat.py b/spacy/pipeline/spancat.py index 956bbb72c..0a84c72fd 100644 --- a/spacy/pipeline/spancat.py +++ b/spacy/pipeline/spancat.py @@ -1,7 +1,7 @@ -from typing import List, Dict, Callable, Tuple, Optional, Iterable, Any, cast +from typing import List, Dict, Callable, Tuple, Optional, Iterable, Any from thinc.api import Config, Model, get_current_ops, set_dropout_rate, Ops from thinc.api import Optimizer -from thinc.types import Ragged, Ints2d, Floats2d, Ints1d +from thinc.types import Ragged, Ints2d, Floats2d import numpy diff --git a/spacy/tests/test_cli.py b/spacy/tests/test_cli.py index 8225e14f1..1c4d0c98f 100644 --- a/spacy/tests/test_cli.py +++ b/spacy/tests/test_cli.py @@ -1,9 +1,10 @@ import os import math +from collections import Counter +from typing import Tuple, List, Dict, Any import pkg_resources -from random import sample -from typing import Counter +import numpy import pytest import srsly from click import NoSuchOption @@ -28,11 +29,12 @@ from spacy.cli.package import get_third_party_dependencies from spacy.cli.package import _is_permitted_package_name from spacy.cli.project.run import _check_requirements from spacy.cli.validate import get_model_pkgs +from spacy.cli.find_threshold import find_threshold from spacy.lang.en import English from spacy.lang.nl import Dutch from spacy.language import Language from spacy.schemas import ProjectConfigSchema, RecommendationSchema, validate -from spacy.tokens import Doc +from spacy.tokens import Doc, DocBin from spacy.tokens.span import Span from spacy.training import Example, docs_to_json, offsets_to_biluo_tags from spacy.training.converters import conll_ner_to_docs, conllu_to_docs @@ -859,6 +861,122 @@ def test_span_length_freq_dist_output_must_be_correct(): assert list(span_freqs.keys()) == [3, 1, 4, 5, 2] +def test_cli_find_threshold(capsys): + thresholds = numpy.linspace(0, 1, 10) + + def make_examples(nlp: Language) -> List[Example]: + docs: List[Example] = [] + + for t in [ + ( + "I am angry and confused in the Bank of America.", + { + "cats": {"ANGRY": 1.0, "CONFUSED": 1.0, "HAPPY": 0.0}, + "spans": {"sc": [(31, 46, "ORG")]}, + }, + ), + ( + "I am confused but happy in New York.", + { + "cats": {"ANGRY": 0.0, "CONFUSED": 1.0, "HAPPY": 1.0}, + "spans": {"sc": [(27, 35, "GPE")]}, + }, + ), + ]: + doc = nlp.make_doc(t[0]) + docs.append(Example.from_dict(doc, t[1])) + + return docs + + def init_nlp( + components: Tuple[Tuple[str, Dict[str, Any]], ...] = () + ) -> Tuple[Language, List[Example]]: + new_nlp = English() + new_nlp.add_pipe( # type: ignore + factory_name="textcat_multilabel", + name="tc_multi", + config={"threshold": 0.9}, + ) + + # Append additional components to pipeline. + for cfn, comp_config in components: + new_nlp.add_pipe(cfn, config=comp_config) + + new_examples = make_examples(new_nlp) + new_nlp.initialize(get_examples=lambda: new_examples) + for i in range(5): + new_nlp.update(new_examples) + + return new_nlp, new_examples + + with make_tempdir() as docs_dir: + # Check whether find_threshold() identifies lowest threshold above 0 as (first) ideal threshold, as this matches + # the current model behavior with the examples above. This can break once the model behavior changes and serves + # mostly as a smoke test. + nlp, examples = init_nlp() + DocBin(docs=[example.reference for example in examples]).to_disk( + docs_dir / "docs.spacy" + ) + with make_tempdir() as nlp_dir: + nlp.to_disk(nlp_dir) + res = find_threshold( + model=nlp_dir, + data_path=docs_dir / "docs.spacy", + pipe_name="tc_multi", + threshold_key="threshold", + scores_key="cats_macro_f", + silent=True, + ) + assert res[0] != thresholds[0] + assert thresholds[0] < res[0] < thresholds[9] + assert res[1] == 1.0 + assert res[2][1.0] == 0.0 + + # Test with spancat. + nlp, _ = init_nlp((("spancat", {}),)) + with make_tempdir() as nlp_dir: + nlp.to_disk(nlp_dir) + res = find_threshold( + model=nlp_dir, + data_path=docs_dir / "docs.spacy", + pipe_name="spancat", + threshold_key="threshold", + scores_key="spans_sc_f", + silent=True, + ) + assert res[0] != thresholds[0] + assert thresholds[0] < res[0] < thresholds[8] + assert res[1] >= 0.6 + assert res[2][1.0] == 0.0 + + # Having multiple textcat_multilabel components should work, since the name has to be specified. + nlp, _ = init_nlp((("textcat_multilabel", {}),)) + with make_tempdir() as nlp_dir: + nlp.to_disk(nlp_dir) + assert find_threshold( + model=nlp_dir, + data_path=docs_dir / "docs.spacy", + pipe_name="tc_multi", + threshold_key="threshold", + scores_key="cats_macro_f", + silent=True, + ) + + # Specifying the name of an non-existing pipe should fail. + nlp, _ = init_nlp() + with make_tempdir() as nlp_dir: + nlp.to_disk(nlp_dir) + with pytest.raises(AttributeError): + find_threshold( + model=nlp_dir, + data_path=docs_dir / "docs.spacy", + pipe_name="_", + threshold_key="threshold", + scores_key="cats_macro_f", + silent=True, + ) + + @pytest.mark.parametrize( "reqs,output", [ diff --git a/website/docs/api/cli.md b/website/docs/api/cli.md index 6e581b903..b42ba8a4f 100644 --- a/website/docs/api/cli.md +++ b/website/docs/api/cli.md @@ -12,6 +12,7 @@ menu: - ['train', 'train'] - ['pretrain', 'pretrain'] - ['evaluate', 'evaluate'] + - ['find-threshold', 'find-threshold'] - ['assemble', 'assemble'] - ['package', 'package'] - ['project', 'project'] @@ -1161,6 +1162,46 @@ $ python -m spacy evaluate [model] [data_path] [--output] [--code] [--gold-prepr | `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | | **CREATES** | Training results and optional metrics and visualizations. | +## find-threshold {#find-threshold new="3.5" tag="command"} + +Runs prediction trials for a trained model with varying tresholds to maximize +the specified metric. The search space for the threshold is traversed linearly +from 0 to 1 in `n_trials` steps. Results are displayed in a table on `stdout` +(the corresponding API call to `spacy.cli.find_threshold.find_threshold()` +returns all results). + +This is applicable only for components whose predictions are influenced by +thresholds - e.g. `textcat_multilabel` and `spancat`, but not `textcat`. Note +that the full path to the corresponding threshold attribute in the config has to +be provided. + +> #### Examples +> +> ```cli +> # For textcat_multilabel: +> $ python -m spacy find-threshold my_nlp data.spacy textcat_multilabel threshold cats_macro_f +> ``` +> +> ```cli +> # For spancat: +> $ python -m spacy find-threshold my_nlp data.spacy spancat threshold spans_sc_f +> ``` + + +| Name | Description | +| ----------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | +| `model` | Pipeline to evaluate. Can be a package or a path to a data directory. ~~str (positional)~~ | +| `data_path` | Path to file with DocBin with docs to use for threshold search. ~~Path (positional)~~ | +| `pipe_name` | Name of pipe to examine thresholds for. ~~str (positional)~~ | +| `threshold_key` | Key of threshold attribute in component's configuration. ~~str (positional)~~ | +| `scores_key` | Name of score to metric to optimize. ~~str (positional)~~ | +| `--n_trials`, `-n` | Number of trials to determine optimal thresholds. ~~int (option)~~ | +| `--code`, `-c` | Path to Python file with additional code to be imported. Allows [registering custom functions](/usage/training#custom-functions) for new architectures. ~~Optional[Path] \(option)~~ | +| `--gpu-id`, `-g` | GPU to use, if any. Defaults to `-1` for CPU. ~~int (option)~~ | +| `--gold-preproc`, `-G` | Use gold preprocessing. ~~bool (flag)~~ | +| `--silent`, `-V`, `-VV` | GPU to use, if any. Defaults to `-1` for CPU. ~~int (option)~~ | +| `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | + ## assemble {#assemble tag="command"} Assemble a pipeline from a config file without additional training. Expects a From 378db0eb1e9231c565faf72078bcfb012f439e9b Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Fri, 1 Apr 2022 10:42:25 +0200 Subject: [PATCH 106/161] Temporarily skip tests that require models/compat --- .github/azure-steps.yml | 44 ++++++++++++++++++++--------------------- spacy/tests/test_cli.py | 2 ++ 2 files changed, 24 insertions(+), 22 deletions(-) diff --git a/.github/azure-steps.yml b/.github/azure-steps.yml index e8bd0d212..2f77706b8 100644 --- a/.github/azure-steps.yml +++ b/.github/azure-steps.yml @@ -52,17 +52,17 @@ steps: python -W error -c "import spacy" displayName: "Test import" - - script: | - python -m spacy download ca_core_news_sm - python -m spacy download ca_core_news_md - python -c "import spacy; nlp=spacy.load('ca_core_news_sm'); doc=nlp('test')" - displayName: 'Test download CLI' - condition: eq(variables['python_version'], '3.8') - - - script: | - python -W error -c "import ca_core_news_sm; nlp = ca_core_news_sm.load(); doc=nlp('test')" - displayName: 'Test no warnings on load (#11713)' - condition: eq(variables['python_version'], '3.8') +# - script: | +# python -m spacy download ca_core_news_sm +# python -m spacy download ca_core_news_md +# python -c "import spacy; nlp=spacy.load('ca_core_news_sm'); doc=nlp('test')" +# displayName: 'Test download CLI' +# condition: eq(variables['python_version'], '3.8') +# +# - script: | +# python -W error -c "import ca_core_news_sm; nlp = ca_core_news_sm.load(); doc=nlp('test')" +# displayName: 'Test no warnings on load (#11713)' +# condition: eq(variables['python_version'], '3.8') - script: | python -m spacy convert extra/example_data/ner_example_data/ner-token-per-line-conll2003.json . @@ -86,17 +86,17 @@ steps: displayName: 'Test train CLI' condition: eq(variables['python_version'], '3.8') - - script: | - python -c "import spacy; config = spacy.util.load_config('ner.cfg'); config['components']['ner'] = {'source': 'ca_core_news_sm'}; config.to_disk('ner_source_sm.cfg')" - PYTHONWARNINGS="error,ignore::DeprecationWarning" python -m spacy assemble ner_source_sm.cfg output_dir - displayName: 'Test assemble CLI' - condition: eq(variables['python_version'], '3.8') - - - script: | - python -c "import spacy; config = spacy.util.load_config('ner.cfg'); config['components']['ner'] = {'source': 'ca_core_news_md'}; config.to_disk('ner_source_md.cfg')" - python -m spacy assemble ner_source_md.cfg output_dir 2>&1 | grep -q W113 - displayName: 'Test assemble CLI vectors warning' - condition: eq(variables['python_version'], '3.8') +# - script: | +# python -c "import spacy; config = spacy.util.load_config('ner.cfg'); config['components']['ner'] = {'source': 'ca_core_news_sm'}; config.to_disk('ner_source_sm.cfg')" +# PYTHONWARNINGS="error,ignore::DeprecationWarning" python -m spacy assemble ner_source_sm.cfg output_dir +# displayName: 'Test assemble CLI' +# condition: eq(variables['python_version'], '3.8') +# +# - script: | +# python -c "import spacy; config = spacy.util.load_config('ner.cfg'); config['components']['ner'] = {'source': 'ca_core_news_md'}; config.to_disk('ner_source_md.cfg')" +# python -m spacy assemble ner_source_md.cfg output_dir 2>&1 | grep -q W113 +# displayName: 'Test assemble CLI vectors warning' +# condition: eq(variables['python_version'], '3.8') - script: | python -m pip install -U -r requirements.txt diff --git a/spacy/tests/test_cli.py b/spacy/tests/test_cli.py index 8225e14f1..563559cb4 100644 --- a/spacy/tests/test_cli.py +++ b/spacy/tests/test_cli.py @@ -591,6 +591,7 @@ def test_string_to_list_intify(value): assert string_to_list(value, intify=True) == [1, 2, 3] +@pytest.mark.skip(reason="Temporarily skip for dev version") def test_download_compatibility(): spec = SpecifierSet("==" + about.__version__) spec.prereleases = False @@ -601,6 +602,7 @@ def test_download_compatibility(): assert get_minor_version(about.__version__) == get_minor_version(version) +@pytest.mark.skip(reason="Temporarily skip for dev version") def test_validate_compatibility_table(): spec = SpecifierSet("==" + about.__version__) spec.prereleases = False From 32396e0bda3aceda74f2d7d050180032cd381d32 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Fri, 25 Nov 2022 11:18:56 +0100 Subject: [PATCH 107/161] Set version to v3.5.0 --- spacy/about.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/about.py b/spacy/about.py index ce86e6294..640e9e93b 100644 --- a/spacy/about.py +++ b/spacy/about.py @@ -1,6 +1,6 @@ # fmt: off __title__ = "spacy" -__version__ = "3.4.2" +__version__ = "3.5.0" __download_url__ = "https://github.com/explosion/spacy-models/releases/download" __compatibility__ = "https://raw.githubusercontent.com/explosion/spacy-models/master/compatibility.json" __projects__ = "https://github.com/explosion/projects" From 681ec209147ba476a4062e5fec2248c7e0c50d68 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Fri, 25 Nov 2022 13:00:57 +0100 Subject: [PATCH 108/161] Add smart_open requirement, update deprecated options (#11864) * Switch from deprecated `ignore_ext` to `compression` * Add upload/download test for local files --- requirements.txt | 1 + setup.cfg | 1 + spacy/cli/_util.py | 2 +- spacy/tests/test_cli.py | 16 ++++++++++++++++ 4 files changed, 19 insertions(+), 1 deletion(-) diff --git a/requirements.txt b/requirements.txt index 23bfa6f14..dd2eff0c2 100644 --- a/requirements.txt +++ b/requirements.txt @@ -11,6 +11,7 @@ srsly>=2.4.3,<3.0.0 catalogue>=2.0.6,<2.1.0 typer>=0.3.0,<0.8.0 pathy>=0.3.5 +smart-open>=5.2.1,<7.0.0 # Third party dependencies numpy>=1.15.0 requests>=2.13.0,<3.0.0 diff --git a/setup.cfg b/setup.cfg index 82d4d2758..330dc8205 100644 --- a/setup.cfg +++ b/setup.cfg @@ -53,6 +53,7 @@ install_requires = # Third-party dependencies typer>=0.3.0,<0.8.0 pathy>=0.3.5 + smart-open>=5.2.1,<7.0.0 tqdm>=4.38.0,<5.0.0 numpy>=1.15.0 requests>=2.13.0,<3.0.0 diff --git a/spacy/cli/_util.py b/spacy/cli/_util.py index 897964a88..872f69c88 100644 --- a/spacy/cli/_util.py +++ b/spacy/cli/_util.py @@ -358,7 +358,7 @@ def download_file(src: Union[str, "Pathy"], dest: Path, *, force: bool = False) if dest.exists() and not force: return None src = str(src) - with smart_open.open(src, mode="rb", ignore_ext=True) as input_file: + with smart_open.open(src, mode="rb", compression="disable") as input_file: with dest.open(mode="wb") as output_file: shutil.copyfileobj(input_file, output_file) diff --git a/spacy/tests/test_cli.py b/spacy/tests/test_cli.py index 1c4d0c98f..525c6d255 100644 --- a/spacy/tests/test_cli.py +++ b/spacy/tests/test_cli.py @@ -17,6 +17,7 @@ from spacy.cli._util import is_subpath_of, load_project_config from spacy.cli._util import parse_config_overrides, string_to_list from spacy.cli._util import substitute_project_variables from spacy.cli._util import validate_project_commands +from spacy.cli._util import upload_file, download_file from spacy.cli.debug_data import _compile_gold, _get_labels_from_model from spacy.cli.debug_data import _get_labels_from_spancat from spacy.cli.debug_data import _get_distribution, _get_kl_divergence @@ -1014,3 +1015,18 @@ def test_project_check_requirements(reqs, output): pkg_resources.require("spacyunknowndoesnotexist12345") except pkg_resources.DistributionNotFound: assert output == _check_requirements([req.strip() for req in reqs.split("\n")]) + + +def test_upload_download_local_file(): + with make_tempdir() as d1, make_tempdir() as d2: + filename = "f.txt" + content = "content" + local_file = d1 / filename + remote_file = d2 / filename + with local_file.open(mode="w") as file_: + file_.write(content) + upload_file(local_file, remote_file) + local_file.unlink() + download_file(remote_file, local_file) + with local_file.open(mode="r") as file_: + assert file_.read() == content From c23d54fd261b34ff947a18170a303a305179e7bd Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Marcus=20Bl=C3=A4ttermann?= Date: Wed, 23 Nov 2022 01:33:20 +0100 Subject: [PATCH 109/161] Remove MDX tags from `README.md` --- website/README.md | 9 ++++----- 1 file changed, 4 insertions(+), 5 deletions(-) diff --git a/website/README.md b/website/README.md index 743e61acd..e0c0ac450 100644 --- a/website/README.md +++ b/website/README.md @@ -11,7 +11,7 @@ rendered version is available at https://spacy.io/styleguide._ -## Setup and installation {#setup} +## Setup and installation Before running the setup, make sure your versions of [Node](https://nodejs.org/en/) and [npm](https://www.npmjs.com/) are up to date. @@ -40,7 +40,7 @@ extensions for your code editor. The [`.prettierrc`](https://github.com/explosion/spaCy/tree/master/website/.prettierrc) file in the root defines the settings used in this codebase. -## Building & developing the site with Docker {#docker} +## Building & developing the site with Docker Sometimes it's hard to get a local environment working due to rapid updates to node dependencies, so it may be easier to use docker for building the docs. @@ -66,7 +66,7 @@ segfault errors from `qemu` if you use the default image. To fix this use the `arm64` tagged image in the `docker run` command (ghcr.io/explosion/spacy-io:arm64). -### Building the Docker image {#docker-build} +### Building the Docker image If you'd like to build the image locally, you can do so like this: @@ -77,10 +77,9 @@ docker build -t spacy-io . This will take some time, so if you want to use the prebuilt image you'll save a bit of time. -## Project structure {#structure} +## Project structure ```yaml -### Directory structure ├── docs # the actual markdown content ├── meta # JSON-formatted site metadata | ├── languages.json # supported languages and statistical models From 7f2ea20fee67c24eb3c7a10b76f6d554c0df5c88 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Marcus=20Bl=C3=A4ttermann?= Date: Tue, 22 Nov 2022 16:16:11 +0100 Subject: [PATCH 110/161] Update `README.md` --- website/README.md | 10 ++-------- 1 file changed, 2 insertions(+), 8 deletions(-) diff --git a/website/README.md b/website/README.md index e0c0ac450..890a48ef9 100644 --- a/website/README.md +++ b/website/README.md @@ -1,15 +1,9 @@ - - # spacy.io website and docs ![Netlify Status](https://api.netlify.com/api/v1/badges/d65fe97d-99ab-47f8-a339-1d8987251da0/deploy-status) -_This page contains the documentation and styleguide for the spaCy website. Its -rendered version is available at https://spacy.io/styleguide._ - ---- - - +The styleguide for the spaCy website is available at +[spacy.io/styleguide](https://spacy.io/styleguide). ## Setup and installation From 5c9faf6eea34eade36e465c5493bfbbb039bcbc5 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Marcus=20Bl=C3=A4ttermann?= Date: Thu, 24 Nov 2022 21:02:14 +0100 Subject: [PATCH 111/161] Update menu for styleguide This reflects the removed parts from ecbf052abde2ab9373be1d7652e20d50b096e49d --- website/docs/styleguide.md | 2 -- 1 file changed, 2 deletions(-) diff --git a/website/docs/styleguide.md b/website/docs/styleguide.md index 6ae23ff3f..47bca1ed4 100644 --- a/website/docs/styleguide.md +++ b/website/docs/styleguide.md @@ -8,9 +8,7 @@ menu: - ['Typography', 'typography'] - ['Elements', 'elements'] - ['Components', 'components'] - - ['Setup & Installation', 'setup'] - ['Markdown Reference', 'markdown'] - - ['Project Structure', 'structure'] - ['Editorial', 'editorial'] sidebar: - label: Styleguide From 9f986af120717680a1b97b15670dbc427b56ad89 Mon Sep 17 00:00:00 2001 From: Zhangrp Date: Mon, 28 Nov 2022 13:50:30 +0800 Subject: [PATCH 112/161] Add example sentence for Chinese in website meta (#11879) --- website/meta/languages.json | 1 + 1 file changed, 1 insertion(+) diff --git a/website/meta/languages.json b/website/meta/languages.json index bd1535c90..15158df79 100644 --- a/website/meta/languages.json +++ b/website/meta/languages.json @@ -562,6 +562,7 @@ "url": "https://github.com/explosion/spacy-pkuseg" } ], + "example": "这是一个用于示例的句子。", "has_examples": true } ], From f54bfb56c923b94ffeff5f9b774a24479c6dea61 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Mon, 28 Nov 2022 18:01:09 +0900 Subject: [PATCH 113/161] Don't throw an error if using displacy on an unset span key (#11845) * Don't throw an error if using displacy on an unset span key * List available keys in W117 --- spacy/displacy/__init__.py | 5 +++-- spacy/errors.py | 2 +- spacy/tests/test_displacy.py | 10 ++++++++++ 3 files changed, 14 insertions(+), 3 deletions(-) diff --git a/spacy/displacy/__init__.py b/spacy/displacy/__init__.py index 7bb300afa..bc32001d7 100644 --- a/spacy/displacy/__init__.py +++ b/spacy/displacy/__init__.py @@ -228,12 +228,13 @@ def parse_spans(doc: Doc, options: Dict[str, Any] = {}) -> Dict[str, Any]: "kb_id": span.kb_id_ if span.kb_id_ else "", "kb_url": kb_url_template.format(span.kb_id_) if kb_url_template else "#", } - for span in doc.spans[spans_key] + for span in doc.spans.get(spans_key, []) ] tokens = [token.text for token in doc] if not spans: - warnings.warn(Warnings.W117.format(spans_key=spans_key)) + keys = list(doc.spans.keys()) + warnings.warn(Warnings.W117.format(spans_key=spans_key, keys=keys)) title = doc.user_data.get("title", None) if hasattr(doc, "user_data") else None settings = get_doc_settings(doc) return { diff --git a/spacy/errors.py b/spacy/errors.py index a8de5fb90..e34614b0f 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -199,7 +199,7 @@ class Warnings(metaclass=ErrorsWithCodes): W117 = ("No spans to visualize found in Doc object with spans_key: '{spans_key}'. If this is " "surprising to you, make sure the Doc was processed using a model " "that supports span categorization, and check the `doc.spans[spans_key]` " - "property manually if necessary.") + "property manually if necessary.\n\nAvailable keys: {keys}") W118 = ("Term '{term}' not found in glossary. It may however be explained in documentation " "for the corpora used to train the language. Please check " "`nlp.meta[\"sources\"]` for any relevant links.") diff --git a/spacy/tests/test_displacy.py b/spacy/tests/test_displacy.py index ccc145b44..f298b38e0 100644 --- a/spacy/tests/test_displacy.py +++ b/spacy/tests/test_displacy.py @@ -203,6 +203,16 @@ def test_displacy_parse_spans_different_spans_key(en_vocab): ] +def test_displacy_parse_empty_spans_key(en_vocab): + """Test that having an unset spans key doesn't raise an error""" + doc = Doc(en_vocab, words=["Welcome", "to", "the", "Bank", "of", "China"]) + doc.spans["custom"] = [Span(doc, 3, 6, "BANK")] + with pytest.warns(UserWarning, match="W117"): + spans = displacy.parse_spans(doc) + + assert isinstance(spans, dict) + + def test_displacy_parse_ents(en_vocab): """Test that named entities on a Doc are converted into displaCy's format.""" doc = Doc(en_vocab, words=["But", "Google", "is", "starting", "from", "behind"]) From 1ebe7db07c8dbb1a55dafb09131b1d08242b79c5 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Tue, 29 Nov 2022 11:40:58 +0100 Subject: [PATCH 114/161] Support local filesystem remotes for projects (#11762) * Support local filesystem remotes for projects * Fix support for local filesystem remotes for projects * Use `FluidPath` instead of `Pathy` to support both filesystem and remote paths * Create missing parent directories if required for local filesystem * Add a more general `_file_exists` method to support both `Pathy`, `Path`, and `smart_open`-compatible URLs * Add explicit `smart_open` dependency starting with support for `compression` flag * Update `pathy` dependency to exclude older versions that aren't compatible with required `smart_open` version * Update docs to refer to `Pathy` instead of `smart_open` for project remotes (technically you can still push to any `smart_open`-compatible path but you can't pull from them) * Add tests for local filesystem remotes * Update pathy for general BlobStat sorting * Add import * Remove _file_exists since only Pathy remotes are supported * Format CLI docs * Clean up merge --- requirements.txt | 2 +- setup.cfg | 2 +- spacy/cli/_util.py | 15 +++++--- spacy/cli/project/remote_storage.py | 42 ++++++++++++++-------- spacy/tests/test_cli.py | 56 +++++++++++++++++++++++++++++ website/docs/api/cli.md | 26 +++++++------- website/docs/usage/projects.md | 20 +++++------ 7 files changed, 120 insertions(+), 43 deletions(-) diff --git a/requirements.txt b/requirements.txt index dd2eff0c2..778c05e21 100644 --- a/requirements.txt +++ b/requirements.txt @@ -10,7 +10,7 @@ wasabi>=0.9.1,<1.1.0 srsly>=2.4.3,<3.0.0 catalogue>=2.0.6,<2.1.0 typer>=0.3.0,<0.8.0 -pathy>=0.3.5 +pathy>=0.10.0 smart-open>=5.2.1,<7.0.0 # Third party dependencies numpy>=1.15.0 diff --git a/setup.cfg b/setup.cfg index 330dc8205..5768c9d3e 100644 --- a/setup.cfg +++ b/setup.cfg @@ -52,7 +52,7 @@ install_requires = catalogue>=2.0.6,<2.1.0 # Third-party dependencies typer>=0.3.0,<0.8.0 - pathy>=0.3.5 + pathy>=0.10.0 smart-open>=5.2.1,<7.0.0 tqdm>=4.38.0,<5.0.0 numpy>=1.15.0 diff --git a/spacy/cli/_util.py b/spacy/cli/_util.py index 872f69c88..7ce006108 100644 --- a/spacy/cli/_util.py +++ b/spacy/cli/_util.py @@ -23,7 +23,7 @@ from ..util import is_compatible_version, SimpleFrozenDict, ENV_VARS from .. import about if TYPE_CHECKING: - from pathy import Pathy # noqa: F401 + from pathy import FluidPath # noqa: F401 SDIST_SUFFIX = ".tar.gz" @@ -331,7 +331,7 @@ def import_code(code_path: Optional[Union[Path, str]]) -> None: msg.fail(f"Couldn't load Python code: {code_path}", e, exits=1) -def upload_file(src: Path, dest: Union[str, "Pathy"]) -> None: +def upload_file(src: Path, dest: Union[str, "FluidPath"]) -> None: """Upload a file. src (Path): The source path. @@ -339,13 +339,20 @@ def upload_file(src: Path, dest: Union[str, "Pathy"]) -> None: """ import smart_open + # Create parent directories for local paths + if isinstance(dest, Path): + if not dest.parent.exists(): + dest.parent.mkdir(parents=True) + dest = str(dest) with smart_open.open(dest, mode="wb") as output_file: with src.open(mode="rb") as input_file: output_file.write(input_file.read()) -def download_file(src: Union[str, "Pathy"], dest: Path, *, force: bool = False) -> None: +def download_file( + src: Union[str, "FluidPath"], dest: Path, *, force: bool = False +) -> None: """Download a file using smart_open. url (str): The URL of the file. @@ -368,7 +375,7 @@ def ensure_pathy(path): slow and annoying Google Cloud warning).""" from pathy import Pathy # noqa: F811 - return Pathy(path) + return Pathy.fluid(path) def git_checkout( diff --git a/spacy/cli/project/remote_storage.py b/spacy/cli/project/remote_storage.py index 12e252b3c..076541580 100644 --- a/spacy/cli/project/remote_storage.py +++ b/spacy/cli/project/remote_storage.py @@ -5,15 +5,17 @@ import hashlib import urllib.parse import tarfile from pathlib import Path +from wasabi import msg -from .._util import get_hash, get_checksum, download_file, ensure_pathy -from ...util import make_tempdir, get_minor_version, ENV_VARS, check_bool_env_var +from .._util import get_hash, get_checksum, upload_file, download_file +from .._util import ensure_pathy, make_tempdir +from ...util import get_minor_version, ENV_VARS, check_bool_env_var from ...git_info import GIT_VERSION from ... import about from ...errors import Errors if TYPE_CHECKING: - from pathy import Pathy # noqa: F401 + from pathy import FluidPath # noqa: F401 class RemoteStorage: @@ -28,7 +30,7 @@ class RemoteStorage: self.url = ensure_pathy(url) self.compression = compression - def push(self, path: Path, command_hash: str, content_hash: str) -> "Pathy": + def push(self, path: Path, command_hash: str, content_hash: str) -> "FluidPath": """Compress a file or directory within a project and upload it to a remote storage. If an object exists at the full URL, nothing is done. @@ -49,9 +51,7 @@ class RemoteStorage: mode_string = f"w:{self.compression}" if self.compression else "w" with tarfile.open(tar_loc, mode=mode_string) as tar_file: tar_file.add(str(loc), arcname=str(path)) - with tar_loc.open(mode="rb") as input_file: - with url.open(mode="wb") as output_file: - output_file.write(input_file.read()) + upload_file(tar_loc, url) return url def pull( @@ -60,7 +60,7 @@ class RemoteStorage: *, command_hash: Optional[str] = None, content_hash: Optional[str] = None, - ) -> Optional["Pathy"]: + ) -> Optional["FluidPath"]: """Retrieve a file from the remote cache. If the file already exists, nothing is done. @@ -110,25 +110,37 @@ class RemoteStorage: *, command_hash: Optional[str] = None, content_hash: Optional[str] = None, - ) -> Optional["Pathy"]: + ) -> Optional["FluidPath"]: """Find the best matching version of a file within the storage, or `None` if no match can be found. If both the creation and content hash are specified, only exact matches will be returned. Otherwise, the most recent matching file is preferred. """ name = self.encode_name(str(path)) + urls = [] if command_hash is not None and content_hash is not None: - url = self.make_url(path, command_hash, content_hash) + url = self.url / name / command_hash / content_hash urls = [url] if url.exists() else [] elif command_hash is not None: - urls = list((self.url / name / command_hash).iterdir()) + if (self.url / name / command_hash).exists(): + urls = list((self.url / name / command_hash).iterdir()) else: - urls = list((self.url / name).iterdir()) - if content_hash is not None: - urls = [url for url in urls if url.parts[-1] == content_hash] + if (self.url / name).exists(): + for sub_dir in (self.url / name).iterdir(): + urls.extend(sub_dir.iterdir()) + if content_hash is not None: + urls = [url for url in urls if url.parts[-1] == content_hash] + if len(urls) >= 2: + try: + urls.sort(key=lambda x: x.stat().last_modified) # type: ignore + except Exception: + msg.warn( + "Unable to sort remote files by last modified. The file(s) " + "pulled from the cache may not be the most recent." + ) return urls[-1] if urls else None - def make_url(self, path: Path, command_hash: str, content_hash: str) -> "Pathy": + def make_url(self, path: Path, command_hash: str, content_hash: str) -> "FluidPath": """Construct a URL from a subpath, a creation hash and a content hash.""" return self.url / self.encode_name(str(path)) / command_hash / content_hash diff --git a/spacy/tests/test_cli.py b/spacy/tests/test_cli.py index 525c6d255..ee3081283 100644 --- a/spacy/tests/test_cli.py +++ b/spacy/tests/test_cli.py @@ -3,6 +3,7 @@ import math from collections import Counter from typing import Tuple, List, Dict, Any import pkg_resources +import time import numpy import pytest @@ -28,6 +29,7 @@ from spacy.cli.download import get_compatibility, get_version from spacy.cli.init_config import RECOMMENDATIONS, init_config, fill_config from spacy.cli.package import get_third_party_dependencies from spacy.cli.package import _is_permitted_package_name +from spacy.cli.project.remote_storage import RemoteStorage from spacy.cli.project.run import _check_requirements from spacy.cli.validate import get_model_pkgs from spacy.cli.find_threshold import find_threshold @@ -862,6 +864,60 @@ def test_span_length_freq_dist_output_must_be_correct(): assert list(span_freqs.keys()) == [3, 1, 4, 5, 2] +def test_local_remote_storage(): + with make_tempdir() as d: + filename = "a.txt" + + content_hashes = ("aaaa", "cccc", "bbbb") + for i, content_hash in enumerate(content_hashes): + # make sure that each subsequent file has a later timestamp + if i > 0: + time.sleep(1) + content = f"{content_hash} content" + loc_file = d / "root" / filename + if not loc_file.parent.exists(): + loc_file.parent.mkdir(parents=True) + with loc_file.open(mode="w") as file_: + file_.write(content) + + # push first version to remote storage + remote = RemoteStorage(d / "root", str(d / "remote")) + remote.push(filename, "aaaa", content_hash) + + # retrieve with full hashes + loc_file.unlink() + remote.pull(filename, command_hash="aaaa", content_hash=content_hash) + with loc_file.open(mode="r") as file_: + assert file_.read() == content + + # retrieve with command hash + loc_file.unlink() + remote.pull(filename, command_hash="aaaa") + with loc_file.open(mode="r") as file_: + assert file_.read() == content + + # retrieve with content hash + loc_file.unlink() + remote.pull(filename, content_hash=content_hash) + with loc_file.open(mode="r") as file_: + assert file_.read() == content + + # retrieve with no hashes + loc_file.unlink() + remote.pull(filename) + with loc_file.open(mode="r") as file_: + assert file_.read() == content + + +def test_local_remote_storage_pull_missing(): + # pulling from a non-existent remote pulls nothing gracefully + with make_tempdir() as d: + filename = "a.txt" + remote = RemoteStorage(d / "root", str(d / "remote")) + assert remote.pull(filename, command_hash="aaaa") is None + assert remote.pull(filename) is None + + def test_cli_find_threshold(capsys): thresholds = numpy.linspace(0, 1, 10) diff --git a/website/docs/api/cli.md b/website/docs/api/cli.md index b42ba8a4f..8823a3bd8 100644 --- a/website/docs/api/cli.md +++ b/website/docs/api/cli.md @@ -1391,12 +1391,13 @@ If the contents are different, the new version of the file is uploaded. Deleting obsolete files is left up to you. Remotes can be defined in the `remotes` section of the -[`project.yml`](/usage/projects#project-yml). Under the hood, spaCy uses the -[`smart-open`](https://github.com/RaRe-Technologies/smart_open) library to -communicate with the remote storages, so you can use any protocol that -`smart-open` supports, including [S3](https://aws.amazon.com/s3/), -[Google Cloud Storage](https://cloud.google.com/storage), SSH and more, although -you may need to install extra dependencies to use certain protocols. +[`project.yml`](/usage/projects#project-yml). Under the hood, spaCy uses +[`Pathy`](https://github.com/justindujardin/pathy) to communicate with the +remote storages, so you can use any protocol that `Pathy` supports, including +[S3](https://aws.amazon.com/s3/), +[Google Cloud Storage](https://cloud.google.com/storage), and the local +filesystem, although you may need to install extra dependencies to use certain +protocols. ```cli $ python -m spacy project push [remote] [project_dir] @@ -1435,12 +1436,13 @@ outputs, so if you change the config back, you'll be able to fetch back the result. Remotes can be defined in the `remotes` section of the -[`project.yml`](/usage/projects#project-yml). Under the hood, spaCy uses the -[`smart-open`](https://github.com/RaRe-Technologies/smart_open) library to -communicate with the remote storages, so you can use any protocol that -`smart-open` supports, including [S3](https://aws.amazon.com/s3/), -[Google Cloud Storage](https://cloud.google.com/storage), SSH and more, although -you may need to install extra dependencies to use certain protocols. +[`project.yml`](/usage/projects#project-yml). Under the hood, spaCy uses +[`Pathy`](https://github.com/justindujardin/pathy) to communicate with the +remote storages, so you can use any protocol that `Pathy` supports, including +[S3](https://aws.amazon.com/s3/), +[Google Cloud Storage](https://cloud.google.com/storage), and the local +filesystem, although you may need to install extra dependencies to use certain +protocols. ```cli $ python -m spacy project pull [remote] [project_dir] diff --git a/website/docs/usage/projects.md b/website/docs/usage/projects.md index 34315e4e7..f57578049 100644 --- a/website/docs/usage/projects.md +++ b/website/docs/usage/projects.md @@ -259,9 +259,9 @@ pipelines. > This can be used in a project command like so: > > ```yaml -> - name: "echo-path" -> script: -> - "echo ${env.ENV_PATH}" +> - name: 'echo-path' +> script: +> - 'echo ${env.ENV_PATH}' > ``` | Section | Description | @@ -643,12 +643,13 @@ locally. You can list one or more remotes in the `remotes` section of your [`project.yml`](#project-yml) by mapping a string name to the URL of the -storage. Under the hood, spaCy uses the -[`smart-open`](https://github.com/RaRe-Technologies/smart_open) library to -communicate with the remote storages, so you can use any protocol that -`smart-open` supports, including [S3](https://aws.amazon.com/s3/), -[Google Cloud Storage](https://cloud.google.com/storage), SSH and more, although -you may need to install extra dependencies to use certain protocols. +storage. Under the hood, spaCy uses +[`Pathy`](https://github.com/justindujardin/pathy) to communicate with the +remote storages, so you can use any protocol that `Pathy` supports, including +[S3](https://aws.amazon.com/s3/), +[Google Cloud Storage](https://cloud.google.com/storage), and the local +filesystem, although you may need to install extra dependencies to use certain +protocols. > #### Example > @@ -661,7 +662,6 @@ you may need to install extra dependencies to use certain protocols. remotes: default: 's3://my-spacy-bucket' local: '/mnt/scratch/cache' - stuff: 'ssh://myserver.example.com/whatever' ``` From f1e024345043cdc986e70308a09a7ca383b60dd0 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Tue, 29 Nov 2022 19:50:23 +0900 Subject: [PATCH 115/161] Remove macro auc per type from textcat defaults (#11887) This appears to have been added by mistake and never used. Removing it does not break validation. --- spacy/pipeline/textcat.py | 1 - spacy/pipeline/textcat_multilabel.py | 1 - 2 files changed, 2 deletions(-) diff --git a/spacy/pipeline/textcat.py b/spacy/pipeline/textcat.py index 9490e3cb1..65121114d 100644 --- a/spacy/pipeline/textcat.py +++ b/spacy/pipeline/textcat.py @@ -87,7 +87,6 @@ subword_features = true "cats_macro_f": None, "cats_macro_auc": None, "cats_f_per_type": None, - "cats_macro_auc_per_type": None, }, ) def make_textcat( diff --git a/spacy/pipeline/textcat_multilabel.py b/spacy/pipeline/textcat_multilabel.py index ef9bd6557..328cee723 100644 --- a/spacy/pipeline/textcat_multilabel.py +++ b/spacy/pipeline/textcat_multilabel.py @@ -87,7 +87,6 @@ subword_features = true "cats_macro_f": None, "cats_macro_auc": None, "cats_f_per_type": None, - "cats_macro_auc_per_type": None, }, ) def make_multilabel_textcat( From 6f9d630f7e9c11d8d5f7ba37e3764ef3630c172d Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Tue, 29 Nov 2022 13:20:08 +0100 Subject: [PATCH 116/161] Replace Pipe type with Callable in Language (#11803) * Replace Pipe type with Callable in Language * Use Callable[[Doc], Doc] in the docstrings --- spacy/cli/debug_data.py | 2 + spacy/language.py | 55 ++++++++++++++-------------- spacy/tests/pipeline/test_textcat.py | 2 +- spacy/util.py | 7 ++-- 4 files changed, 33 insertions(+), 33 deletions(-) diff --git a/spacy/cli/debug_data.py b/spacy/cli/debug_data.py index 963d5b926..a85324e87 100644 --- a/spacy/cli/debug_data.py +++ b/spacy/cli/debug_data.py @@ -13,6 +13,7 @@ from ._util import import_code, debug_cli, _format_number from ..training import Example, remove_bilu_prefix from ..training.initialize import get_sourced_components from ..schemas import ConfigSchemaTraining +from ..pipeline import TrainablePipe from ..pipeline._parser_internals import nonproj from ..pipeline._parser_internals.nonproj import DELIMITER from ..pipeline import Morphologizer, SpanCategorizer @@ -934,6 +935,7 @@ def _get_labels_from_model(nlp: Language, factory_name: str) -> Set[str]: labels: Set[str] = set() for pipe_name in pipe_names: pipe = nlp.get_pipe(pipe_name) + assert isinstance(pipe, TrainablePipe) labels.update(pipe.labels) return labels diff --git a/spacy/language.py b/spacy/language.py index 2789b6690..e0abfd5e7 100644 --- a/spacy/language.py +++ b/spacy/language.py @@ -43,8 +43,7 @@ from .lookups import load_lookups from .compat import Literal -if TYPE_CHECKING: - from .pipeline import Pipe # noqa: F401 +PipeCallable = Callable[[Doc], Doc] # This is the base config will all settings (training etc.) @@ -181,7 +180,7 @@ class Language: self.vocab: Vocab = vocab if self.lang is None: self.lang = self.vocab.lang - self._components: List[Tuple[str, "Pipe"]] = [] + self._components: List[Tuple[str, PipeCallable]] = [] self._disabled: Set[str] = set() self.max_length = max_length # Create the default tokenizer from the default config @@ -303,7 +302,7 @@ class Language: return SimpleFrozenList(names) @property - def components(self) -> List[Tuple[str, "Pipe"]]: + def components(self) -> List[Tuple[str, PipeCallable]]: """Get all (name, component) tuples in the pipeline, including the currently disabled components. """ @@ -322,12 +321,12 @@ class Language: return SimpleFrozenList(names, error=Errors.E926.format(attr="component_names")) @property - def pipeline(self) -> List[Tuple[str, "Pipe"]]: + def pipeline(self) -> List[Tuple[str, PipeCallable]]: """The processing pipeline consisting of (name, component) tuples. The components are called on the Doc in order as it passes through the pipeline. - RETURNS (List[Tuple[str, Pipe]]): The pipeline. + RETURNS (List[Tuple[str, Callable[[Doc], Doc]]]): The pipeline. """ pipes = [(n, p) for n, p in self._components if n not in self._disabled] return SimpleFrozenList(pipes, error=Errors.E926.format(attr="pipeline")) @@ -527,7 +526,7 @@ class Language: assigns: Iterable[str] = SimpleFrozenList(), requires: Iterable[str] = SimpleFrozenList(), retokenizes: bool = False, - func: Optional["Pipe"] = None, + func: Optional[PipeCallable] = None, ) -> Callable[..., Any]: """Register a new pipeline component. Can be used for stateless function components that don't require a separate factory. Can be used as a @@ -542,7 +541,7 @@ class Language: e.g. "token.ent_id". Used for pipeline analysis. retokenizes (bool): Whether the component changes the tokenization. Used for pipeline analysis. - func (Optional[Callable]): Factory function if not used as a decorator. + func (Optional[Callable[[Doc], Doc]): Factory function if not used as a decorator. DOCS: https://spacy.io/api/language#component """ @@ -553,11 +552,11 @@ class Language: raise ValueError(Errors.E853.format(name=name)) component_name = name if name is not None else util.get_object_name(func) - def add_component(component_func: "Pipe") -> Callable: + def add_component(component_func: PipeCallable) -> Callable: if isinstance(func, type): # function is a class raise ValueError(Errors.E965.format(name=component_name)) - def factory_func(nlp, name: str) -> "Pipe": + def factory_func(nlp, name: str) -> PipeCallable: return component_func internal_name = cls.get_factory_name(name) @@ -607,7 +606,7 @@ class Language: print_pipe_analysis(analysis, keys=keys) return analysis - def get_pipe(self, name: str) -> "Pipe": + def get_pipe(self, name: str) -> PipeCallable: """Get a pipeline component for a given component name. name (str): Name of pipeline component to get. @@ -628,7 +627,7 @@ class Language: config: Dict[str, Any] = SimpleFrozenDict(), raw_config: Optional[Config] = None, validate: bool = True, - ) -> "Pipe": + ) -> PipeCallable: """Create a pipeline component. Mostly used internally. To create and add a component to the pipeline, you can use nlp.add_pipe. @@ -640,7 +639,7 @@ class Language: raw_config (Optional[Config]): Internals: the non-interpolated config. validate (bool): Whether to validate the component config against the arguments and types expected by the factory. - RETURNS (Pipe): The pipeline component. + RETURNS (Callable[[Doc], Doc]): The pipeline component. DOCS: https://spacy.io/api/language#create_pipe """ @@ -695,13 +694,13 @@ class Language: def create_pipe_from_source( self, source_name: str, source: "Language", *, name: str - ) -> Tuple["Pipe", str]: + ) -> Tuple[PipeCallable, str]: """Create a pipeline component by copying it from an existing model. source_name (str): Name of the component in the source pipeline. source (Language): The source nlp object to copy from. name (str): Optional alternative name to use in current pipeline. - RETURNS (Tuple[Callable, str]): The component and its factory name. + RETURNS (Tuple[Callable[[Doc], Doc], str]): The component and its factory name. """ # Check source type if not isinstance(source, Language): @@ -740,7 +739,7 @@ class Language: config: Dict[str, Any] = SimpleFrozenDict(), raw_config: Optional[Config] = None, validate: bool = True, - ) -> "Pipe": + ) -> PipeCallable: """Add a component to the processing pipeline. Valid components are callables that take a `Doc` object, modify it and return it. Only one of before/after/first/last can be set. Default behaviour is "last". @@ -763,7 +762,7 @@ class Language: raw_config (Optional[Config]): Internals: the non-interpolated config. validate (bool): Whether to validate the component config against the arguments and types expected by the factory. - RETURNS (Pipe): The pipeline component. + RETURNS (Callable[[Doc], Doc]): The pipeline component. DOCS: https://spacy.io/api/language#add_pipe """ @@ -869,7 +868,7 @@ class Language: *, config: Dict[str, Any] = SimpleFrozenDict(), validate: bool = True, - ) -> "Pipe": + ) -> PipeCallable: """Replace a component in the pipeline. name (str): Name of the component to replace. @@ -878,7 +877,7 @@ class Language: component. Will be merged with default config, if available. validate (bool): Whether to validate the component config against the arguments and types expected by the factory. - RETURNS (Pipe): The new pipeline component. + RETURNS (Callable[[Doc], Doc]): The new pipeline component. DOCS: https://spacy.io/api/language#replace_pipe """ @@ -930,11 +929,11 @@ class Language: init_cfg = self._config["initialize"]["components"].pop(old_name) self._config["initialize"]["components"][new_name] = init_cfg - def remove_pipe(self, name: str) -> Tuple[str, "Pipe"]: + def remove_pipe(self, name: str) -> Tuple[str, PipeCallable]: """Remove a component from the pipeline. name (str): Name of the component to remove. - RETURNS (tuple): A `(name, component)` tuple of the removed component. + RETURNS (Tuple[str, Callable[[Doc], Doc]]): A `(name, component)` tuple of the removed component. DOCS: https://spacy.io/api/language#remove_pipe """ @@ -1349,15 +1348,15 @@ class Language: def set_error_handler( self, - error_handler: Callable[[str, "Pipe", List[Doc], Exception], NoReturn], + error_handler: Callable[[str, PipeCallable, List[Doc], Exception], NoReturn], ): - """Set an error handler object for all the components in the pipeline that implement - a set_error_handler function. + """Set an error handler object for all the components in the pipeline + that implement a set_error_handler function. - error_handler (Callable[[str, Pipe, List[Doc], Exception], NoReturn]): - Function that deals with a failing batch of documents. This callable function should take in - the component's name, the component itself, the offending batch of documents, and the exception - that was thrown. + error_handler (Callable[[str, Callable[[Doc], Doc], List[Doc], Exception], NoReturn]): + Function that deals with a failing batch of documents. This callable + function should take in the component's name, the component itself, + the offending batch of documents, and the exception that was thrown. DOCS: https://spacy.io/api/language#set_error_handler """ self.default_error_handler = error_handler diff --git a/spacy/tests/pipeline/test_textcat.py b/spacy/tests/pipeline/test_textcat.py index 2eda9deaf..155ce99a2 100644 --- a/spacy/tests/pipeline/test_textcat.py +++ b/spacy/tests/pipeline/test_textcat.py @@ -838,8 +838,8 @@ def test_textcat_loss(multi_label: bool, expected_loss: float): textcat = nlp.add_pipe("textcat_multilabel") else: textcat = nlp.add_pipe("textcat") - textcat.initialize(lambda: train_examples) assert isinstance(textcat, TextCategorizer) + textcat.initialize(lambda: train_examples) scores = textcat.model.ops.asarray( [[0.0, 0.0, 0.0, 1.0], [0.0, 0.0, 1.0, 1.0]], dtype="f" # type: ignore ) diff --git a/spacy/util.py b/spacy/util.py index 76a1e0bfa..cba403361 100644 --- a/spacy/util.py +++ b/spacy/util.py @@ -51,8 +51,7 @@ from . import about if TYPE_CHECKING: # This lets us add type hints for mypy etc. without causing circular imports - from .language import Language # noqa: F401 - from .pipeline import Pipe # noqa: F401 + from .language import Language, PipeCallable # noqa: F401 from .tokens import Doc, Span # noqa: F401 from .vocab import Vocab # noqa: F401 @@ -1642,9 +1641,9 @@ def check_bool_env_var(env_var: str) -> bool: def _pipe( docs: Iterable["Doc"], - proc: "Pipe", + proc: "PipeCallable", name: str, - default_error_handler: Callable[[str, "Pipe", List["Doc"], Exception], NoReturn], + default_error_handler: Callable[[str, "PipeCallable", List["Doc"], Exception], NoReturn], kwargs: Mapping[str, Any], ) -> Iterator["Doc"]: if hasattr(proc, "pipe"): From afd7a2476d2491af864d0723bff96191ea61b429 Mon Sep 17 00:00:00 2001 From: Damian Romero <12145757+damian-romero@users.noreply.github.com> Date: Thu, 1 Dec 2022 07:06:28 -0500 Subject: [PATCH 117/161] Fix typo in vocab.md table (#11908) * Fix typo in vocab.md table Fixes explosion/spaCy/#11907 * Reformat vocab.md with Prettier --- website/docs/api/vocab.md | 16 ++++++++-------- 1 file changed, 8 insertions(+), 8 deletions(-) diff --git a/website/docs/api/vocab.md b/website/docs/api/vocab.md index afbd1301d..5e4de219a 100644 --- a/website/docs/api/vocab.md +++ b/website/docs/api/vocab.md @@ -308,14 +308,14 @@ Load state from a binary string. > assert type(PERSON) == int > ``` -| Name | Description | -| ---------------------------------------------- | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------- | -| `strings` | A table managing the string-to-int mapping. ~~StringStore~~ | -| `vectors` | A table associating word IDs to word vectors. ~~Vectors~~ | -| `vectors_length` | Number of dimensions for each word vector. ~~int~~ | -| `lookups` | The available lookup tables in this vocab. ~~Lookups~~ | -| `writing_system` | A dict with information about the language's writing system. ~~Dict[str, Any]~~ | -| `get_noun_chunks` 3.0 | A function that yields base noun phrases used for [`Doc.noun_chunks`](/ap/doc#noun_chunks). ~~Optional[Callable[[Union[Doc, Span], Iterator[Tuple[int, int, int]]]]]~~ | +| Name | Description | +| ---------------------------------------------- | ----------------------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `strings` | A table managing the string-to-int mapping. ~~StringStore~~ | +| `vectors` | A table associating word IDs to word vectors. ~~Vectors~~ | +| `vectors_length` | Number of dimensions for each word vector. ~~int~~ | +| `lookups` | The available lookup tables in this vocab. ~~Lookups~~ | +| `writing_system` | A dict with information about the language's writing system. ~~Dict[str, Any]~~ | +| `get_noun_chunks` 3.0 | A function that yields base noun phrases used for [`Doc.noun_chunks`](/api/doc#noun_chunks). ~~Optional[Callable[[Union[Doc, Span], Iterator[Tuple[int, int, int]]]]]~~ | ## Serialization fields {#serialization-fields} From 9cf3fa9711dfff94e88d6e137a52ebabdcceaad8 Mon Sep 17 00:00:00 2001 From: Zhangrp Date: Thu, 1 Dec 2022 20:30:27 +0800 Subject: [PATCH 118/161] Add docs for biluo_to_iob and iob_to_biluo. (#11901) * Add docs for biluo_to_iob and iob_to_biluo. * Fix typos. * Remove redundant links. --- website/docs/api/top-level.md | 48 +++++++++++++++++++++++++++++++++++ 1 file changed, 48 insertions(+) diff --git a/website/docs/api/top-level.md b/website/docs/api/top-level.md index 211affa4a..26a5d42f4 100644 --- a/website/docs/api/top-level.md +++ b/website/docs/api/top-level.md @@ -1004,6 +1004,54 @@ This method was previously available as `spacy.gold.spans_from_biluo_tags`. | `tags` | A sequence of [BILUO](/usage/linguistic-features#accessing-ner) tags with each tag describing one token. Each tag string will be of the form of either `""`, `"O"` or `"{action}-{label}"`, where action is one of `"B"`, `"I"`, `"L"`, `"U"`. ~~List[str]~~ | | **RETURNS** | A sequence of `Span` objects with added entity labels. ~~List[Span]~~ | +### training.biluo_to_iob {#biluo_to_iob tag="function"} + +Convert a sequence of [BILUO](/usage/linguistic-features#accessing-ner) tags to +[IOB](/usage/linguistic-features#accessing-ner) tags. This is useful if you want +use the BILUO tags with a model that only supports IOB tags. + +> #### Example +> +> ```python +> from spacy.training import biluo_to_iob +> +> tags = ["O", "O", "B-LOC", "I-LOC", "L-LOC", "O"] +> iob_tags = biluo_to_iob(tags) +> assert iob_tags == ["O", "O", "B-LOC", "I-LOC", "I-LOC", "O"] +> ``` + +| Name | Description | +| ----------- | --------------------------------------------------------------------------------------- | +| `tags` | A sequence of [BILUO](/usage/linguistic-features#accessing-ner) tags. ~~Iterable[str]~~ | +| **RETURNS** | A list of [IOB](/usage/linguistic-features#accessing-ner) tags. ~~List[str]~~ | + +### training.iob_to_biluo {#iob_to_biluo tag="function"} + +Convert a sequence of [IOB](/usage/linguistic-features#accessing-ner) tags to +[BILUO](/usage/linguistic-features#accessing-ner) tags. This is useful if you +want use the IOB tags with a model that only supports BILUO tags. + + + +This method was previously available as `spacy.gold.iob_to_biluo`. + + + +> #### Example +> +> ```python +> from spacy.training import iob_to_biluo +> +> tags = ["O", "O", "B-LOC", "I-LOC", "O"] +> biluo_tags = iob_to_biluo(tags) +> assert biluo_tags == ["O", "O", "B-LOC", "L-LOC", "O"] +> ``` + +| Name | Description | +| ----------- | ------------------------------------------------------------------------------------- | +| `tags` | A sequence of [IOB](/usage/linguistic-features#accessing-ner) tags. ~~Iterable[str]~~ | +| **RETURNS** | A list of [BILUO](/usage/linguistic-features#accessing-ner) tags. ~~List[str]~~ | + ## Utility functions {#util source="spacy/util.py"} spaCy comes with a small collection of utility functions located in From 445c670a2d537598b3d562fb7f444050164a260b Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Fri, 2 Dec 2022 09:33:52 +0100 Subject: [PATCH 119/161] Fix spancat for zero suggestions (#11860) * Add test for spancat predict with zero suggestions * Fix spancat for zero suggestions * Undo changes to extract_spans * Use .sum() as in update --- spacy/pipeline/spancat.py | 5 +++- spacy/tests/pipeline/test_spancat.py | 43 ++++++++++++++++++++++------ 2 files changed, 38 insertions(+), 10 deletions(-) diff --git a/spacy/pipeline/spancat.py b/spacy/pipeline/spancat.py index 0a84c72fd..a3388e81a 100644 --- a/spacy/pipeline/spancat.py +++ b/spacy/pipeline/spancat.py @@ -272,7 +272,10 @@ class SpanCategorizer(TrainablePipe): DOCS: https://spacy.io/api/spancategorizer#predict """ indices = self.suggester(docs, ops=self.model.ops) - scores = self.model.predict((docs, indices)) # type: ignore + if indices.lengths.sum() == 0: + scores = self.model.ops.alloc2f(0, 0) + else: + scores = self.model.predict((docs, indices)) # type: ignore return indices, scores def set_candidates( diff --git a/spacy/tests/pipeline/test_spancat.py b/spacy/tests/pipeline/test_spancat.py index 15256a763..e9db983d3 100644 --- a/spacy/tests/pipeline/test_spancat.py +++ b/spacy/tests/pipeline/test_spancat.py @@ -372,24 +372,39 @@ def test_overfitting_IO_overlapping(): def test_zero_suggestions(): - # Test with a suggester that returns 0 suggestions + # Test with a suggester that can return 0 suggestions - @registry.misc("test_zero_suggester") - def make_zero_suggester(): - def zero_suggester(docs, *, ops=None): + @registry.misc("test_mixed_zero_suggester") + def make_mixed_zero_suggester(): + def mixed_zero_suggester(docs, *, ops=None): if ops is None: ops = get_current_ops() - return Ragged( - ops.xp.zeros((0, 0), dtype="i"), ops.xp.zeros((len(docs),), dtype="i") - ) + spans = [] + lengths = [] + for doc in docs: + if len(doc) > 0 and len(doc) % 2 == 0: + spans.append((0, 1)) + lengths.append(1) + else: + lengths.append(0) + spans = ops.asarray2i(spans) + lengths_array = ops.asarray1i(lengths) + if len(spans) > 0: + output = Ragged(ops.xp.vstack(spans), lengths_array) + else: + output = Ragged(ops.xp.zeros((0, 0), dtype="i"), lengths_array) + return output - return zero_suggester + return mixed_zero_suggester fix_random_seed(0) nlp = English() spancat = nlp.add_pipe( "spancat", - config={"suggester": {"@misc": "test_zero_suggester"}, "spans_key": SPAN_KEY}, + config={ + "suggester": {"@misc": "test_mixed_zero_suggester"}, + "spans_key": SPAN_KEY, + }, ) train_examples = make_examples(nlp) optimizer = nlp.initialize(get_examples=lambda: train_examples) @@ -397,6 +412,16 @@ def test_zero_suggestions(): assert set(spancat.labels) == {"LOC", "PERSON"} nlp.update(train_examples, sgd=optimizer) + # empty doc + nlp("") + # single doc with zero suggestions + nlp("one") + # single doc with one suggestion + nlp("two two") + # batch with mixed zero/one suggestions + list(nlp.pipe(["one", "two two", "three three three", "", "four four four four"])) + # batch with no suggestions + list(nlp.pipe(["", "one", "three three three"])) def test_set_candidates(): From f9d17a644b3d037924f715c03672ada6d12e4d86 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Fri, 2 Dec 2022 18:17:11 +0900 Subject: [PATCH 120/161] Config generation fails for GPU without transformers (#11899) If you don't have spacy-transformers installed, but try to use `init config` with the GPU flag, you'll get an error. The issue is that the `use_transformers` flag in the config is conflated with the GPU flag, and then there's an attempt to access transformers config info that may not exist. There may be a better way to do this, but this stops the error. --- spacy/cli/templates/quickstart_training.jinja | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/cli/templates/quickstart_training.jinja b/spacy/cli/templates/quickstart_training.jinja index 58864883a..b961ac892 100644 --- a/spacy/cli/templates/quickstart_training.jinja +++ b/spacy/cli/templates/quickstart_training.jinja @@ -1,7 +1,7 @@ {# This is a template for training configs used for the quickstart widget in the docs and the init config command. It encodes various best practices and can help generate the best possible configuration, given a user's requirements. #} -{%- set use_transformer = hardware != "cpu" -%} +{%- set use_transformer = hardware != "cpu" and transformer_data -%} {%- set transformer = transformer_data[optimize] if use_transformer else {} -%} {%- set listener_components = ["tagger", "morphologizer", "parser", "ner", "textcat", "textcat_multilabel", "entity_linker", "spancat", "trainable_lemmatizer"] -%} [paths] From df0cb4b77be6e20a62143f5f65c3e165a4a45bcc Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 2 Dec 2022 14:49:12 +0100 Subject: [PATCH 121/161] Auto-format code with black (#11913) Co-authored-by: explosion-bot --- spacy/util.py | 4 +++- 1 file changed, 3 insertions(+), 1 deletion(-) diff --git a/spacy/util.py b/spacy/util.py index cba403361..8d211a9a5 100644 --- a/spacy/util.py +++ b/spacy/util.py @@ -1643,7 +1643,9 @@ def _pipe( docs: Iterable["Doc"], proc: "PipeCallable", name: str, - default_error_handler: Callable[[str, "PipeCallable", List["Doc"], Exception], NoReturn], + default_error_handler: Callable[ + [str, "PipeCallable", List["Doc"], Exception], NoReturn + ], kwargs: Mapping[str, Any], ) -> Iterator["Doc"]: if hasattr(proc, "pipe"): From 4b2097a2713b548cba1c841fa5cb8f6f42e3e30f Mon Sep 17 00:00:00 2001 From: Sofie Van Landeghem Date: Mon, 5 Dec 2022 08:29:13 +0100 Subject: [PATCH 122/161] fix links (#11927) --- website/docs/usage/v3-4.md | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/website/docs/usage/v3-4.md b/website/docs/usage/v3-4.md index 597fc3cc8..e10110b71 100644 --- a/website/docs/usage/v3-4.md +++ b/website/docs/usage/v3-4.md @@ -66,8 +66,8 @@ The English CNN pipelines have new word vectors: | Package | Model Version | TAG | Parser LAS | NER F | | ----------------------------------------------- | ------------- | ---: | ---------: | ----: | | [`en_core_web_md`](/models/en#en_core_web_md) | v3.3.0 | 97.3 | 90.1 | 84.6 | -| [`en_core_web_md`](/models/en#en_core_web_lg) | v3.4.0 | 97.2 | 90.3 | 85.5 | -| [`en_core_web_lg`](/models/en#en_core_web_md) | v3.3.0 | 97.4 | 90.1 | 85.3 | +| [`en_core_web_md`](/models/en#en_core_web_md) | v3.4.0 | 97.2 | 90.3 | 85.5 | +| [`en_core_web_lg`](/models/en#en_core_web_lg) | v3.3.0 | 97.4 | 90.1 | 85.3 | | [`en_core_web_lg`](/models/en#en_core_web_lg) | v3.4.0 | 97.3 | 90.2 | 85.6 | ## Notes about upgrading from v3.3 {#upgrading} From 799d2266762b443097f8f2125c93148c2156be1b Mon Sep 17 00:00:00 2001 From: svlandeg Date: Mon, 5 Dec 2022 08:57:24 +0100 Subject: [PATCH 123/161] prettier formatting --- website/docs/api/cli.md | 3 +-- website/docs/usage/index.md | 12 ++++++------ website/docs/usage/processing-pipelines.md | 7 ++++--- website/docs/usage/v3-4.md | 4 ++-- 4 files changed, 13 insertions(+), 13 deletions(-) diff --git a/website/docs/api/cli.md b/website/docs/api/cli.md index 8823a3bd8..92a123241 100644 --- a/website/docs/api/cli.md +++ b/website/docs/api/cli.md @@ -474,7 +474,7 @@ report span characteristics such as the average span length and the span (or span boundary) distinctiveness. The distinctiveness measure shows how different the tokens are with respect to the rest of the corpus using the KL-divergence of the token distributions. To learn more, you can check out Papay et al.'s work on -[*Dissecting Span Identification Tasks with Performance Prediction* (EMNLP 2020)](https://aclanthology.org/2020.emnlp-main.396/). +[_Dissecting Span Identification Tasks with Performance Prediction_ (EMNLP 2020)](https://aclanthology.org/2020.emnlp-main.396/). @@ -1187,7 +1187,6 @@ be provided. > $ python -m spacy find-threshold my_nlp data.spacy spancat threshold spans_sc_f > ``` - | Name | Description | | ----------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | | `model` | Pipeline to evaluate. Can be a package or a path to a data directory. ~~str (positional)~~ | diff --git a/website/docs/usage/index.md b/website/docs/usage/index.md index dff5a16ba..d6ad6681c 100644 --- a/website/docs/usage/index.md +++ b/website/docs/usage/index.md @@ -235,10 +235,10 @@ package to see what the oldest recommended versions of `numpy` are. Some additional options may be useful for spaCy developers who are editing the source code and recompiling frequently. -- Install in editable mode. Changes to `.py` files will be reflected as soon - as the files are saved, but edits to Cython files (`.pxd`, `.pyx`) will - require the `pip install` command below to be run again. Before installing in - editable mode, be sure you have removed any previous installs with +- Install in editable mode. Changes to `.py` files will be reflected as soon as + the files are saved, but edits to Cython files (`.pxd`, `.pyx`) will require + the `pip install` command below to be run again. Before installing in editable + mode, be sure you have removed any previous installs with `pip uninstall spacy`, which you may need to run multiple times to remove all traces of earlier installs. @@ -247,8 +247,8 @@ source code and recompiling frequently. $ pip install --no-build-isolation --editable . ``` -- Build in parallel. Starting in v3.4.0, you can specify the number of - build jobs with the environment variable `SPACY_NUM_BUILD_JOBS`: +- Build in parallel. Starting in v3.4.0, you can specify the number of build + jobs with the environment variable `SPACY_NUM_BUILD_JOBS`: ```bash $ pip install -r requirements.txt diff --git a/website/docs/usage/processing-pipelines.md b/website/docs/usage/processing-pipelines.md index 9bf85e54c..b3940458b 100644 --- a/website/docs/usage/processing-pipelines.md +++ b/website/docs/usage/processing-pipelines.md @@ -365,7 +365,8 @@ nlp.enable_pipe("tagger") In addition to `disable`, `spacy.load()` also accepts `enable`. If `enable` is set, all components except for those in `enable` are disabled. If `enable` and -`disable` conflict (i.e. the same component is included in both), an error is raised. +`disable` conflict (i.e. the same component is included in both), an error is +raised. ```python # Load the complete pipeline, but disable all components except for tok2vec and tagger @@ -1400,8 +1401,8 @@ Writing to a `._` attribute instead of to the `Doc` directly keeps a clearer separation and makes it easier to ensure backwards compatibility. For example, if you've implemented your own `.coref` property and spaCy claims it one day, it'll break your code. Similarly, just by looking at the code, you'll -immediately know what's built-in and what's custom – for example, -`doc.lang` is spaCy, while `doc._.language` isn't. +immediately know what's built-in and what's custom – for example, `doc.lang` is +spaCy, while `doc._.language` isn't. diff --git a/website/docs/usage/v3-4.md b/website/docs/usage/v3-4.md index e10110b71..e6987e7a2 100644 --- a/website/docs/usage/v3-4.md +++ b/website/docs/usage/v3-4.md @@ -63,8 +63,8 @@ All CNN pipelines have been extended with whitespace augmentation. The English CNN pipelines have new word vectors: -| Package | Model Version | TAG | Parser LAS | NER F | -| ----------------------------------------------- | ------------- | ---: | ---------: | ----: | +| Package | Model Version | TAG | Parser LAS | NER F | +| --------------------------------------------- | ------------- | ---: | ---------: | ----: | | [`en_core_web_md`](/models/en#en_core_web_md) | v3.3.0 | 97.3 | 90.1 | 84.6 | | [`en_core_web_md`](/models/en#en_core_web_md) | v3.4.0 | 97.2 | 90.3 | 85.5 | | [`en_core_web_lg`](/models/en#en_core_web_lg) | v3.3.0 | 97.4 | 90.1 | 85.3 | From 5848656b5e3287d77674ce678e321eadea52f68e Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Mon, 5 Dec 2022 17:43:23 +0900 Subject: [PATCH 124/161] Switch ubuntu-latest to ubuntu-20.04 in main tests (#11928) * Switch ubuntu-latest to ubuntu-20.04 in main tests * Only use 20.04 for 3.6 --- azure-pipelines.yml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/azure-pipelines.yml b/azure-pipelines.yml index 9c3b92f06..0f7ea91f9 100644 --- a/azure-pipelines.yml +++ b/azure-pipelines.yml @@ -41,7 +41,7 @@ jobs: matrix: # We're only running one platform per Python version to speed up builds Python36Linux: - imageName: "ubuntu-latest" + imageName: "ubuntu-20.04" python.version: "3.6" # Python36Windows: # imageName: "windows-latest" @@ -50,7 +50,7 @@ jobs: # imageName: "macos-latest" # python.version: "3.6" # Python37Linux: - # imageName: "ubuntu-latest" + # imageName: "ubuntu-20.04" # python.version: "3.7" Python37Windows: imageName: "windows-latest" From 8267aa1b65783ea29e42f470eaf7553ff7508206 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Mon, 5 Dec 2022 17:43:23 +0900 Subject: [PATCH 125/161] Switch ubuntu-latest to ubuntu-20.04 in main tests (#11928) * Switch ubuntu-latest to ubuntu-20.04 in main tests * Only use 20.04 for 3.6 --- azure-pipelines.yml | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/azure-pipelines.yml b/azure-pipelines.yml index 9c3b92f06..0f7ea91f9 100644 --- a/azure-pipelines.yml +++ b/azure-pipelines.yml @@ -41,7 +41,7 @@ jobs: matrix: # We're only running one platform per Python version to speed up builds Python36Linux: - imageName: "ubuntu-latest" + imageName: "ubuntu-20.04" python.version: "3.6" # Python36Windows: # imageName: "windows-latest" @@ -50,7 +50,7 @@ jobs: # imageName: "macos-latest" # python.version: "3.6" # Python37Linux: - # imageName: "ubuntu-latest" + # imageName: "ubuntu-20.04" # python.version: "3.7" Python37Windows: imageName: "windows-latest" From 6f342bdd72f300cdc431d0e0f2a168c62fd2a861 Mon Sep 17 00:00:00 2001 From: Darigov Research <30328618+darigovresearch@users.noreply.github.com> Date: Mon, 5 Dec 2022 08:49:04 +0000 Subject: [PATCH 126/161] docs: Adds link to license in readme (#11924) Would resolve https://github.com/explosion/spaCy/issues/11923 if merged --- README.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/README.md b/README.md index abfc3da67..7595460fb 100644 --- a/README.md +++ b/README.md @@ -14,7 +14,7 @@ parsing, **named entity recognition**, **text classification** and more, multi-task learning with pretrained **transformers** like BERT, as well as a production-ready [**training system**](https://spacy.io/usage/training) and easy model packaging, deployment and workflow management. spaCy is commercial -open-source software, released under the MIT license. +open-source software, released under the [MIT license](https://github.com/explosion/spaCy/blob/master/LICENSE). 💫 **Version 3.4 out now!** [Check out the release notes here.](https://github.com/explosion/spaCy/releases) From 8afa8b5a7b8ee51eb42b83dabd0f3c1276369e73 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Mon, 5 Dec 2022 10:00:00 +0100 Subject: [PATCH 127/161] Refactor kwargs in CLI msg for future wasabi compatibility (#11918) Necessary for mypy with wasabi v1+. --- spacy/cli/project/run.py | 4 ++-- 1 file changed, 2 insertions(+), 2 deletions(-) diff --git a/spacy/cli/project/run.py b/spacy/cli/project/run.py index a109c4a5a..6dd174902 100644 --- a/spacy/cli/project/run.py +++ b/spacy/cli/project/run.py @@ -101,8 +101,8 @@ def project_run( if not (project_dir / dep).exists(): err = f"Missing dependency specified by command '{subcommand}': {dep}" err_help = "Maybe you forgot to run the 'project assets' command or a previous step?" - err_kwargs = {"exits": 1} if not dry else {} - msg.fail(err, err_help, **err_kwargs) + err_exits = 1 if not dry else None + msg.fail(err, err_help, exits=err_exits) check_spacy_commit = check_bool_env_var(ENV_VARS.PROJECT_USE_GIT_VERSION) with working_dir(project_dir) as current_dir: msg.divider(subcommand) From 1aadcfcb37ba166558688782fabbcbe3e32ea020 Mon Sep 17 00:00:00 2001 From: Ryn Daniels <397565+ryndaniels@users.noreply.github.com> Date: Mon, 5 Dec 2022 11:17:10 +0200 Subject: [PATCH 128/161] update lock-threads to v4 (#11930) --- .github/workflows/lock.yml | 8 ++++---- 1 file changed, 4 insertions(+), 4 deletions(-) diff --git a/.github/workflows/lock.yml b/.github/workflows/lock.yml index c9833cdba..794adee85 100644 --- a/.github/workflows/lock.yml +++ b/.github/workflows/lock.yml @@ -15,11 +15,11 @@ jobs: action: runs-on: ubuntu-latest steps: - - uses: dessant/lock-threads@v3 + - uses: dessant/lock-threads@v4 with: process-only: 'issues' issue-inactive-days: '30' - issue-comment: > - This thread has been automatically locked since there - has not been any recent activity after it was closed. + issue-comment: > + This thread has been automatically locked since there + has not been any recent activity after it was closed. Please open a new issue for related bugs. From 23085ffef4bba62aff0de5993ff405cb3ff3528c Mon Sep 17 00:00:00 2001 From: Zhangrp Date: Tue, 6 Dec 2022 16:42:12 +0800 Subject: [PATCH 129/161] Fix interpolation in directory names, see #11235. (#11914) --- spacy/cli/_util.py | 8 ++++---- spacy/tests/test_cli.py | 19 +++++++++++++++++++ 2 files changed, 23 insertions(+), 4 deletions(-) diff --git a/spacy/cli/_util.py b/spacy/cli/_util.py index 7ce006108..9b97a9f19 100644 --- a/spacy/cli/_util.py +++ b/spacy/cli/_util.py @@ -158,15 +158,15 @@ def load_project_config( sys.exit(1) validate_project_version(config) validate_project_commands(config) + if interpolate: + err = f"{PROJECT_FILE} validation error" + with show_validation_error(title=err, hint_fill=False): + config = substitute_project_variables(config, overrides) # Make sure directories defined in config exist for subdir in config.get("directories", []): dir_path = path / subdir if not dir_path.exists(): dir_path.mkdir(parents=True) - if interpolate: - err = f"{PROJECT_FILE} validation error" - with show_validation_error(title=err, hint_fill=False): - config = substitute_project_variables(config, overrides) return config diff --git a/spacy/tests/test_cli.py b/spacy/tests/test_cli.py index 2e706458f..3104b49ff 100644 --- a/spacy/tests/test_cli.py +++ b/spacy/tests/test_cli.py @@ -123,6 +123,25 @@ def test_issue7055(): assert "model" in filled_cfg["components"]["ner"] +@pytest.mark.issue(11235) +def test_issue11235(): + """ + Test that the cli handles interpolation in the directory names correctly when loading project config. + """ + lang_var = "en" + variables = {"lang": lang_var} + commands = [{"name": "x", "script": ["hello ${vars.lang}"]}] + directories = ["cfg", "${vars.lang}_model"] + project = {"commands": commands, "vars": variables, "directories": directories} + with make_tempdir() as d: + srsly.write_yaml(d / "project.yml", project) + cfg = load_project_config(d) + # Check that the directories are interpolated and created correctly + assert os.path.exists(d / "cfg") + assert os.path.exists(d / f"{lang_var}_model") + assert cfg["commands"][0]["script"][0] == f"hello {lang_var}" + + def test_cli_info(): nlp = Dutch() nlp.add_pipe("textcat") From 27fac7df2e67a0dbfefd68834c14fb1f9505da49 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Dani=C3=ABl=20de=20Kok?= Date: Wed, 7 Dec 2022 05:53:41 +0100 Subject: [PATCH 130/161] EditTreeLemmatizer: correctly add strings when initializing from labels (#11934) Strings in replacement nodes where not added to the `StringStore` when `EditTreeLemmatizer` was initialized from a set of labels. The corresponding test did not capture this because it added the strings through the examples that were passed to the initialization. This change fixes both this bug in the initialization as the 'shadowing' of the bug in the test. --- spacy/pipeline/edit_tree_lemmatizer.py | 4 +- .../pipeline/test_edit_tree_lemmatizer.py | 37 ++++++++++++++++++- 2 files changed, 38 insertions(+), 3 deletions(-) diff --git a/spacy/pipeline/edit_tree_lemmatizer.py b/spacy/pipeline/edit_tree_lemmatizer.py index 12f9b73a3..a56c9975e 100644 --- a/spacy/pipeline/edit_tree_lemmatizer.py +++ b/spacy/pipeline/edit_tree_lemmatizer.py @@ -328,9 +328,9 @@ class EditTreeLemmatizer(TrainablePipe): tree = dict(tree) if "orig" in tree: - tree["orig"] = self.vocab.strings[tree["orig"]] + tree["orig"] = self.vocab.strings.add(tree["orig"]) if "orig" in tree: - tree["subst"] = self.vocab.strings[tree["subst"]] + tree["subst"] = self.vocab.strings.add(tree["subst"]) trees.append(tree) diff --git a/spacy/tests/pipeline/test_edit_tree_lemmatizer.py b/spacy/tests/pipeline/test_edit_tree_lemmatizer.py index cf541e301..b12ca5dd4 100644 --- a/spacy/tests/pipeline/test_edit_tree_lemmatizer.py +++ b/spacy/tests/pipeline/test_edit_tree_lemmatizer.py @@ -60,10 +60,45 @@ def test_initialize_from_labels(): nlp2 = Language() lemmatizer2 = nlp2.add_pipe("trainable_lemmatizer") lemmatizer2.initialize( - get_examples=lambda: train_examples, + # We want to check that the strings in replacement nodes are + # added to the string store. Avoid that they get added through + # the examples. + get_examples=lambda: train_examples[:1], labels=lemmatizer.label_data, ) assert lemmatizer2.tree2label == {1: 0, 3: 1, 4: 2, 6: 3} + assert lemmatizer2.label_data == { + "trees": [ + {"orig": "S", "subst": "s"}, + { + "prefix_len": 1, + "suffix_len": 0, + "prefix_tree": 0, + "suffix_tree": 4294967295, + }, + {"orig": "s", "subst": ""}, + { + "prefix_len": 0, + "suffix_len": 1, + "prefix_tree": 4294967295, + "suffix_tree": 2, + }, + { + "prefix_len": 0, + "suffix_len": 0, + "prefix_tree": 4294967295, + "suffix_tree": 4294967295, + }, + {"orig": "E", "subst": "e"}, + { + "prefix_len": 1, + "suffix_len": 0, + "prefix_tree": 5, + "suffix_tree": 4294967295, + }, + ], + "labels": (1, 3, 4, 6), + } def test_no_data(): From 916191848ab7bf90e88f23401451695f61903112 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Wed, 7 Dec 2022 18:09:04 +0900 Subject: [PATCH 131/161] Update scattertext example code (#11937) * Update scattertext example code * Remove PMI Filter Threshold --- website/meta/universe.json | 25 +++++++++++++++++++------ 1 file changed, 19 insertions(+), 6 deletions(-) diff --git a/website/meta/universe.json b/website/meta/universe.json index 97b53e9c5..8ca657561 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -1468,13 +1468,26 @@ "image": "https://jasonkessler.github.io/2012conventions0.0.2.2.png", "code_example": [ "import spacy", - "import scattertext as st", "", - "nlp = spacy.load('en')", - "corpus = st.CorpusFromPandas(convention_df,", - " category_col='party',", - " text_col='text',", - " nlp=nlp).build()" + "from scattertext import SampleCorpora, produce_scattertext_explorer", + "from scattertext import produce_scattertext_html", + "from scattertext.CorpusFromPandas import CorpusFromPandas", + "", + "nlp = spacy.load('en_core_web_sm')", + "convention_df = SampleCorpora.ConventionData2012.get_data()", + "corpus = CorpusFromPandas(convention_df,", + " category_col='party',", + " text_col='text',", + " nlp=nlp).build()", + "", + "html = produce_scattertext_html(corpus,", + " category='democrat',", + " category_name='Democratic',", + " not_category_name='Republican',", + " minimum_term_frequency=5,", + " width_in_pixels=1000)", + "open('./simple.html', 'wb').write(html.encode('utf-8'))", + "print('Open ./simple.html in Chrome or Firefox.')" ], "author": "Jason Kessler", "author_links": { From 5c3a60e8f4273aff7bd47bce01d62c8224967045 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Wed, 7 Dec 2022 23:52:35 +0900 Subject: [PATCH 132/161] Add in errors used in the beam code that were removed at some point (#11935) I don't think there's any way to use the beam code at the moment, but as long as it's around the errors it refers to should also be present. --- spacy/errors.py | 5 +++++ 1 file changed, 5 insertions(+) diff --git a/spacy/errors.py b/spacy/errors.py index e34614b0f..0e5ef91ed 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -345,6 +345,11 @@ class Errors(metaclass=ErrorsWithCodes): "clear the existing vectors and resize the table.") E074 = ("Error interpreting compiled match pattern: patterns are expected " "to end with the attribute {attr}. Got: {bad_attr}.") + E079 = ("Error computing states in beam: number of predicted beams " + "({pbeams}) does not equal number of gold beams ({gbeams}).") + E080 = ("Duplicate state found in beam: {key}.") + E081 = ("Error getting gradient in beam: number of histories ({n_hist}) " + "does not equal number of losses ({losses}).") E082 = ("Error deprojectivizing parse: number of heads ({n_heads}), " "projective heads ({n_proj_heads}) and labels ({n_labels}) do not " "match.") From 73919336fb1b003425373a07d41e5541dc5c3c46 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Wed, 7 Dec 2022 23:56:03 +0900 Subject: [PATCH 133/161] Remove spacy-sentence-segmenter from Universe (#11932) --- website/meta/universe.json | 19 ------------------- 1 file changed, 19 deletions(-) diff --git a/website/meta/universe.json b/website/meta/universe.json index 8ca657561..db533c3b2 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -1023,25 +1023,6 @@ }, "category": ["pipeline"] }, - { - "id": "spacy-sentence-segmenter", - "title": "Sentence Segmenter", - "slogan": "Custom sentence segmentation for spaCy", - "code_example": [ - "from seg.newline.segmenter import NewLineSegmenter", - "import spacy", - "", - "nlseg = NewLineSegmenter()", - "nlp = spacy.load('en')", - "nlp.add_pipe(nlseg.set_sent_starts, name='sentence_segmenter', before='parser')", - "doc = nlp(my_doc_text)" - ], - "author": "tc64", - "author_links": { - "github": "tc64" - }, - "category": ["pipeline"] - }, { "id": "spacy_cld", "title": "spaCy-CLD", From 6d2ca1ab3a545491acbe058035677a263135e52a Mon Sep 17 00:00:00 2001 From: vincent d warmerdam Date: Wed, 7 Dec 2022 16:02:09 +0100 Subject: [PATCH 134/161] Update custom solutions links (#11903) * Update custom solutions Will now point to https://explosion.ai/custom-solutions * added-sidebar * added-analysis-to-readme * update-landing-page --- README.md | 2 ++ website/meta/sidebars.json | 2 +- website/meta/site.json | 2 +- website/src/widgets/landing.js | 4 ++-- 4 files changed, 6 insertions(+), 4 deletions(-) diff --git a/README.md b/README.md index 7595460fb..195424551 100644 --- a/README.md +++ b/README.md @@ -46,6 +46,7 @@ open-source software, released under the [MIT license](https://github.com/explos | 🛠 **[Changelog]** | Changes and version history. | | 💝 **[Contribute]** | How to contribute to the spaCy project and code base. | | spaCy Tailored Pipelines | Get a custom spaCy pipeline, tailor-made for your NLP problem by spaCy's core developers. Streamlined, production-ready, predictable and maintainable. Start by completing our 5-minute questionnaire to tell us what you need and we'll be in touch! **[Learn more →](https://explosion.ai/spacy-tailored-pipelines)** | +| spaCy Tailored Pipelines | Bespoke advice for problem solving, strategy and analysis for applied NLP projects. Services include data strategy, code reviews, pipeline design and annotation coaching. Curious? Fill in our 5-minute questionnaire to tell us what you need and we'll be in touch! **[Learn more →](https://explosion.ai/spacy-tailored-analysis)** | [spacy 101]: https://spacy.io/usage/spacy-101 [new in v3.0]: https://spacy.io/usage/v3 @@ -59,6 +60,7 @@ open-source software, released under the [MIT license](https://github.com/explos [changelog]: https://spacy.io/usage#changelog [contribute]: https://github.com/explosion/spaCy/blob/master/CONTRIBUTING.md + ## 💬 Where to ask questions The spaCy project is maintained by the [spaCy team](https://explosion.ai/about). diff --git a/website/meta/sidebars.json b/website/meta/sidebars.json index 2d8745d77..339e4085b 100644 --- a/website/meta/sidebars.json +++ b/website/meta/sidebars.json @@ -45,7 +45,7 @@ { "text": "v2.x Documentation", "url": "https://v2.spacy.io" }, { "text": "Custom Solutions", - "url": "https://explosion.ai/spacy-tailored-pipelines" + "url": "https://explosion.ai/custom-solutions" } ] } diff --git a/website/meta/site.json b/website/meta/site.json index 360a72178..fa79d3c69 100644 --- a/website/meta/site.json +++ b/website/meta/site.json @@ -51,7 +51,7 @@ { "text": "Online Course", "url": "https://course.spacy.io" }, { "text": "Custom Solutions", - "url": "https://explosion.ai/spacy-tailored-pipelines" + "url": "https://explosion.ai/custom-solutions" } ] }, diff --git a/website/src/widgets/landing.js b/website/src/widgets/landing.js index b7ae35f6e..c3aaa8a22 100644 --- a/website/src/widgets/landing.js +++ b/website/src/widgets/landing.js @@ -105,13 +105,13 @@ const Landing = ({ data }) => { - + spaCy Tailored Pipelines From 6b9af38eeb1fdcb50e50f5bb0093472f7e22f6ff Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Thu, 8 Dec 2022 19:43:52 +0900 Subject: [PATCH 135/161] Remove all references to "begin_training" (#11943) When v3 was released, `begin_training` was renamed to `initialize`. There were warnings in the code and docs about that. This PR removes them. --- spacy/errors.py | 7 ------- spacy/language.py | 9 --------- spacy/pipeline/pipe.pyx | 7 ------- spacy/tests/pipeline/test_pipe_methods.py | 11 ----------- website/docs/api/dependencyparser.md | 6 ------ website/docs/api/entitylinker.md | 6 ------ website/docs/api/entityrecognizer.md | 6 ------ website/docs/api/language.md | 9 --------- website/docs/api/pipe.md | 6 ------ website/docs/api/tagger.md | 6 ------ website/docs/api/textcategorizer.md | 6 ------ 11 files changed, 79 deletions(-) diff --git a/spacy/errors.py b/spacy/errors.py index 82e7c52bc..31230d7a4 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -131,13 +131,6 @@ class Warnings(metaclass=ErrorsWithCodes): "and make it independent. For example, `replace_listeners = " "[\"model.tok2vec\"]` See the documentation for details: " "https://spacy.io/usage/training#config-components-listeners") - W088 = ("The pipeline component {name} implements a `begin_training` " - "method, which won't be called by spaCy. As of v3.0, `begin_training` " - "has been renamed to `initialize`, so you likely want to rename the " - "component method. See the documentation for details: " - "https://spacy.io/api/language#initialize") - W089 = ("As of spaCy v3.0, the `nlp.begin_training` method has been renamed " - "to `nlp.initialize`.") W090 = ("Could not locate any {format} files in path '{path}'.") W091 = ("Could not clean/remove the temp directory at {dir}: {msg}.") W092 = ("Ignoring annotations for sentence starts, as dependency heads are set.") diff --git a/spacy/language.py b/spacy/language.py index e0abfd5e7..dcb62aef0 100644 --- a/spacy/language.py +++ b/spacy/language.py @@ -1239,15 +1239,6 @@ class Language: sgd(key, W, dW) # type: ignore[call-arg, misc] return losses - def begin_training( - self, - get_examples: Optional[Callable[[], Iterable[Example]]] = None, - *, - sgd: Optional[Optimizer] = None, - ) -> Optimizer: - warnings.warn(Warnings.W089, DeprecationWarning) - return self.initialize(get_examples, sgd=sgd) - def initialize( self, get_examples: Optional[Callable[[], Iterable[Example]]] = None, diff --git a/spacy/pipeline/pipe.pyx b/spacy/pipeline/pipe.pyx index 8407acc45..c5650382b 100644 --- a/spacy/pipeline/pipe.pyx +++ b/spacy/pipeline/pipe.pyx @@ -19,13 +19,6 @@ cdef class Pipe: DOCS: https://spacy.io/api/pipe """ - @classmethod - def __init_subclass__(cls, **kwargs): - """Raise a warning if an inheriting class implements 'begin_training' - (from v2) instead of the new 'initialize' method (from v3)""" - if hasattr(cls, "begin_training"): - warnings.warn(Warnings.W088.format(name=cls.__name__)) - def __call__(self, Doc doc) -> Doc: """Apply the pipe to one document. The document is modified in place, and returned. This usually happens under the hood when the nlp object diff --git a/spacy/tests/pipeline/test_pipe_methods.py b/spacy/tests/pipeline/test_pipe_methods.py index 4dd7bae16..9b9786f04 100644 --- a/spacy/tests/pipeline/test_pipe_methods.py +++ b/spacy/tests/pipeline/test_pipe_methods.py @@ -529,17 +529,6 @@ def test_pipe_label_data_no_labels(pipe): assert "labels" not in get_arg_names(initialize) -def test_warning_pipe_begin_training(): - with pytest.warns(UserWarning, match="begin_training"): - - class IncompatPipe(TrainablePipe): - def __init__(self): - ... - - def begin_training(*args, **kwargs): - ... - - def test_pipe_methods_initialize(): """Test that the [initialize] config reflects the components correctly.""" nlp = Language() diff --git a/website/docs/api/dependencyparser.md b/website/docs/api/dependencyparser.md index 27e315592..c30d39b57 100644 --- a/website/docs/api/dependencyparser.md +++ b/website/docs/api/dependencyparser.md @@ -169,12 +169,6 @@ arguments it receives via the [`[initialize.components]`](/api/data-formats#config-initialize) block in the config. - - -This method was previously called `begin_training`. - - - > #### Example > > ```python diff --git a/website/docs/api/entitylinker.md b/website/docs/api/entitylinker.md index 10132acd9..b116c4be4 100644 --- a/website/docs/api/entitylinker.md +++ b/website/docs/api/entitylinker.md @@ -200,12 +200,6 @@ knowledge base. This argument should be a function that takes a `Vocab` instance and creates the `KnowledgeBase`, ensuring that the strings of the knowledge base are synced with the current vocab. - - -This method was previously called `begin_training`. - - - > #### Example > > ```python diff --git a/website/docs/api/entityrecognizer.md b/website/docs/api/entityrecognizer.md index a535e8316..06828eb04 100644 --- a/website/docs/api/entityrecognizer.md +++ b/website/docs/api/entityrecognizer.md @@ -165,12 +165,6 @@ arguments it receives via the [`[initialize.components]`](/api/data-formats#config-initialize) block in the config. - - -This method was previously called `begin_training`. - - - > #### Example > > ```python diff --git a/website/docs/api/language.md b/website/docs/api/language.md index ad0ac2a46..4d568df62 100644 --- a/website/docs/api/language.md +++ b/website/docs/api/language.md @@ -259,15 +259,6 @@ either in the [config](/usage/training#config), or by calling [`pipe.add_label`](/api/pipe#add_label) for each possible output label (e.g. for the tagger or textcat). - - -This method was previously called `begin_training`. It now also takes a -**function** that is called with no arguments and returns a sequence of -[`Example`](/api/example) objects instead of tuples of `Doc` and `GoldParse` -objects. - - - > #### Example > > ```python diff --git a/website/docs/api/pipe.md b/website/docs/api/pipe.md index 263942e3e..70a4648b6 100644 --- a/website/docs/api/pipe.md +++ b/website/docs/api/pipe.md @@ -152,12 +152,6 @@ network, setting up the label scheme based on the data. This method is typically called by [`Language.initialize`](/api/language#initialize). - - -This method was previously called `begin_training`. - - - > #### Example > > ```python diff --git a/website/docs/api/tagger.md b/website/docs/api/tagger.md index 0d77d9bf4..102793377 100644 --- a/website/docs/api/tagger.md +++ b/website/docs/api/tagger.md @@ -142,12 +142,6 @@ arguments it receives via the [`[initialize.components]`](/api/data-formats#config-initialize) block in the config. - - -This method was previously called `begin_training`. - - - > #### Example > > ```python diff --git a/website/docs/api/textcategorizer.md b/website/docs/api/textcategorizer.md index ed1205d8c..b69c87a28 100644 --- a/website/docs/api/textcategorizer.md +++ b/website/docs/api/textcategorizer.md @@ -187,12 +187,6 @@ arguments it receives via the [`[initialize.components]`](/api/data-formats#config-initialize) block in the config. - - -This method was previously called `begin_training`. - - - > #### Example > > ```python From d60997febb1c2710543b46c18e3875317349dcf9 Mon Sep 17 00:00:00 2001 From: Paul O'Leary McCann Date: Thu, 8 Dec 2022 19:45:52 +0900 Subject: [PATCH 136/161] Remove old model shortcuts (#11916) * Remove old model shortcuts * Remove error, docs warnings about shortcuts * Fix import in util Accidentally deleted the whole import and not just the old part... * Change universe example to v3 style * Switch ubuntu-latest to ubuntu-20.04 in main tests (#11928) * Switch ubuntu-latest to ubuntu-20.04 in main tests * Only use 20.04 for 3.6 * Update some model loading in Universe * Add v2 tag to neuralcoref * Use the spacy-version feature instead of a v2 tag Co-authored-by: svlandeg --- spacy/cli/download.py | 7 ------- spacy/errors.py | 16 ---------------- spacy/util.py | 4 +--- website/UNIVERSE.md | 2 +- website/docs/usage/models.md | 27 --------------------------- website/meta/universe.json | 20 ++++++++++++-------- 6 files changed, 14 insertions(+), 62 deletions(-) diff --git a/spacy/cli/download.py b/spacy/cli/download.py index 0c9a32b93..4c998a6e0 100644 --- a/spacy/cli/download.py +++ b/spacy/cli/download.py @@ -8,7 +8,6 @@ from ._util import app, Arg, Opt, WHEEL_SUFFIX, SDIST_SUFFIX from .. import about from ..util import is_package, get_minor_version, run_command from ..util import is_prerelease_version -from ..errors import OLD_MODEL_SHORTCUTS @app.command( @@ -61,12 +60,6 @@ def download( version = components[-1] else: model_name = model - if model in OLD_MODEL_SHORTCUTS: - msg.warn( - f"As of spaCy v3.0, shortcuts like '{model}' are deprecated. Please " - f"use the full pipeline package name '{OLD_MODEL_SHORTCUTS[model]}' instead." - ) - model_name = OLD_MODEL_SHORTCUTS[model] compatibility = get_compatibility() version = get_version(model_name, compatibility) diff --git a/spacy/errors.py b/spacy/errors.py index 31230d7a4..9ad7d1292 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -720,13 +720,6 @@ class Errors(metaclass=ErrorsWithCodes): "method in component '{name}'. If you want to use this " "method, make sure it's overwritten on the subclass.") E940 = ("Found NaN values in scores.") - E941 = ("Can't find model '{name}'. It looks like you're trying to load a " - "model from a shortcut, which is obsolete as of spaCy v3.0. To " - "load the model, use its full name instead:\n\n" - "nlp = spacy.load(\"{full}\")\n\nFor more details on the available " - "models, see the models directory: https://spacy.io/models. If you " - "want to create a blank model, use spacy.blank: " - "nlp = spacy.blank(\"{name}\")") E942 = ("Executing `after_{name}` callback failed. Expected the function to " "return an initialized nlp object but got: {value}. Maybe " "you forgot to return the modified object in your function?") @@ -955,15 +948,6 @@ class Errors(metaclass=ErrorsWithCodes): "but got '{received_type}'") -# Deprecated model shortcuts, only used in errors and warnings -OLD_MODEL_SHORTCUTS = { - "en": "en_core_web_sm", "de": "de_core_news_sm", "es": "es_core_news_sm", - "pt": "pt_core_news_sm", "fr": "fr_core_news_sm", "it": "it_core_news_sm", - "nl": "nl_core_news_sm", "el": "el_core_news_sm", "nb": "nb_core_news_sm", - "lt": "lt_core_news_sm", "xx": "xx_ent_wiki_sm" -} - - # fmt: on diff --git a/spacy/util.py b/spacy/util.py index 4bdde1ad1..d674fb9ce 100644 --- a/spacy/util.py +++ b/spacy/util.py @@ -40,7 +40,7 @@ except ImportError: from .symbols import ORTH from .compat import cupy, CudaStream, is_windows, importlib_metadata -from .errors import Errors, Warnings, OLD_MODEL_SHORTCUTS +from .errors import Errors, Warnings from . import about if TYPE_CHECKING: @@ -427,8 +427,6 @@ def load_model( return load_model_from_path(Path(name), **kwargs) # type: ignore[arg-type] elif hasattr(name, "exists"): # Path or Path-like to model data return load_model_from_path(name, **kwargs) # type: ignore[arg-type] - if name in OLD_MODEL_SHORTCUTS: - raise IOError(Errors.E941.format(name=name, full=OLD_MODEL_SHORTCUTS[name])) # type: ignore[index] raise IOError(Errors.E050.format(name=name)) diff --git a/website/UNIVERSE.md b/website/UNIVERSE.md index 770bbde13..c3e49ba43 100644 --- a/website/UNIVERSE.md +++ b/website/UNIVERSE.md @@ -51,7 +51,7 @@ markup is correct. "import spacy", "import package_name", "", - "nlp = spacy.load('en')", + "nlp = spacy.load('en_core_web_sm')", "nlp.add_pipe(package_name)" ], "code_language": "python", diff --git a/website/docs/usage/models.md b/website/docs/usage/models.md index 3b1558bd8..03d0d535c 100644 --- a/website/docs/usage/models.md +++ b/website/docs/usage/models.md @@ -342,22 +342,6 @@ The easiest way to download a trained pipeline is via spaCy's [`download`](/api/cli#download) command. It takes care of finding the best-matching package compatible with your spaCy installation. -> #### Important note for v3.0 -> -> Note that as of spaCy v3.0, shortcut links like `en` that create (potentially -> brittle) symlinks in your spaCy installation are **deprecated**. To download -> and load an installed pipeline package, use its full name: -> -> ```diff -> - python -m spacy download en -> + python -m spacy download en_core_web_sm -> ``` -> -> ```diff -> - nlp = spacy.load("en") -> + nlp = spacy.load("en_core_web_sm") -> ``` - ```cli # Download best-matching version of a package for your spaCy installation $ python -m spacy download en_core_web_sm @@ -489,17 +473,6 @@ spacy.cli.download("en_core_web_sm") To load a pipeline package, use [`spacy.load`](/api/top-level#spacy.load) with the package name or a path to the data directory: -> #### Important note for v3.0 -> -> Note that as of spaCy v3.0, shortcut links like `en` that create (potentially -> brittle) symlinks in your spaCy installation are **deprecated**. To download -> and load an installed pipeline package, use its full name: -> -> ```diff -> - python -m spacy download en -> + python -m spacy download en_core_web_sm -> ``` - ```python import spacy nlp = spacy.load("en_core_web_sm") # load package "en_core_web_sm" diff --git a/website/meta/universe.json b/website/meta/universe.json index 97b53e9c5..168a39a5f 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -1021,7 +1021,8 @@ "author_links": { "github": "mholtzscher" }, - "category": ["pipeline"] + "category": ["pipeline"], + "spacy_version": 2 }, { "id": "spacy-sentence-segmenter", @@ -1045,7 +1046,7 @@ { "id": "spacy_cld", "title": "spaCy-CLD", - "slogan": "Add language detection to your spaCy pipeline using CLD2", + "slogan": "Add language detection to your spaCy v2 pipeline using CLD2", "description": "spaCy-CLD operates on `Doc` and `Span` spaCy objects. When called on a `Doc` or `Span`, the object is given two attributes: `languages` (a list of up to 3 language codes) and `language_scores` (a dictionary mapping language codes to confidence scores between 0 and 1).\n\nspacy-cld is a little extension that wraps the [PYCLD2](https://github.com/aboSamoor/pycld2) Python library, which in turn wraps the [Compact Language Detector 2](https://github.com/CLD2Owners/cld2) C library originally built at Google for the Chromium project. CLD2 uses character n-grams as features and a Naive Bayes classifier to identify 80+ languages from Unicode text strings (or XML/HTML). It can detect up to 3 different languages in a given document, and reports a confidence score (reported in with each language.", "github": "nickdavidhaynes/spacy-cld", "pip": "spacy_cld", @@ -1065,7 +1066,8 @@ "author_links": { "github": "nickdavidhaynes" }, - "category": ["pipeline"] + "category": ["pipeline"], + "spacy_version": 2 }, { "id": "spacy-iwnlp", @@ -1139,7 +1141,8 @@ "github": "sammous" }, "category": ["pipeline"], - "tags": ["pos", "lemmatizer", "french"] + "tags": ["pos", "lemmatizer", "french"], + "spacy_version": 2 }, { "id": "lemmy", @@ -1333,8 +1336,8 @@ }, { "id": "neuralcoref", - "slogan": "State-of-the-art coreference resolution based on neural nets and spaCy", - "description": "This coreference resolution module is based on the super fast [spaCy](https://spacy.io/) parser and uses the neural net scoring model described in [Deep Reinforcement Learning for Mention-Ranking Coreference Models](http://cs.stanford.edu/people/kevclark/resources/clark-manning-emnlp2016-deep.pdf) by Kevin Clark and Christopher D. Manning, EMNLP 2016. Since ✨Neuralcoref v2.0, you can train the coreference resolution system on your own dataset — e.g., another language than English! — **provided you have an annotated dataset**. Note that to use neuralcoref with spaCy > 2.1.0, you'll have to install neuralcoref from source.", + "slogan": "State-of-the-art coreference resolution based on neural nets and spaCy v2", + "description": "This coreference resolution module is based on the super fast spaCy parser and uses the neural net scoring model described in [Deep Reinforcement Learning for Mention-Ranking Coreference Models](http://cs.stanford.edu/people/kevclark/resources/clark-manning-emnlp2016-deep.pdf) by Kevin Clark and Christopher D. Manning, EMNLP 2016. Since ✨Neuralcoref v2.0, you can train the coreference resolution system on your own dataset — e.g., another language than English! — **provided you have an annotated dataset**. Note that to use neuralcoref with spaCy > 2.1.0, you'll have to install neuralcoref from source, and v3+ is not supported.", "github": "huggingface/neuralcoref", "thumb": "https://i.imgur.com/j6FO9O6.jpg", "code_example": [ @@ -1355,7 +1358,8 @@ "github": "huggingface" }, "category": ["standalone", "conversational", "models"], - "tags": ["coref"] + "tags": ["coref"], + "spacy_version": 2 }, { "id": "neuralcoref-vizualizer", @@ -1431,7 +1435,7 @@ "import spacy", "import explacy", "", - "nlp = spacy.load('en')", + "nlp = spacy.load('en_core_web_sm')", "explacy.print_parse_info(nlp, 'The salad was surprisingly tasty.')" ], "author": "Tyler Neylon", From f5aabaf7d69e1dc5a1f510bb47297b7f45f49100 Mon Sep 17 00:00:00 2001 From: Madeesh Kannan Date: Thu, 8 Dec 2022 13:24:45 +0100 Subject: [PATCH 137/161] Remove unused, experimental multi-task components (#11919) * Remove experimental multi-task components These are incomplete implementations and are not usable in their current state. * Remove orphaned error message * Switch ubuntu-latest to ubuntu-20.04 in main tests (#11928) * Switch ubuntu-latest to ubuntu-20.04 in main tests * Only use 20.04 for 3.6 * Revert "Switch ubuntu-latest to ubuntu-20.04 in main tests (#11928)" This reverts commit 77c0fd7b176be80e8438fa21440a85d1fe26e39b. Co-authored-by: Paul O'Leary McCann --- setup.py | 1 - spacy/errors.py | 2 - spacy/pipeline/multitask.pyx | 221 ----------------------------------- 3 files changed, 224 deletions(-) delete mode 100644 spacy/pipeline/multitask.pyx diff --git a/setup.py b/setup.py index bc911276f..55494344b 100755 --- a/setup.py +++ b/setup.py @@ -38,7 +38,6 @@ MOD_NAMES = [ "spacy.pipeline.dep_parser", "spacy.pipeline._edit_tree_internals.edit_trees", "spacy.pipeline.morphologizer", - "spacy.pipeline.multitask", "spacy.pipeline.ner", "spacy.pipeline.pipe", "spacy.pipeline.trainable_pipe", diff --git a/spacy/errors.py b/spacy/errors.py index 9ad7d1292..c097348ef 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -243,8 +243,6 @@ class Errors(metaclass=ErrorsWithCodes): "https://spacy.io/usage/models") E011 = ("Unknown operator: '{op}'. Options: {opts}") E012 = ("Cannot add pattern for zero tokens to matcher.\nKey: {key}") - E016 = ("MultitaskObjective target should be function or one of: dep, " - "tag, ent, dep_tag_offset, ent_tag.") E017 = ("Can only add 'str' inputs to StringStore. Got type: {value_type}") E018 = ("Can't retrieve string for hash '{hash_value}'. This usually " "refers to an issue with the `Vocab` or `StringStore`.") diff --git a/spacy/pipeline/multitask.pyx b/spacy/pipeline/multitask.pyx deleted file mode 100644 index 8c44061e2..000000000 --- a/spacy/pipeline/multitask.pyx +++ /dev/null @@ -1,221 +0,0 @@ -# cython: infer_types=True, profile=True, binding=True -from typing import Optional -import numpy -from thinc.api import CosineDistance, to_categorical, Model, Config -from thinc.api import set_dropout_rate - -from ..tokens.doc cimport Doc - -from .trainable_pipe import TrainablePipe -from .tagger import Tagger -from ..training import validate_examples -from ..language import Language -from ._parser_internals import nonproj -from ..attrs import POS, ID -from ..errors import Errors - - -default_model_config = """ -[model] -@architectures = "spacy.MultiTask.v1" -maxout_pieces = 3 -token_vector_width = 96 - -[model.tok2vec] -@architectures = "spacy.HashEmbedCNN.v2" -pretrained_vectors = null -width = 96 -depth = 4 -embed_size = 2000 -window_size = 1 -maxout_pieces = 2 -subword_features = true -""" -DEFAULT_MT_MODEL = Config().from_str(default_model_config)["model"] - - -@Language.factory( - "nn_labeller", - default_config={"labels": None, "target": "dep_tag_offset", "model": DEFAULT_MT_MODEL} -) -def make_nn_labeller(nlp: Language, name: str, model: Model, labels: Optional[dict], target: str): - return MultitaskObjective(nlp.vocab, model, name) - - -class MultitaskObjective(Tagger): - """Experimental: Assist training of a parser or tagger, by training a - side-objective. - """ - - def __init__(self, vocab, model, name="nn_labeller", *, target): - self.vocab = vocab - self.model = model - self.name = name - if target == "dep": - self.make_label = self.make_dep - elif target == "tag": - self.make_label = self.make_tag - elif target == "ent": - self.make_label = self.make_ent - elif target == "dep_tag_offset": - self.make_label = self.make_dep_tag_offset - elif target == "ent_tag": - self.make_label = self.make_ent_tag - elif target == "sent_start": - self.make_label = self.make_sent_start - elif hasattr(target, "__call__"): - self.make_label = target - else: - raise ValueError(Errors.E016) - cfg = {"labels": {}, "target": target} - self.cfg = dict(cfg) - - @property - def labels(self): - return self.cfg.setdefault("labels", {}) - - @labels.setter - def labels(self, value): - self.cfg["labels"] = value - - def set_annotations(self, docs, dep_ids): - pass - - def initialize(self, get_examples, nlp=None, labels=None): - if not hasattr(get_examples, "__call__"): - err = Errors.E930.format(name="MultitaskObjective", obj=type(get_examples)) - raise ValueError(err) - if labels is not None: - self.labels = labels - else: - for example in get_examples(): - for token in example.y: - label = self.make_label(token) - if label is not None and label not in self.labels: - self.labels[label] = len(self.labels) - self.model.initialize() # TODO: fix initialization by defining X and Y - - def predict(self, docs): - tokvecs = self.model.get_ref("tok2vec")(docs) - scores = self.model.get_ref("softmax")(tokvecs) - return tokvecs, scores - - def get_loss(self, examples, scores): - cdef int idx = 0 - correct = numpy.zeros((scores.shape[0],), dtype="i") - guesses = scores.argmax(axis=1) - docs = [eg.predicted for eg in examples] - for i, eg in enumerate(examples): - # Handles alignment for tokenization differences - doc_annots = eg.get_aligned() # TODO - for j in range(len(eg.predicted)): - tok_annots = {key: values[j] for key, values in tok_annots.items()} - label = self.make_label(j, tok_annots) - if label is None or label not in self.labels: - correct[idx] = guesses[idx] - else: - correct[idx] = self.labels[label] - idx += 1 - correct = self.model.ops.xp.array(correct, dtype="i") - d_scores = scores - to_categorical(correct, n_classes=scores.shape[1]) - loss = (d_scores**2).sum() - return float(loss), d_scores - - @staticmethod - def make_dep(token): - return token.dep_ - - @staticmethod - def make_tag(token): - return token.tag_ - - @staticmethod - def make_ent(token): - if token.ent_iob_ == "O": - return "O" - else: - return token.ent_iob_ + "-" + token.ent_type_ - - @staticmethod - def make_dep_tag_offset(token): - dep = token.dep_ - tag = token.tag_ - offset = token.head.i - token.i - offset = min(offset, 2) - offset = max(offset, -2) - return f"{dep}-{tag}:{offset}" - - @staticmethod - def make_ent_tag(token): - if token.ent_iob_ == "O": - ent = "O" - else: - ent = token.ent_iob_ + "-" + token.ent_type_ - tag = token.tag_ - return f"{tag}-{ent}" - - @staticmethod - def make_sent_start(token): - """A multi-task objective for representing sentence boundaries, - using BILU scheme. (O is impossible) - """ - if token.is_sent_start and token.is_sent_end: - return "U-SENT" - elif token.is_sent_start: - return "B-SENT" - else: - return "I-SENT" - - -class ClozeMultitask(TrainablePipe): - def __init__(self, vocab, model, **cfg): - self.vocab = vocab - self.model = model - self.cfg = cfg - self.distance = CosineDistance(ignore_zeros=True, normalize=False) # TODO: in config - - def set_annotations(self, docs, dep_ids): - pass - - def initialize(self, get_examples, nlp=None): - self.model.initialize() # TODO: fix initialization by defining X and Y - X = self.model.ops.alloc((5, self.model.get_ref("tok2vec").get_dim("nO"))) - self.model.output_layer.initialize(X) - - def predict(self, docs): - tokvecs = self.model.get_ref("tok2vec")(docs) - vectors = self.model.get_ref("output_layer")(tokvecs) - return tokvecs, vectors - - def get_loss(self, examples, vectors, prediction): - validate_examples(examples, "ClozeMultitask.get_loss") - # The simplest way to implement this would be to vstack the - # token.vector values, but that's a bit inefficient, especially on GPU. - # Instead we fetch the index into the vectors table for each of our tokens, - # and look them up all at once. This prevents data copying. - ids = self.model.ops.flatten([eg.predicted.to_array(ID).ravel() for eg in examples]) - target = vectors[ids] - gradient = self.distance.get_grad(prediction, target) - loss = self.distance.get_loss(prediction, target) - return float(loss), gradient - - def update(self, examples, *, drop=0., sgd=None, losses=None): - pass - - def rehearse(self, examples, drop=0., sgd=None, losses=None): - if losses is not None and self.name not in losses: - losses[self.name] = 0. - set_dropout_rate(self.model, drop) - validate_examples(examples, "ClozeMultitask.rehearse") - docs = [eg.predicted for eg in examples] - predictions, bp_predictions = self.model.begin_update() - loss, d_predictions = self.get_loss(examples, self.vocab.vectors.data, predictions) - bp_predictions(d_predictions) - if sgd is not None: - self.finish_update(sgd) - if losses is not None: - losses[self.name] += loss - return losses - - def add_label(self, label): - raise NotImplementedError From f22fc7a1138545a2a75975909b5af554e8e1d616 Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 9 Dec 2022 10:15:52 +0100 Subject: [PATCH 138/161] Auto-format code with black (#11955) Co-authored-by: explosion-bot --- spacy/tests/test_cli.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/tests/test_cli.py b/spacy/tests/test_cli.py index 3104b49ff..42af08749 100644 --- a/spacy/tests/test_cli.py +++ b/spacy/tests/test_cli.py @@ -140,7 +140,7 @@ def test_issue11235(): assert os.path.exists(d / "cfg") assert os.path.exists(d / f"{lang_var}_model") assert cfg["commands"][0]["script"][0] == f"hello {lang_var}" - + def test_cli_info(): nlp = Dutch() From 8c291ace0c0978e70257906438d3585022090e9f Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Mon, 12 Dec 2022 08:38:36 +0100 Subject: [PATCH 139/161] Extend to wasabi v1.1 (#11945) * Extend to wasabi v1.1 * Temporarily run mypy and tests with newest wasabi * Temporarily skip check requirements test * Revert "Temporarily skip check requirements test" This reverts commit 44f4ce20a8e8c92e8bfc8042cc68333589a96253. * Revert "Temporarily run mypy and tests with newest wasabi" This reverts commit e677a2257ced55e696cafc3a8e89eb2f7ddfc369. --- requirements.txt | 2 +- setup.cfg | 2 +- 2 files changed, 2 insertions(+), 2 deletions(-) diff --git a/requirements.txt b/requirements.txt index 778c05e21..0440835f2 100644 --- a/requirements.txt +++ b/requirements.txt @@ -6,7 +6,7 @@ preshed>=3.0.2,<3.1.0 thinc>=8.1.0,<8.2.0 ml_datasets>=0.2.0,<0.3.0 murmurhash>=0.28.0,<1.1.0 -wasabi>=0.9.1,<1.1.0 +wasabi>=0.9.1,<1.2.0 srsly>=2.4.3,<3.0.0 catalogue>=2.0.6,<2.1.0 typer>=0.3.0,<0.8.0 diff --git a/setup.cfg b/setup.cfg index 5768c9d3e..cf6e6f84b 100644 --- a/setup.cfg +++ b/setup.cfg @@ -47,7 +47,7 @@ install_requires = cymem>=2.0.2,<2.1.0 preshed>=3.0.2,<3.1.0 thinc>=8.1.0,<8.2.0 - wasabi>=0.9.1,<1.1.0 + wasabi>=0.9.1,<1.2.0 srsly>=2.4.3,<3.0.0 catalogue>=2.0.6,<2.1.0 # Third-party dependencies From 0591e67265d7378769c0fc0df4020817f2d514ec Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Mon, 12 Dec 2022 08:45:35 +0100 Subject: [PATCH 140/161] Cast to uint64 for all array-based doc representations (#11933) * Convert all individual values explicitly to uint64 for array-based doc representations * Temporarily test with latest numpy v1.24.0rc * Remove unnecessary conversion from attr_t * Reduce number of individual casts * Convert specifically from int32 to uint64 * Revert "Temporarily test with latest numpy v1.24.0rc" This reverts commit eb0e3c5006515b9a7ff52bae59484c909b8a3f65. * Also use int32 in tests --- spacy/tests/doc/test_array.py | 4 ++-- spacy/tokens/doc.pyx | 2 ++ spacy/tokens/span.pyx | 4 ++-- spacy/training/example.pyx | 15 ++++++++------- 4 files changed, 14 insertions(+), 11 deletions(-) diff --git a/spacy/tests/doc/test_array.py b/spacy/tests/doc/test_array.py index c334cc6eb..1f2d7d999 100644 --- a/spacy/tests/doc/test_array.py +++ b/spacy/tests/doc/test_array.py @@ -123,14 +123,14 @@ def test_doc_from_array_heads_in_bounds(en_vocab): # head before start arr = doc.to_array(["HEAD"]) - arr[0] = -1 + arr[0] = numpy.int32(-1).astype(numpy.uint64) doc_from_array = Doc(en_vocab, words=words) with pytest.raises(ValueError): doc_from_array.from_array(["HEAD"], arr) # head after end arr = doc.to_array(["HEAD"]) - arr[0] = 5 + arr[0] = numpy.int32(5).astype(numpy.uint64) doc_from_array = Doc(en_vocab, words=words) with pytest.raises(ValueError): doc_from_array.from_array(["HEAD"], arr) diff --git a/spacy/tokens/doc.pyx b/spacy/tokens/doc.pyx index f2621292c..075bc4d15 100644 --- a/spacy/tokens/doc.pyx +++ b/spacy/tokens/doc.pyx @@ -359,6 +359,7 @@ cdef class Doc: for annot in annotations: if annot: if annot is heads or annot is sent_starts or annot is ent_iobs: + annot = numpy.array(annot, dtype=numpy.int32).astype(numpy.uint64) for i in range(len(words)): if attrs.ndim == 1: attrs[i] = annot[i] @@ -1558,6 +1559,7 @@ cdef class Doc: for j, (attr, annot) in enumerate(token_annotations.items()): if attr is HEAD: + annot = numpy.array(annot, dtype=numpy.int32).astype(numpy.uint64) for i in range(len(words)): array[i, j] = annot[i] elif attr is MORPH: diff --git a/spacy/tokens/span.pyx b/spacy/tokens/span.pyx index c3495f497..99a5f43bd 100644 --- a/spacy/tokens/span.pyx +++ b/spacy/tokens/span.pyx @@ -299,7 +299,7 @@ cdef class Span: for ancestor in ancestors: ancestor_i = ancestor.i - self.c.start if ancestor_i in range(length): - array[i, head_col] = ancestor_i - i + array[i, head_col] = numpy.int32(ancestor_i - i).astype(numpy.uint64) # if there is no appropriate ancestor, define a new artificial root value = array[i, head_col] @@ -307,7 +307,7 @@ cdef class Span: new_root = old_to_new_root.get(ancestor_i, None) if new_root is not None: # take the same artificial root as a previous token from the same sentence - array[i, head_col] = new_root - i + array[i, head_col] = numpy.int32(new_root - i).astype(numpy.uint64) else: # set this token as the new artificial root array[i, head_col] = 0 diff --git a/spacy/training/example.pyx b/spacy/training/example.pyx index dfd337b9e..95b0f0de9 100644 --- a/spacy/training/example.pyx +++ b/spacy/training/example.pyx @@ -443,26 +443,27 @@ def _annot2array(vocab, tok_annot, doc_annot): if key not in IDS: raise ValueError(Errors.E974.format(obj="token", key=key)) elif key in ["ORTH", "SPACY"]: - pass + continue elif key == "HEAD": attrs.append(key) - values.append([h-i if h is not None else 0 for i, h in enumerate(value)]) + row = [h-i if h is not None else 0 for i, h in enumerate(value)] elif key == "DEP": attrs.append(key) - values.append([vocab.strings.add(h) if h is not None else MISSING_DEP for h in value]) + row = [vocab.strings.add(h) if h is not None else MISSING_DEP for h in value] elif key == "SENT_START": attrs.append(key) - values.append([to_ternary_int(v) for v in value]) + row = [to_ternary_int(v) for v in value] elif key == "MORPH": attrs.append(key) - values.append([vocab.morphology.add(v) for v in value]) + row = [vocab.morphology.add(v) for v in value] else: attrs.append(key) if not all(isinstance(v, str) for v in value): types = set([type(v) for v in value]) raise TypeError(Errors.E969.format(field=key, types=types)) from None - values.append([vocab.strings.add(v) for v in value]) - array = numpy.asarray(values, dtype="uint64") + row = [vocab.strings.add(v) for v in value] + values.append([numpy.array(v, dtype=numpy.int32).astype(numpy.uint64) if v < 0 else v for v in row]) + array = numpy.array(values, dtype=numpy.uint64) return attrs, array.T From ca75190a3d2972392d9333d731fdf6d1b4a48793 Mon Sep 17 00:00:00 2001 From: Edward <43848523+thomashacker@users.noreply.github.com> Date: Mon, 12 Dec 2022 08:55:53 +0100 Subject: [PATCH 141/161] Custom extensions for spans with equal boundaries (#11429) * Init * Fix return type for mypy * adjust types and improve setting new attributes * Add underscore changes to json conversion * Add test and underscore changes to from_docs * add underscore changes and test to span.to_doc * update return values Co-authored-by: Sofie Van Landeghem * Add types to function Co-authored-by: Sofie Van Landeghem * adjust formatting Co-authored-by: Sofie Van Landeghem * shorten return type Co-authored-by: Sofie Van Landeghem * add helper function to improve readability * Improve code and add comments * rerun azure tests * Fix tests for json conversion Co-authored-by: Sofie Van Landeghem --- spacy/tests/doc/test_underscore.py | 119 +++++++++++++++++++++++++++++ spacy/tokens/doc.pyx | 30 ++++++-- spacy/tokens/span.pyx | 38 +++++++-- spacy/tokens/underscore.py | 44 ++++++++++- 4 files changed, 214 insertions(+), 17 deletions(-) diff --git a/spacy/tests/doc/test_underscore.py b/spacy/tests/doc/test_underscore.py index b934221af..d23bb3162 100644 --- a/spacy/tests/doc/test_underscore.py +++ b/spacy/tests/doc/test_underscore.py @@ -3,6 +3,10 @@ from mock import Mock from spacy.tokens import Doc, Span, Token from spacy.tokens.underscore import Underscore +# Helper functions +def _get_tuple(s: Span): + return "._.", "span_extension", s.start_char, s.end_char, s.label, s.kb_id, s.id + @pytest.fixture(scope="function", autouse=True) def clean_underscore(): @@ -171,3 +175,118 @@ def test_underscore_docstring(en_vocab): doc = Doc(en_vocab, words=["hello", "world"]) assert test_method.__doc__ == "I am a docstring" assert doc._.test_docstrings.__doc__.rsplit(". ")[-1] == "I am a docstring" + + +def test_underscore_for_unique_span(en_tokenizer): + """Test that spans with the same boundaries but with different labels are uniquely identified (see #9706).""" + Doc.set_extension(name="doc_extension", default=None) + Span.set_extension(name="span_extension", default=None) + Token.set_extension(name="token_extension", default=None) + + # Initialize doc + text = "Hello, world!" + doc = en_tokenizer(text) + span_1 = Span(doc, 0, 2, "SPAN_1") + span_2 = Span(doc, 0, 2, "SPAN_2") + + # Set custom extensions + doc._.doc_extension = "doc extension" + doc[0]._.token_extension = "token extension" + span_1._.span_extension = "span_1 extension" + span_2._.span_extension = "span_2 extension" + + # Assert extensions + assert doc.user_data[_get_tuple(span_1)] == "span_1 extension" + assert doc.user_data[_get_tuple(span_2)] == "span_2 extension" + + # Change label of span and assert extensions + span_1.label_ = "NEW_LABEL" + assert doc.user_data[_get_tuple(span_1)] == "span_1 extension" + assert doc.user_data[_get_tuple(span_2)] == "span_2 extension" + + # Change KB_ID and assert extensions + span_1.kb_id_ = "KB_ID" + assert doc.user_data[_get_tuple(span_1)] == "span_1 extension" + assert doc.user_data[_get_tuple(span_2)] == "span_2 extension" + + # Change extensions and assert + span_2._.span_extension = "updated span_2 extension" + assert doc.user_data[_get_tuple(span_1)] == "span_1 extension" + assert doc.user_data[_get_tuple(span_2)] == "updated span_2 extension" + + # Change span ID and assert extensions + span_2.id = 2 + assert doc.user_data[_get_tuple(span_1)] == "span_1 extension" + assert doc.user_data[_get_tuple(span_2)] == "updated span_2 extension" + + # Assert extensions with original key + assert doc.user_data[("._.", "doc_extension", None, None)] == "doc extension" + assert doc.user_data[("._.", "token_extension", 0, None)] == "token extension" + + +def test_underscore_for_unique_span_from_docs(en_tokenizer): + """Test that spans in the user_data keep the same data structure when using Doc.from_docs""" + Span.set_extension(name="span_extension", default=None) + Token.set_extension(name="token_extension", default=None) + + # Initialize doc + text_1 = "Hello, world!" + doc_1 = en_tokenizer(text_1) + span_1a = Span(doc_1, 0, 2, "SPAN_1a") + span_1b = Span(doc_1, 0, 2, "SPAN_1b") + + text_2 = "This is a test." + doc_2 = en_tokenizer(text_2) + span_2a = Span(doc_2, 0, 3, "SPAN_2a") + + # Set custom extensions + doc_1[0]._.token_extension = "token_1" + doc_2[1]._.token_extension = "token_2" + span_1a._.span_extension = "span_1a extension" + span_1b._.span_extension = "span_1b extension" + span_2a._.span_extension = "span_2a extension" + + doc = Doc.from_docs([doc_1, doc_2]) + # Assert extensions + assert doc_1.user_data[_get_tuple(span_1a)] == "span_1a extension" + assert doc_1.user_data[_get_tuple(span_1b)] == "span_1b extension" + assert doc_2.user_data[_get_tuple(span_2a)] == "span_2a extension" + + # Check extensions on merged doc + assert doc.user_data[_get_tuple(span_1a)] == "span_1a extension" + assert doc.user_data[_get_tuple(span_1b)] == "span_1b extension" + assert ( + doc.user_data[ + ( + "._.", + "span_extension", + span_2a.start_char + len(doc_1.text) + 1, + span_2a.end_char + len(doc_1.text) + 1, + span_2a.label, + span_2a.kb_id, + span_2a.id, + ) + ] + == "span_2a extension" + ) + + +def test_underscore_for_unique_span_as_span(en_tokenizer): + """Test that spans in the user_data keep the same data structure when using Span.as_doc""" + Span.set_extension(name="span_extension", default=None) + + # Initialize doc + text = "Hello, world!" + doc = en_tokenizer(text) + span_1 = Span(doc, 0, 2, "SPAN_1") + span_2 = Span(doc, 0, 2, "SPAN_2") + + # Set custom extensions + span_1._.span_extension = "span_1 extension" + span_2._.span_extension = "span_2 extension" + + span_doc = span_1.as_doc(copy_user_data=True) + + # Assert extensions + assert span_doc.user_data[_get_tuple(span_1)] == "span_1 extension" + assert span_doc.user_data[_get_tuple(span_2)] == "span_2 extension" diff --git a/spacy/tokens/doc.pyx b/spacy/tokens/doc.pyx index bf3da0ce4..b7506f745 100644 --- a/spacy/tokens/doc.pyx +++ b/spacy/tokens/doc.pyx @@ -1177,13 +1177,22 @@ cdef class Doc: if "user_data" not in exclude: for key, value in doc.user_data.items(): - if isinstance(key, tuple) and len(key) == 4 and key[0] == "._.": - data_type, name, start, end = key + if isinstance(key, tuple) and len(key) >= 4 and key[0] == "._.": + data_type = key[0] + name = key[1] + start = key[2] + end = key[3] if start is not None or end is not None: start += char_offset if end is not None: end += char_offset - concat_user_data[(data_type, name, start, end)] = copy.copy(value) + _label = key[4] + _kb_id = key[5] + _span_id = key[6] + concat_user_data[(data_type, name, start, end, _label, _kb_id, _span_id)] = copy.copy(value) + else: + concat_user_data[(data_type, name, start, end)] = copy.copy(value) + else: warnings.warn(Warnings.W101.format(name=name)) else: @@ -1627,7 +1636,11 @@ cdef class Doc: Span.set_extension(span_attr) for span_data in doc_json["underscore_span"][span_attr]: value = span_data["value"] - self.char_span(span_data["start"], span_data["end"])._.set(span_attr, value) + span = self.char_span(span_data["start"], span_data["end"]) + span.label = span_data["label"] + span.kb_id = span_data["kb_id"] + span.id = span_data["id"] + span._.set(span_attr, value) return self def to_json(self, underscore=None): @@ -1705,13 +1718,16 @@ cdef class Doc: if attr not in data["underscore_token"]: data["underscore_token"][attr] = [] data["underscore_token"][attr].append({"start": start, "value": value}) - # Span attribute - elif start is not None and end is not None: + # Else span attribute + elif end is not None: + _label = data_key[4] + _kb_id = data_key[5] + _span_id = data_key[6] if "underscore_span" not in data: data["underscore_span"] = {} if attr not in data["underscore_span"]: data["underscore_span"][attr] = [] - data["underscore_span"][attr].append({"start": start, "end": end, "value": value}) + data["underscore_span"][attr].append({"start": start, "end": end, "value": value, "label": _label, "kb_id": _kb_id, "id":_span_id}) for attr in underscore: if attr not in user_keys: diff --git a/spacy/tokens/span.pyx b/spacy/tokens/span.pyx index 5530dd127..6f2d0379c 100644 --- a/spacy/tokens/span.pyx +++ b/spacy/tokens/span.pyx @@ -218,11 +218,10 @@ cdef class Span: cdef SpanC* span_c = self.span_c() """Custom extension attributes registered via `set_extension`.""" return Underscore(Underscore.span_extensions, self, - start=span_c.start_char, end=span_c.end_char) + start=span_c.start_char, end=span_c.end_char, label=self.label, kb_id=self.kb_id, span_id=self.id) def as_doc(self, *, bint copy_user_data=False, array_head=None, array=None): """Create a `Doc` object with a copy of the `Span`'s data. - copy_user_data (bool): Whether or not to copy the original doc's user data. array_head (tuple): `Doc` array attrs, can be passed in to speed up computation. array (ndarray): `Doc` as array, can be passed in to speed up computation. @@ -275,12 +274,22 @@ cdef class Span: char_offset = self.start_char for key, value in self.doc.user_data.items(): if isinstance(key, tuple) and len(key) == 4 and key[0] == "._.": - data_type, name, start, end = key + data_type = key[0] + name = key[1] + start = key[2] + end = key[3] if start is not None or end is not None: start -= char_offset + # Check if Span object if end is not None: end -= char_offset - user_data[(data_type, name, start, end)] = copy.copy(value) + _label = key[4] + _kb_id = key[5] + _span_id = key[6] + user_data[(data_type, name, start, end, _label, _kb_id, _span_id)] = copy.copy(value) + # Else Token object + else: + user_data[(data_type, name, start, end)] = copy.copy(value) else: user_data[key] = copy.copy(value) doc.user_data = user_data @@ -781,21 +790,36 @@ cdef class Span: return self.span_c().label def __set__(self, attr_t label): - self.span_c().label = label + if label != self.span_c().label : + old_label = self.span_c().label + self.span_c().label = label + new = Underscore(Underscore.span_extensions, self, start=self.span_c().start_char, end=self.span_c().end_char, label=self.label, kb_id=self.kb_id, span_id=self.id) + old = Underscore(Underscore.span_extensions, self, start=self.span_c().start_char, end=self.span_c().end_char, label=old_label, kb_id=self.kb_id, span_id=self.id) + Underscore._replace_keys(old, new) property kb_id: def __get__(self): return self.span_c().kb_id def __set__(self, attr_t kb_id): - self.span_c().kb_id = kb_id + if kb_id != self.span_c().kb_id : + old_kb_id = self.span_c().kb_id + self.span_c().kb_id = kb_id + new = Underscore(Underscore.span_extensions, self, start=self.span_c().start_char, end=self.span_c().end_char, label=self.label, kb_id=self.kb_id, span_id=self.id) + old = Underscore(Underscore.span_extensions, self, start=self.span_c().start_char, end=self.span_c().end_char, label=self.label, kb_id=old_kb_id, span_id=self.id) + Underscore._replace_keys(old, new) property id: def __get__(self): return self.span_c().id def __set__(self, attr_t id): - self.span_c().id = id + if id != self.span_c().id : + old_id = self.span_c().id + self.span_c().id = id + new = Underscore(Underscore.span_extensions, self, start=self.span_c().start_char, end=self.span_c().end_char, label=self.label, kb_id=self.kb_id, span_id=self.id) + old = Underscore(Underscore.span_extensions, self, start=self.span_c().start_char, end=self.span_c().end_char, label=self.label, kb_id=self.kb_id, span_id=old_id) + Underscore._replace_keys(old, new) property ent_id: """Alias for the span's ID.""" diff --git a/spacy/tokens/underscore.py b/spacy/tokens/underscore.py index e9a4e1862..f2f357441 100644 --- a/spacy/tokens/underscore.py +++ b/spacy/tokens/underscore.py @@ -2,10 +2,10 @@ from typing import Dict, Any, List, Optional, Tuple, Union, TYPE_CHECKING import functools import copy from ..errors import Errors +from .span import Span if TYPE_CHECKING: from .doc import Doc - from .span import Span from .token import Token @@ -25,6 +25,9 @@ class Underscore: obj: Union["Doc", "Span", "Token"], start: Optional[int] = None, end: Optional[int] = None, + label: int = 0, + kb_id: int = 0, + span_id: int = 0, ): object.__setattr__(self, "_extensions", extensions) object.__setattr__(self, "_obj", obj) @@ -36,6 +39,10 @@ class Underscore: object.__setattr__(self, "_doc", obj.doc) object.__setattr__(self, "_start", start) object.__setattr__(self, "_end", end) + if type(obj) == Span: + object.__setattr__(self, "_label", label) + object.__setattr__(self, "_kb_id", kb_id) + object.__setattr__(self, "_span_id", span_id) def __dir__(self) -> List[str]: # Hack to enable autocomplete on custom extensions @@ -88,8 +95,39 @@ class Underscore: def has(self, name: str) -> bool: return name in self._extensions - def _get_key(self, name: str) -> Tuple[str, str, Optional[int], Optional[int]]: - return ("._.", name, self._start, self._end) + def _get_key( + self, name: str + ) -> Union[ + Tuple[str, str, Optional[int], Optional[int]], + Tuple[str, str, Optional[int], Optional[int], int, int, int], + ]: + if hasattr(self, "_label"): + return ( + "._.", + name, + self._start, + self._end, + self._label, + self._kb_id, + self._span_id, + ) + else: + return "._.", name, self._start, self._end + + @staticmethod + def _replace_keys(old_underscore: "Underscore", new_underscore: "Underscore"): + """ + This function is called by Span when its kb_id or label are re-assigned. + It checks if any user_data is stored for this span and replaces the keys + """ + for name in old_underscore._extensions: + old_key = old_underscore._get_key(name) + old_doc = old_underscore._doc + new_key = new_underscore._get_key(name) + if old_key != new_key and old_key in old_doc.user_data: + old_underscore._doc.user_data[ + new_key + ] = old_underscore._doc.user_data.pop(old_key) @classmethod def get_state(cls) -> Tuple[Dict[Any, Any], Dict[Any, Any], Dict[Any, Any]]: From e5c7f3b0776d49c4f6aab7e02b503cdb84fb2134 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Mon, 12 Dec 2022 10:13:10 +0100 Subject: [PATCH 142/161] CI: Install thinc-apple-ops through extra (#11963) --- .github/azure-steps.yml | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/.github/azure-steps.yml b/.github/azure-steps.yml index 2f77706b8..d0db75f9a 100644 --- a/.github/azure-steps.yml +++ b/.github/azure-steps.yml @@ -107,7 +107,7 @@ steps: displayName: "Run CPU tests" - script: | - python -m pip install --pre thinc-apple-ops + python -m pip install 'spacy[apple]' python -m pytest --pyargs spacy displayName: "Run CPU tests with thinc-apple-ops" condition: and(startsWith(variables['imageName'], 'macos'), eq(variables['python.version'], '3.11')) From c9d9d6847f9685c21eeec01f4b8cd053cadf8bf5 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Thu, 15 Dec 2022 10:55:01 +0100 Subject: [PATCH 143/161] Update build constraints for python 3.11 (#11981) --- build-constraints.txt | 3 ++- 1 file changed, 2 insertions(+), 1 deletion(-) diff --git a/build-constraints.txt b/build-constraints.txt index 956973abf..c1e82f1b0 100644 --- a/build-constraints.txt +++ b/build-constraints.txt @@ -5,4 +5,5 @@ numpy==1.17.3; python_version=='3.8' and platform_machine!='aarch64' numpy==1.19.2; python_version=='3.8' and platform_machine=='aarch64' numpy==1.19.3; python_version=='3.9' numpy==1.21.3; python_version=='3.10' -numpy; python_version>='3.11' +numpy==1.23.2; python_version=='3.11' +numpy; python_version>='3.12' From f9308aae1342111416ae2ba0de04ea3643e5f1c7 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Dani=C3=ABl=20de=20Kok?= Date: Sat, 17 Dec 2022 14:32:19 +0100 Subject: [PATCH 144/161] Fix v4 branch to build against Thinc v9 (#11921) * Move `thinc.extra.search` to `spacy.pipeline._parser_internals` Backport of: https://github.com/explosion/spaCy/pull/11317 Co-authored-by: Madeesh Kannan * Replace references to `thinc.backends.linalg` with `CBlas` Backport of: https://github.com/explosion/spaCy/pull/11292 Co-authored-by: Madeesh Kannan * Use cross entropy from `thinc.legacy` * Require thinc>=9.0.0.dev0,<9.1.0 Co-authored-by: Madeesh Kannan --- pyproject.toml | 2 +- requirements.txt | 2 +- setup.cfg | 2 +- setup.py | 2 + spacy/ml/parser_model.pyx | 24 +- .../_parser_internals/_beam_utils.pxd | 2 +- .../_parser_internals/_beam_utils.pyx | 7 +- .../pipeline/_parser_internals/arc_eager.pyx | 2 +- spacy/pipeline/_parser_internals/ner.pyx | 2 +- spacy/pipeline/_parser_internals/search.pxd | 89 +++++ spacy/pipeline/_parser_internals/search.pyx | 306 ++++++++++++++++++ spacy/pipeline/edit_tree_lemmatizer.py | 7 +- spacy/pipeline/morphologizer.pyx | 5 +- spacy/pipeline/senter.pyx | 6 +- spacy/pipeline/tagger.pyx | 7 +- spacy/pipeline/transition_parser.pyx | 2 +- spacy/tests/conftest.py | 31 ++ spacy/tests/parser/_search.pyx | 119 +++++++ spacy/tests/parser/test_search.py | 3 + 19 files changed, 593 insertions(+), 27 deletions(-) create mode 100644 spacy/pipeline/_parser_internals/search.pxd create mode 100644 spacy/pipeline/_parser_internals/search.pyx create mode 100644 spacy/tests/parser/_search.pyx create mode 100644 spacy/tests/parser/test_search.py diff --git a/pyproject.toml b/pyproject.toml index 7abd7a96f..4b0da39b9 100644 --- a/pyproject.toml +++ b/pyproject.toml @@ -5,7 +5,7 @@ requires = [ "cymem>=2.0.2,<2.1.0", "preshed>=3.0.2,<3.1.0", "murmurhash>=0.28.0,<1.1.0", - "thinc>=8.1.0,<8.2.0", + "thinc>=9.0.0.dev0,<9.1.0", "numpy>=1.15.0", ] build-backend = "setuptools.build_meta" diff --git a/requirements.txt b/requirements.txt index 778c05e21..5bd04aa9c 100644 --- a/requirements.txt +++ b/requirements.txt @@ -3,7 +3,7 @@ spacy-legacy>=3.0.10,<3.1.0 spacy-loggers>=1.0.0,<2.0.0 cymem>=2.0.2,<2.1.0 preshed>=3.0.2,<3.1.0 -thinc>=8.1.0,<8.2.0 +thinc>=9.0.0.dev0,<9.1.0 ml_datasets>=0.2.0,<0.3.0 murmurhash>=0.28.0,<1.1.0 wasabi>=0.9.1,<1.1.0 diff --git a/setup.cfg b/setup.cfg index 3c1bf5b0b..0870e032e 100644 --- a/setup.cfg +++ b/setup.cfg @@ -38,7 +38,7 @@ install_requires = murmurhash>=0.28.0,<1.1.0 cymem>=2.0.2,<2.1.0 preshed>=3.0.2,<3.1.0 - thinc>=8.1.0,<8.2.0 + thinc>=9.0.0.dev0,<9.1.0 wasabi>=0.9.1,<1.1.0 srsly>=2.4.3,<3.0.0 catalogue>=2.0.6,<2.1.0 diff --git a/setup.py b/setup.py index 55494344b..77a4cf283 100755 --- a/setup.py +++ b/setup.py @@ -48,6 +48,7 @@ MOD_NAMES = [ "spacy.pipeline._parser_internals.arc_eager", "spacy.pipeline._parser_internals.ner", "spacy.pipeline._parser_internals.nonproj", + "spacy.pipeline._parser_internals.search", "spacy.pipeline._parser_internals._state", "spacy.pipeline._parser_internals.stateclass", "spacy.pipeline._parser_internals.transition_system", @@ -67,6 +68,7 @@ MOD_NAMES = [ "spacy.matcher.dependencymatcher", "spacy.symbols", "spacy.vectors", + "spacy.tests.parser._search", ] COMPILE_OPTIONS = { "msvc": ["/Ox", "/EHsc"], diff --git a/spacy/ml/parser_model.pyx b/spacy/ml/parser_model.pyx index 055fa0bad..91558683b 100644 --- a/spacy/ml/parser_model.pyx +++ b/spacy/ml/parser_model.pyx @@ -3,7 +3,6 @@ cimport numpy as np from libc.math cimport exp from libc.string cimport memset, memcpy from libc.stdlib cimport calloc, free, realloc -from thinc.backends.linalg cimport Vec, VecVec from thinc.backends.cblas cimport saxpy, sgemm import numpy @@ -102,11 +101,10 @@ cdef void predict_states(CBlas cblas, ActivationsC* A, StateC** states, sum_state_features(cblas, A.unmaxed, W.feat_weights, A.token_ids, n.states, n.feats, n.hiddens * n.pieces) for i in range(n.states): - VecVec.add_i(&A.unmaxed[i*n.hiddens*n.pieces], - W.feat_bias, 1., n.hiddens * n.pieces) + saxpy(cblas)(n.hiddens * n.pieces, 1., W.feat_bias, 1, &A.unmaxed[i*n.hiddens*n.pieces], 1) for j in range(n.hiddens): index = i * n.hiddens * n.pieces + j * n.pieces - which = Vec.arg_max(&A.unmaxed[index], n.pieces) + which = _arg_max(&A.unmaxed[index], n.pieces) A.hiddens[i*n.hiddens + j] = A.unmaxed[index + which] memset(A.scores, 0, n.states * n.classes * sizeof(float)) if W.hidden_weights == NULL: @@ -119,8 +117,7 @@ cdef void predict_states(CBlas cblas, ActivationsC* A, StateC** states, 0.0, A.scores, n.classes) # Add bias for i in range(n.states): - VecVec.add_i(&A.scores[i*n.classes], - W.hidden_bias, 1., n.classes) + saxpy(cblas)(n.classes, 1., W.hidden_bias, 1, &A.scores[i*n.classes], 1) # Set unseen classes to minimum value i = 0 min_ = A.scores[0] @@ -158,7 +155,8 @@ cdef void cpu_log_loss(float* d_scores, """Do multi-label log loss""" cdef double max_, gmax, Z, gZ best = arg_max_if_gold(scores, costs, is_valid, O) - guess = Vec.arg_max(scores, O) + guess = _arg_max(scores, O) + if best == -1 or guess == -1: # These shouldn't happen, but if they do, we want to make sure we don't # cause an OOB access. @@ -488,3 +486,15 @@ cdef class precompute_hiddens: return d_best.reshape((d_best.shape + (1,))) return state_vector, backprop_relu + +cdef inline int _arg_max(const float* scores, const int n_classes) nogil: + if n_classes == 2: + return 0 if scores[0] > scores[1] else 1 + cdef int i + cdef int best = 0 + cdef float mode = scores[0] + for i in range(1, n_classes): + if scores[i] > mode: + mode = scores[i] + best = i + return best diff --git a/spacy/pipeline/_parser_internals/_beam_utils.pxd b/spacy/pipeline/_parser_internals/_beam_utils.pxd index de3573fbc..571f246b1 100644 --- a/spacy/pipeline/_parser_internals/_beam_utils.pxd +++ b/spacy/pipeline/_parser_internals/_beam_utils.pxd @@ -1,6 +1,6 @@ from ...typedefs cimport class_t, hash_t -# These are passed as callbacks to thinc.search.Beam +# These are passed as callbacks to .search.Beam cdef int transition_state(void* _dest, void* _src, class_t clas, void* _moves) except -1 cdef int check_final_state(void* _state, void* extra_args) except -1 diff --git a/spacy/pipeline/_parser_internals/_beam_utils.pyx b/spacy/pipeline/_parser_internals/_beam_utils.pyx index fa7df2056..610c8ddee 100644 --- a/spacy/pipeline/_parser_internals/_beam_utils.pyx +++ b/spacy/pipeline/_parser_internals/_beam_utils.pyx @@ -3,17 +3,16 @@ cimport numpy as np import numpy from cpython.ref cimport PyObject, Py_XDECREF -from thinc.extra.search cimport Beam -from thinc.extra.search import MaxViolation -from thinc.extra.search cimport MaxViolation from ...typedefs cimport hash_t, class_t from .transition_system cimport TransitionSystem, Transition from ...errors import Errors +from .search cimport Beam, MaxViolation +from .search import MaxViolation from .stateclass cimport StateC, StateClass -# These are passed as callbacks to thinc.search.Beam +# These are passed as callbacks to .search.Beam cdef int transition_state(void* _dest, void* _src, class_t clas, void* _moves) except -1: dest = _dest src = _src diff --git a/spacy/pipeline/_parser_internals/arc_eager.pyx b/spacy/pipeline/_parser_internals/arc_eager.pyx index 257b5ef8a..a79aef64a 100644 --- a/spacy/pipeline/_parser_internals/arc_eager.pyx +++ b/spacy/pipeline/_parser_internals/arc_eager.pyx @@ -15,7 +15,7 @@ from ...training.example cimport Example from .stateclass cimport StateClass from ._state cimport StateC, ArcC from ...errors import Errors -from thinc.extra.search cimport Beam +from .search cimport Beam cdef weight_t MIN_SCORE = -90000 cdef attr_t SUBTOK_LABEL = hash_string('subtok') diff --git a/spacy/pipeline/_parser_internals/ner.pyx b/spacy/pipeline/_parser_internals/ner.pyx index cc196d85a..53ed03523 100644 --- a/spacy/pipeline/_parser_internals/ner.pyx +++ b/spacy/pipeline/_parser_internals/ner.pyx @@ -6,7 +6,6 @@ from libcpp.vector cimport vector from cymem.cymem cimport Pool from collections import Counter -from thinc.extra.search cimport Beam from ...tokens.doc cimport Doc from ...tokens.span import Span @@ -17,6 +16,7 @@ from ...attrs cimport IS_SPACE from ...structs cimport TokenC, SpanC from ...training import split_bilu_label from ...training.example cimport Example +from .search cimport Beam from .stateclass cimport StateClass from ._state cimport StateC from .transition_system cimport Transition, do_func_t diff --git a/spacy/pipeline/_parser_internals/search.pxd b/spacy/pipeline/_parser_internals/search.pxd new file mode 100644 index 000000000..dfe30e1c1 --- /dev/null +++ b/spacy/pipeline/_parser_internals/search.pxd @@ -0,0 +1,89 @@ +from cymem.cymem cimport Pool + +from libc.stdint cimport uint32_t +from libc.stdint cimport uint64_t +from libcpp.pair cimport pair +from libcpp.queue cimport priority_queue +from libcpp.vector cimport vector + +from ...typedefs cimport class_t, weight_t, hash_t + +ctypedef pair[weight_t, size_t] Entry +ctypedef priority_queue[Entry] Queue + + +ctypedef int (*trans_func_t)(void* dest, void* src, class_t clas, void* x) except -1 + +ctypedef void* (*init_func_t)(Pool mem, int n, void* extra_args) except NULL + +ctypedef int (*del_func_t)(Pool mem, void* state, void* extra_args) except -1 + +ctypedef int (*finish_func_t)(void* state, void* extra_args) except -1 + +ctypedef hash_t (*hash_func_t)(void* state, void* x) except 0 + + +cdef struct _State: + void* content + class_t* hist + weight_t score + weight_t loss + int i + int t + bint is_done + + +cdef class Beam: + cdef Pool mem + cdef class_t nr_class + cdef class_t width + cdef class_t size + cdef public weight_t min_density + cdef int t + cdef readonly bint is_done + cdef list histories + cdef list _parent_histories + cdef weight_t** scores + cdef int** is_valid + cdef weight_t** costs + cdef _State* _parents + cdef _State* _states + cdef del_func_t del_func + + cdef int _fill(self, Queue* q, weight_t** scores, int** is_valid) except -1 + + cdef inline void* at(self, int i) nogil: + return self._states[i].content + + cdef int initialize(self, init_func_t init_func, del_func_t del_func, int n, void* extra_args) except -1 + cdef int advance(self, trans_func_t transition_func, hash_func_t hash_func, + void* extra_args) except -1 + cdef int check_done(self, finish_func_t finish_func, void* extra_args) except -1 + + + cdef inline void set_cell(self, int i, int j, weight_t score, int is_valid, weight_t cost) nogil: + self.scores[i][j] = score + self.is_valid[i][j] = is_valid + self.costs[i][j] = cost + + cdef int set_row(self, int i, const weight_t* scores, const int* is_valid, + const weight_t* costs) except -1 + cdef int set_table(self, weight_t** scores, int** is_valid, weight_t** costs) except -1 + + +cdef class MaxViolation: + cdef Pool mem + cdef weight_t cost + cdef weight_t delta + cdef readonly weight_t p_score + cdef readonly weight_t g_score + cdef readonly double Z + cdef readonly double gZ + cdef class_t n + cdef readonly list p_hist + cdef readonly list g_hist + cdef readonly list p_probs + cdef readonly list g_probs + + cpdef int check(self, Beam pred, Beam gold) except -1 + cpdef int check_crf(self, Beam pred, Beam gold) except -1 diff --git a/spacy/pipeline/_parser_internals/search.pyx b/spacy/pipeline/_parser_internals/search.pyx new file mode 100644 index 000000000..1d9b6dd7a --- /dev/null +++ b/spacy/pipeline/_parser_internals/search.pyx @@ -0,0 +1,306 @@ +# cython: profile=True, experimental_cpp_class_def=True, cdivision=True, infer_types=True +cimport cython +from libc.string cimport memset, memcpy +from libc.math cimport log, exp +import math + +from cymem.cymem cimport Pool +from preshed.maps cimport PreshMap + + +cdef class Beam: + def __init__(self, class_t nr_class, class_t width, weight_t min_density=0.0): + assert nr_class != 0 + assert width != 0 + self.nr_class = nr_class + self.width = width + self.min_density = min_density + self.size = 1 + self.t = 0 + self.mem = Pool() + self.del_func = NULL + self._parents = <_State*>self.mem.alloc(self.width, sizeof(_State)) + self._states = <_State*>self.mem.alloc(self.width, sizeof(_State)) + cdef int i + self.histories = [[] for i in range(self.width)] + self._parent_histories = [[] for i in range(self.width)] + + self.scores = self.mem.alloc(self.width, sizeof(weight_t*)) + self.is_valid = self.mem.alloc(self.width, sizeof(weight_t*)) + self.costs = self.mem.alloc(self.width, sizeof(weight_t*)) + for i in range(self.width): + self.scores[i] = self.mem.alloc(self.nr_class, sizeof(weight_t)) + self.is_valid[i] = self.mem.alloc(self.nr_class, sizeof(int)) + self.costs[i] = self.mem.alloc(self.nr_class, sizeof(weight_t)) + + def __len__(self): + return self.size + + property score: + def __get__(self): + return self._states[0].score + + property min_score: + def __get__(self): + return self._states[self.size-1].score + + property loss: + def __get__(self): + return self._states[0].loss + + property probs: + def __get__(self): + return _softmax([self._states[i].score for i in range(self.size)]) + + property scores: + def __get__(self): + return [self._states[i].score for i in range(self.size)] + + property histories: + def __get__(self): + return self.histories + + cdef int set_row(self, int i, const weight_t* scores, const int* is_valid, + const weight_t* costs) except -1: + cdef int j + for j in range(self.nr_class): + self.scores[i][j] = scores[j] + self.is_valid[i][j] = is_valid[j] + self.costs[i][j] = costs[j] + + cdef int set_table(self, weight_t** scores, int** is_valid, weight_t** costs) except -1: + cdef int i, j + for i in range(self.width): + memcpy(self.scores[i], scores[i], sizeof(weight_t) * self.nr_class) + memcpy(self.is_valid[i], is_valid[i], sizeof(bint) * self.nr_class) + memcpy(self.costs[i], costs[i], sizeof(int) * self.nr_class) + + cdef int initialize(self, init_func_t init_func, del_func_t del_func, int n, void* extra_args) except -1: + for i in range(self.width): + self._states[i].content = init_func(self.mem, n, extra_args) + self._parents[i].content = init_func(self.mem, n, extra_args) + self.del_func = del_func + + def __dealloc__(self): + if self.del_func == NULL: + return + + for i in range(self.width): + self.del_func(self.mem, self._states[i].content, NULL) + self.del_func(self.mem, self._parents[i].content, NULL) + + @cython.cdivision(True) + cdef int advance(self, trans_func_t transition_func, hash_func_t hash_func, + void* extra_args) except -1: + cdef weight_t** scores = self.scores + cdef int** is_valid = self.is_valid + cdef weight_t** costs = self.costs + + cdef Queue* q = new Queue() + self._fill(q, scores, is_valid) + # For a beam of width k, we only ever need 2k state objects. How? + # Each transition takes a parent and a class and produces a new state. + # So, we don't need the whole history --- just the parent. So at + # each step, we take a parent, and apply one or more extensions to + # it. + self._parents, self._states = self._states, self._parents + self._parent_histories, self.histories = self.histories, self._parent_histories + cdef weight_t score + cdef int p_i + cdef int i = 0 + cdef class_t clas + cdef _State* parent + cdef _State* state + cdef hash_t key + cdef PreshMap seen_states = PreshMap(self.width) + cdef uint64_t is_seen + cdef uint64_t one = 1 + while i < self.width and not q.empty(): + data = q.top() + p_i = data.second / self.nr_class + clas = data.second % self.nr_class + score = data.first + q.pop() + parent = &self._parents[p_i] + # Indicates terminal state reached; i.e. state is done + if parent.is_done: + # Now parent will not be changed, so we don't have to copy. + # Once finished, should also be unbranching. + self._states[i], parent[0] = parent[0], self._states[i] + parent.i = self._states[i].i + parent.t = self._states[i].t + parent.is_done = self._states[i].t + self._states[i].score = score + self.histories[i] = list(self._parent_histories[p_i]) + i += 1 + else: + state = &self._states[i] + # The supplied transition function should adjust the destination + # state to be the result of applying the class to the source state + transition_func(state.content, parent.content, clas, extra_args) + key = hash_func(state.content, extra_args) if hash_func is not NULL else 0 + is_seen = seen_states.get(key) + if key == 0 or key == 1 or not is_seen: + if key != 0 and key != 1: + seen_states.set(key, one) + state.score = score + state.loss = parent.loss + costs[p_i][clas] + self.histories[i] = list(self._parent_histories[p_i]) + self.histories[i].append(clas) + i += 1 + del q + self.size = i + assert self.size >= 1 + for i in range(self.width): + memset(self.scores[i], 0, sizeof(weight_t) * self.nr_class) + memset(self.costs[i], 0, sizeof(weight_t) * self.nr_class) + memset(self.is_valid[i], 0, sizeof(int) * self.nr_class) + self.t += 1 + + cdef int check_done(self, finish_func_t finish_func, void* extra_args) except -1: + cdef int i + for i in range(self.size): + if not self._states[i].is_done: + self._states[i].is_done = finish_func(self._states[i].content, extra_args) + for i in range(self.size): + if not self._states[i].is_done: + self.is_done = False + break + else: + self.is_done = True + + @cython.cdivision(True) + cdef int _fill(self, Queue* q, weight_t** scores, int** is_valid) except -1: + """Populate the queue from a k * n matrix of scores, where k is the + beam-width, and n is the number of classes. + """ + cdef Entry entry + cdef weight_t score + cdef _State* s + cdef int i, j, move_id + assert self.size >= 1 + cdef vector[Entry] entries + for i in range(self.size): + s = &self._states[i] + move_id = i * self.nr_class + if s.is_done: + # Update score by path average, following TACL '13 paper. + if self.histories[i]: + entry.first = s.score + (s.score / self.t) + else: + entry.first = s.score + entry.second = move_id + entries.push_back(entry) + else: + for j in range(self.nr_class): + if is_valid[i][j]: + entry.first = s.score + scores[i][j] + entry.second = move_id + j + entries.push_back(entry) + cdef double max_, Z, cutoff + if self.min_density == 0.0: + for i in range(entries.size()): + q.push(entries[i]) + elif not entries.empty(): + max_ = entries[0].first + Z = 0. + cutoff = 0. + # Softmax into probabilities, so we can prune + for i in range(entries.size()): + if entries[i].first > max_: + max_ = entries[i].first + for i in range(entries.size()): + Z += exp(entries[i].first-max_) + cutoff = (1. / Z) * self.min_density + for i in range(entries.size()): + prob = exp(entries[i].first-max_) / Z + if prob >= cutoff: + q.push(entries[i]) + + +cdef class MaxViolation: + def __init__(self): + self.p_score = 0.0 + self.g_score = 0.0 + self.Z = 0.0 + self.gZ = 0.0 + self.delta = -1 + self.cost = 0 + self.p_hist = [] + self.g_hist = [] + self.p_probs = [] + self.g_probs = [] + + cpdef int check(self, Beam pred, Beam gold) except -1: + cdef _State* p = &pred._states[0] + cdef _State* g = &gold._states[0] + cdef weight_t d = p.score - g.score + if p.loss >= 1 and (self.cost == 0 or d > self.delta): + self.cost = p.loss + self.delta = d + self.p_hist = list(pred.histories[0]) + self.g_hist = list(gold.histories[0]) + self.p_score = p.score + self.g_score = g.score + self.Z = 1e-10 + self.gZ = 1e-10 + for i in range(pred.size): + if pred._states[i].loss > 0: + self.Z += exp(pred._states[i].score) + for i in range(gold.size): + if gold._states[i].loss == 0: + prob = exp(gold._states[i].score) + self.Z += prob + self.gZ += prob + + cpdef int check_crf(self, Beam pred, Beam gold) except -1: + d = pred.score - gold.score + seen_golds = set([tuple(gold.histories[i]) for i in range(gold.size)]) + if pred.loss > 0 and (self.cost == 0 or d > self.delta): + p_hist = [] + p_scores = [] + g_hist = [] + g_scores = [] + for i in range(pred.size): + if pred._states[i].loss > 0: + p_scores.append(pred._states[i].score) + p_hist.append(list(pred.histories[i])) + # This can happen from non-monotonic actions + # If we find a better gold analysis this way, be sure to keep it. + elif pred._states[i].loss <= 0 \ + and tuple(pred.histories[i]) not in seen_golds: + g_scores.append(pred._states[i].score) + g_hist.append(list(pred.histories[i])) + for i in range(gold.size): + if gold._states[i].loss == 0: + g_scores.append(gold._states[i].score) + g_hist.append(list(gold.histories[i])) + + all_probs = _softmax(p_scores + g_scores) + p_probs = all_probs[:len(p_scores)] + g_probs_all = all_probs[len(p_scores):] + g_probs = _softmax(g_scores) + + self.cost = pred.loss + self.delta = d + self.p_hist = p_hist + self.g_hist = g_hist + # TODO: These variables are misnamed! These are the gradients of the loss. + self.p_probs = p_probs + # Intuition here: + # The gradient of the loss is: + # P(model) - P(truth) + # Normally, P(truth) is 1 for the gold + # But, if we want to do the "partial credit" scheme, we want + # to create a distribution over the gold, proportional to the scores + # awarded. + self.g_probs = [x-y for x, y in zip(g_probs_all, g_probs)] + + +def _softmax(nums): + if not nums: + return [] + max_ = max(nums) + nums = [(exp(n-max_) if n is not None else None) for n in nums] + Z = sum(n for n in nums if n is not None) + return [(n/Z if n is not None else None) for n in nums] diff --git a/spacy/pipeline/edit_tree_lemmatizer.py b/spacy/pipeline/edit_tree_lemmatizer.py index 9676e2194..0531d4ba5 100644 --- a/spacy/pipeline/edit_tree_lemmatizer.py +++ b/spacy/pipeline/edit_tree_lemmatizer.py @@ -5,8 +5,9 @@ from itertools import islice import numpy as np import srsly -from thinc.api import Config, Model, SequenceCategoricalCrossentropy +from thinc.api import Config, Model from thinc.types import ArrayXd, Floats2d, Ints1d +from thinc.legacy import LegacySequenceCategoricalCrossentropy from ._edit_tree_internals.edit_trees import EditTrees from ._edit_tree_internals.schemas import validate_edit_tree @@ -129,7 +130,9 @@ class EditTreeLemmatizer(TrainablePipe): self, examples: Iterable[Example], scores: List[Floats2d] ) -> Tuple[float, List[Floats2d]]: validate_examples(examples, "EditTreeLemmatizer.get_loss") - loss_func = SequenceCategoricalCrossentropy(normalize=False, missing_value=-1) + loss_func = LegacySequenceCategoricalCrossentropy( + normalize=False, missing_value=-1 + ) truths = [] for eg in examples: diff --git a/spacy/pipeline/morphologizer.pyx b/spacy/pipeline/morphologizer.pyx index 782a1dabe..293add9e1 100644 --- a/spacy/pipeline/morphologizer.pyx +++ b/spacy/pipeline/morphologizer.pyx @@ -1,7 +1,8 @@ # cython: infer_types=True, profile=True, binding=True from typing import Callable, Dict, Iterable, List, Optional, Union import srsly -from thinc.api import SequenceCategoricalCrossentropy, Model, Config +from thinc.api import Model, Config +from thinc.legacy import LegacySequenceCategoricalCrossentropy from thinc.types import Floats2d, Ints1d from itertools import islice @@ -290,7 +291,7 @@ class Morphologizer(Tagger): DOCS: https://spacy.io/api/morphologizer#get_loss """ validate_examples(examples, "Morphologizer.get_loss") - loss_func = SequenceCategoricalCrossentropy(names=tuple(self.labels), normalize=False) + loss_func = LegacySequenceCategoricalCrossentropy(names=tuple(self.labels), normalize=False) truths = [] for eg in examples: eg_truths = [] diff --git a/spacy/pipeline/senter.pyx b/spacy/pipeline/senter.pyx index 93a7ee796..42feeb277 100644 --- a/spacy/pipeline/senter.pyx +++ b/spacy/pipeline/senter.pyx @@ -3,7 +3,9 @@ from typing import Dict, Iterable, Optional, Callable, List, Union from itertools import islice import srsly -from thinc.api import Model, SequenceCategoricalCrossentropy, Config +from thinc.api import Model, Config +from thinc.legacy import LegacySequenceCategoricalCrossentropy + from thinc.types import Floats2d, Ints1d from ..tokens.doc cimport Doc @@ -161,7 +163,7 @@ class SentenceRecognizer(Tagger): """ validate_examples(examples, "SentenceRecognizer.get_loss") labels = self.labels - loss_func = SequenceCategoricalCrossentropy(names=labels, normalize=False) + loss_func = LegacySequenceCategoricalCrossentropy(names=labels, normalize=False) truths = [] for eg in examples: eg_truth = [] diff --git a/spacy/pipeline/tagger.pyx b/spacy/pipeline/tagger.pyx index 3b4715ce5..e12f116af 100644 --- a/spacy/pipeline/tagger.pyx +++ b/spacy/pipeline/tagger.pyx @@ -2,7 +2,8 @@ from typing import Callable, Dict, Iterable, List, Optional, Union import numpy import srsly -from thinc.api import Model, set_dropout_rate, SequenceCategoricalCrossentropy, Config +from thinc.api import Model, set_dropout_rate, Config +from thinc.legacy import LegacySequenceCategoricalCrossentropy from thinc.types import Floats2d, Ints1d import warnings from itertools import islice @@ -244,7 +245,7 @@ class Tagger(TrainablePipe): DOCS: https://spacy.io/api/tagger#rehearse """ - loss_func = SequenceCategoricalCrossentropy() + loss_func = LegacySequenceCategoricalCrossentropy() if losses is None: losses = {} losses.setdefault(self.name, 0.0) @@ -275,7 +276,7 @@ class Tagger(TrainablePipe): DOCS: https://spacy.io/api/tagger#get_loss """ validate_examples(examples, "Tagger.get_loss") - loss_func = SequenceCategoricalCrossentropy(names=self.labels, normalize=False, neg_prefix=self.cfg["neg_prefix"]) + loss_func = LegacySequenceCategoricalCrossentropy(names=self.labels, normalize=False, neg_prefix=self.cfg["neg_prefix"]) # Convert empty tag "" to missing value None so that both misaligned # tokens and tokens with missing annotation have the default missing # value None. diff --git a/spacy/pipeline/transition_parser.pyx b/spacy/pipeline/transition_parser.pyx index 340334b1a..9d7b258c6 100644 --- a/spacy/pipeline/transition_parser.pyx +++ b/spacy/pipeline/transition_parser.pyx @@ -10,12 +10,12 @@ import random import srsly from thinc.api import get_ops, set_dropout_rate, CupyOps, NumpyOps -from thinc.extra.search cimport Beam import numpy.random import numpy import warnings from ._parser_internals.stateclass cimport StateClass +from ._parser_internals.search cimport Beam from ..ml.parser_model cimport alloc_activations, free_activations from ..ml.parser_model cimport predict_states, arg_max_if_valid from ..ml.parser_model cimport WeightsC, ActivationsC, SizesC, cpu_log_loss diff --git a/spacy/tests/conftest.py b/spacy/tests/conftest.py index 2be286a57..b9c4ef715 100644 --- a/spacy/tests/conftest.py +++ b/spacy/tests/conftest.py @@ -1,6 +1,10 @@ import pytest from spacy.util import get_lang_class +import functools from hypothesis import settings +import inspect +import importlib +import sys # Functionally disable deadline settings for tests # to prevent spurious test failures in CI builds. @@ -47,6 +51,33 @@ def pytest_runtest_setup(item): pytest.skip("not referencing any issues") +# Decorator for Cython-built tests +# https://shwina.github.io/cython-testing/ +def cytest(func): + """ + Wraps `func` in a plain Python function. + """ + + @functools.wraps(func) + def wrapped(*args, **kwargs): + bound = inspect.signature(func).bind(*args, **kwargs) + return func(*bound.args, **bound.kwargs) + + return wrapped + + +def register_cython_tests(cython_mod_name: str, test_mod_name: str): + """ + Registers all callables with name `test_*` in Cython module `cython_mod_name` + as attributes in module `test_mod_name`, making them discoverable by pytest. + """ + cython_mod = importlib.import_module(cython_mod_name) + for name in dir(cython_mod): + item = getattr(cython_mod, name) + if callable(item) and name.startswith("test_"): + setattr(sys.modules[test_mod_name], name, item) + + # Fixtures for language tokenizers (languages sorted alphabetically) diff --git a/spacy/tests/parser/_search.pyx b/spacy/tests/parser/_search.pyx new file mode 100644 index 000000000..23fc81644 --- /dev/null +++ b/spacy/tests/parser/_search.pyx @@ -0,0 +1,119 @@ +# cython: infer_types=True, binding=True +from spacy.pipeline._parser_internals.search cimport Beam, MaxViolation +from spacy.typedefs cimport class_t, weight_t +from cymem.cymem cimport Pool + +from ..conftest import cytest +import pytest + +cdef struct TestState: + int length + int x + Py_UNICODE* string + + +cdef int transition(void* dest, void* src, class_t clas, void* extra_args) except -1: + dest_state = dest + src_state = src + dest_state.length = src_state.length + dest_state.x = src_state.x + dest_state.x += clas + if extra_args != NULL: + dest_state.string = extra_args + else: + dest_state.string = src_state.string + + +cdef void* initialize(Pool mem, int n, void* extra_args) except NULL: + state = mem.alloc(1, sizeof(TestState)) + state.length = n + state.x = 1 + if extra_args == NULL: + state.string = u'default' + else: + state.string = extra_args + return state + + +cdef int destroy(Pool mem, void* state, void* extra_args) except -1: + state = state + mem.free(state) + +@cytest +@pytest.mark.parametrize("nr_class,beam_width", + [ + (2, 3), + (3, 6), + (4, 20), + ] +) +def test_init(nr_class, beam_width): + b = Beam(nr_class, beam_width) + assert b.size == 1 + assert b.width == beam_width + assert b.nr_class == nr_class + +@cytest +def test_init_violn(): + MaxViolation() + +@cytest +@pytest.mark.parametrize("nr_class,beam_width,length", + [ + (2, 3, 3), + (3, 6, 15), + (4, 20, 32), + ] +) +def test_initialize(nr_class, beam_width, length): + b = Beam(nr_class, beam_width) + b.initialize(initialize, destroy, length, NULL) + for i in range(b.width): + s = b.at(i) + assert s.length == length, s.length + assert s.string == 'default' + + +@cytest +@pytest.mark.parametrize("nr_class,beam_width,length,extra", + [ + (2, 3, 4, None), + (3, 6, 15, u"test beam 1"), + ] +) +def test_initialize_extra(nr_class, beam_width, length, extra): + b = Beam(nr_class, beam_width) + if extra is None: + b.initialize(initialize, destroy, length, NULL) + else: + b.initialize(initialize, destroy, length, extra) + for i in range(b.width): + s = b.at(i) + assert s.length == length + + +@cytest +@pytest.mark.parametrize("nr_class,beam_width,length", + [ + (3, 6, 15), + (4, 20, 32), + ] +) +def test_transition(nr_class, beam_width, length): + b = Beam(nr_class, beam_width) + b.initialize(initialize, destroy, length, NULL) + b.set_cell(0, 2, 30, True, 0) + b.set_cell(0, 1, 42, False, 0) + b.advance(transition, NULL, NULL) + assert b.size == 1, b.size + assert b.score == 30, b.score + s = b.at(0) + assert s.x == 3 + assert b._states[0].score == 30, b._states[0].score + b.set_cell(0, 1, 10, True, 0) + b.set_cell(0, 2, 20, True, 0) + b.advance(transition, NULL, NULL) + assert b._states[0].score == 50, b._states[0].score + assert b._states[1].score == 40 + s = b.at(0) + assert s.x == 5 diff --git a/spacy/tests/parser/test_search.py b/spacy/tests/parser/test_search.py new file mode 100644 index 000000000..136c3a11b --- /dev/null +++ b/spacy/tests/parser/test_search.py @@ -0,0 +1,3 @@ +from ..conftest import register_cython_tests + +register_cython_tests("spacy.tests.parser._search", __name__) From 3a2b655a29203d1c181a2c14d230b3f9cf8dd54a Mon Sep 17 00:00:00 2001 From: cfuerbachersparks <119413757+cfuerbachersparks@users.noreply.github.com> Date: Mon, 19 Dec 2022 10:33:38 +0100 Subject: [PATCH 145/161] Update lexeme.md (#11994) Change suffix_ string to end --- website/docs/api/lexeme.md | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/website/docs/api/lexeme.md b/website/docs/api/lexeme.md index eb76afa90..557d04cce 100644 --- a/website/docs/api/lexeme.md +++ b/website/docs/api/lexeme.md @@ -138,7 +138,7 @@ The L2 norm of the lexeme's vector representation. | `prefix` | Length-N substring from the start of the word. Defaults to `N=1`. ~~int~~ | | `prefix_` | Length-N substring from the start of the word. Defaults to `N=1`. ~~str~~ | | `suffix` | Length-N substring from the end of the word. Defaults to `N=3`. ~~int~~ | -| `suffix_` | Length-N substring from the start of the word. Defaults to `N=3`. ~~str~~ | +| `suffix_` | Length-N substring from the end of the word. Defaults to `N=3`. ~~str~~ | | `is_alpha` | Does the lexeme consist of alphabetic characters? Equivalent to `lexeme.text.isalpha()`. ~~bool~~ | | `is_ascii` | Does the lexeme consist of ASCII characters? Equivalent to `[any(ord(c) >= 128 for c in lexeme.text)]`. ~~bool~~ | | `is_digit` | Does the lexeme consist of digits? Equivalent to `lexeme.text.isdigit()`. ~~bool~~ | From 18ffe5bbd6a554920107ff48d1387df34c3f872a Mon Sep 17 00:00:00 2001 From: Jos Polfliet Date: Mon, 19 Dec 2022 16:17:49 +0100 Subject: [PATCH 146/161] Update stop_words.py (#11997) fix typo in "aangaande" --- spacy/lang/nl/stop_words.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/lang/nl/stop_words.py b/spacy/lang/nl/stop_words.py index a2c6198e7..cd4fdefdf 100644 --- a/spacy/lang/nl/stop_words.py +++ b/spacy/lang/nl/stop_words.py @@ -15,7 +15,7 @@ STOP_WORDS = set( """ -aan af al alle alles allebei alleen allen als altijd ander anders andere anderen aangaangde aangezien achter achterna +aan af al alle alles allebei alleen allen als altijd ander anders andere anderen aangaande aangezien achter achterna afgelopen aldus alhoewel anderzijds ben bij bijna bijvoorbeeld behalve beide beiden beneden bent bepaald beter betere betreffende binnen binnenin boven From c223cd7a86f460f3dabb9e7369eef136a653218e Mon Sep 17 00:00:00 2001 From: kadarakos Date: Tue, 20 Dec 2022 17:11:33 +0100 Subject: [PATCH 147/161] Add apply CLI (#11376) * annotate cli first try * add batch-size and n_process * rename to apply * typing fix * handle file suffixes * walk directories * support jsonl * typing fix * remove debug * make suffix optional for walk * revert unrelated * don't warn but raise * better error message * minor touch up * Update spacy/tests/test_cli.py Co-authored-by: Adriane Boyd * Update spacy/cli/apply.py Co-authored-by: Sofie Van Landeghem * Update spacy/cli/apply.py Co-authored-by: Sofie Van Landeghem * update tests and bugfix * add force_overwrite * typo * fix adding .spacy suffix * Update spacy/cli/apply.py Co-authored-by: Sofie Van Landeghem * Update spacy/cli/apply.py Co-authored-by: Sofie Van Landeghem * Update spacy/cli/apply.py Co-authored-by: Sofie Van Landeghem * store user data and rename cmd arg * include test for user attr * rename cmd arg * better help message * documentation * prettier * black * link fix * Update spacy/cli/apply.py Co-authored-by: Paul O'Leary McCann * Update website/docs/api/cli.md Co-authored-by: Paul O'Leary McCann * Update website/docs/api/cli.md Co-authored-by: Paul O'Leary McCann * Update website/docs/api/cli.md Co-authored-by: Paul O'Leary McCann * addressing reviews * dont quit but warn * prettier Co-authored-by: Adriane Boyd Co-authored-by: Sofie Van Landeghem Co-authored-by: Paul O'Leary McCann --- spacy/cli/__init__.py | 1 + spacy/cli/_util.py | 23 +++++++ spacy/cli/apply.py | 143 ++++++++++++++++++++++++++++++++++++++++ spacy/cli/convert.py | 31 +-------- spacy/tests/test_cli.py | 78 ++++++++++++++++++++++ website/docs/api/cli.md | 35 +++++++++- 6 files changed, 280 insertions(+), 31 deletions(-) create mode 100644 spacy/cli/apply.py diff --git a/spacy/cli/__init__.py b/spacy/cli/__init__.py index aab2c8d12..aabd1cfef 100644 --- a/spacy/cli/__init__.py +++ b/spacy/cli/__init__.py @@ -16,6 +16,7 @@ from .debug_config import debug_config # noqa: F401 from .debug_model import debug_model # noqa: F401 from .debug_diff import debug_diff # noqa: F401 from .evaluate import evaluate # noqa: F401 +from .apply import apply # noqa: F401 from .convert import convert # noqa: F401 from .init_pipeline import init_pipeline_cli # noqa: F401 from .init_config import init_config, fill_config # noqa: F401 diff --git a/spacy/cli/_util.py b/spacy/cli/_util.py index 9b97a9f19..c46abffe5 100644 --- a/spacy/cli/_util.py +++ b/spacy/cli/_util.py @@ -582,6 +582,29 @@ def setup_gpu(use_gpu: int, silent=None) -> None: local_msg.info("To switch to GPU 0, use the option: --gpu-id 0") +def walk_directory(path: Path, suffix: Optional[str] = None) -> List[Path]: + if not path.is_dir(): + return [path] + paths = [path] + locs = [] + seen = set() + for path in paths: + if str(path) in seen: + continue + seen.add(str(path)) + if path.parts[-1].startswith("."): + continue + elif path.is_dir(): + paths.extend(path.iterdir()) + elif suffix is not None and not path.parts[-1].endswith(suffix): + continue + else: + locs.append(path) + # It's good to sort these, in case the ordering messes up cache. + locs.sort() + return locs + + def _format_number(number: Union[int, float], ndigits: int = 2) -> str: """Formats a number (float or int) rounding to `ndigits`, without truncating trailing 0s, as happens with `round(number, ndigits)`""" diff --git a/spacy/cli/apply.py b/spacy/cli/apply.py new file mode 100644 index 000000000..9d170bc95 --- /dev/null +++ b/spacy/cli/apply.py @@ -0,0 +1,143 @@ +import tqdm +import srsly + +from itertools import chain +from pathlib import Path +from typing import Optional, List, Iterable, cast, Union + +from wasabi import msg + +from ._util import app, Arg, Opt, setup_gpu, import_code, walk_directory + +from ..tokens import Doc, DocBin +from ..vocab import Vocab +from ..util import ensure_path, load_model + + +path_help = """Location of the documents to predict on. +Can be a single file in .spacy format or a .jsonl file. +Files with other extensions are treated as single plain text documents. +If a directory is provided it is traversed recursively to grab +all files to be processed. +The files can be a mixture of .spacy, .jsonl and text files. +If .jsonl is provided the specified field is going +to be grabbed ("text" by default).""" + +out_help = "Path to save the resulting .spacy file" +code_help = ( + "Path to Python file with additional " "code (registered functions) to be imported" +) +gold_help = "Use gold preprocessing provided in the .spacy files" +force_msg = ( + "The provided output file already exists. " + "To force overwriting the output file, set the --force or -F flag." +) + + +DocOrStrStream = Union[Iterable[str], Iterable[Doc]] + + +def _stream_docbin(path: Path, vocab: Vocab) -> Iterable[Doc]: + """ + Stream Doc objects from DocBin. + """ + docbin = DocBin().from_disk(path) + for doc in docbin.get_docs(vocab): + yield doc + + +def _stream_jsonl(path: Path, field: str) -> Iterable[str]: + """ + Stream "text" field from JSONL. If the field "text" is + not found it raises error. + """ + for entry in srsly.read_jsonl(path): + if field not in entry: + msg.fail( + f"{path} does not contain the required '{field}' field.", exits=1 + ) + else: + yield entry[field] + + +def _stream_texts(paths: Iterable[Path]) -> Iterable[str]: + """ + Yields strings from text files in paths. + """ + for path in paths: + with open(path, "r") as fin: + text = fin.read() + yield text + + +@app.command("apply") +def apply_cli( + # fmt: off + model: str = Arg(..., help="Model name or path"), + data_path: Path = Arg(..., help=path_help, exists=True), + output_file: Path = Arg(..., help=out_help, dir_okay=False), + code_path: Optional[Path] = Opt(None, "--code", "-c", help=code_help), + text_key: str = Opt("text", "--text-key", "-tk", help="Key containing text string for JSONL"), + force_overwrite: bool = Opt(False, "--force", "-F", help="Force overwriting the output file"), + use_gpu: int = Opt(-1, "--gpu-id", "-g", help="GPU ID or -1 for CPU."), + batch_size: int = Opt(1, "--batch-size", "-b", help="Batch size."), + n_process: int = Opt(1, "--n-process", "-n", help="number of processors to use.") +): + """ + Apply a trained pipeline to documents to get predictions. + Expects a loadable spaCy pipeline and path to the data, which + can be a directory or a file. + The data files can be provided in multiple formats: + 1. .spacy files + 2. .jsonl files with a specified "field" to read the text from. + 3. Files with any other extension are assumed to be containing + a single document. + DOCS: https://spacy.io/api/cli#apply + """ + data_path = ensure_path(data_path) + output_file = ensure_path(output_file) + code_path = ensure_path(code_path) + if output_file.exists() and not force_overwrite: + msg.fail(force_msg, exits=1) + if not data_path.exists(): + msg.fail(f"Couldn't find data path: {data_path}", exits=1) + import_code(code_path) + setup_gpu(use_gpu) + apply(data_path, output_file, model, text_key, batch_size, n_process) + + +def apply( + data_path: Path, + output_file: Path, + model: str, + json_field: str, + batch_size: int, + n_process: int, +): + docbin = DocBin(store_user_data=True) + paths = walk_directory(data_path) + if len(paths) == 0: + docbin.to_disk(output_file) + msg.warn("Did not find data to process," + f" {data_path} seems to be an empty directory.") + return + nlp = load_model(model) + msg.good(f"Loaded model {model}") + vocab = nlp.vocab + streams: List[DocOrStrStream] = [] + text_files = [] + for path in paths: + if path.suffix == ".spacy": + streams.append(_stream_docbin(path, vocab)) + elif path.suffix == ".jsonl": + streams.append(_stream_jsonl(path, json_field)) + else: + text_files.append(path) + if len(text_files) > 0: + streams.append(_stream_texts(text_files)) + datagen = cast(DocOrStrStream, chain(*streams)) + for doc in tqdm.tqdm(nlp.pipe(datagen, batch_size=batch_size, n_process=n_process)): + docbin.add(doc) + if output_file.suffix == "": + output_file = output_file.with_suffix(".spacy") + docbin.to_disk(output_file) diff --git a/spacy/cli/convert.py b/spacy/cli/convert.py index 04eb7078f..7f365ae2c 100644 --- a/spacy/cli/convert.py +++ b/spacy/cli/convert.py @@ -1,4 +1,4 @@ -from typing import Callable, Iterable, Mapping, Optional, Any, List, Union +from typing import Callable, Iterable, Mapping, Optional, Any, Union from enum import Enum from pathlib import Path from wasabi import Printer @@ -7,7 +7,7 @@ import re import sys import itertools -from ._util import app, Arg, Opt +from ._util import app, Arg, Opt, walk_directory from ..training import docs_to_json from ..tokens import Doc, DocBin from ..training.converters import iob_to_docs, conll_ner_to_docs, json_to_docs @@ -189,33 +189,6 @@ def autodetect_ner_format(input_data: str) -> Optional[str]: return None -def walk_directory(path: Path, converter: str) -> List[Path]: - if not path.is_dir(): - return [path] - paths = [path] - locs = [] - seen = set() - for path in paths: - if str(path) in seen: - continue - seen.add(str(path)) - if path.parts[-1].startswith("."): - continue - elif path.is_dir(): - paths.extend(path.iterdir()) - elif converter == "json" and not path.parts[-1].endswith("json"): - continue - elif converter == "conll" and not path.parts[-1].endswith("conll"): - continue - elif converter == "iob" and not path.parts[-1].endswith("iob"): - continue - else: - locs.append(path) - # It's good to sort these, in case the ordering messes up cache. - locs.sort() - return locs - - def verify_cli_args( msg: Printer, input_path: Path, diff --git a/spacy/tests/test_cli.py b/spacy/tests/test_cli.py index 42af08749..c6768a3fd 100644 --- a/spacy/tests/test_cli.py +++ b/spacy/tests/test_cli.py @@ -5,6 +5,7 @@ from typing import Tuple, List, Dict, Any import pkg_resources import time +import spacy import numpy import pytest import srsly @@ -32,6 +33,7 @@ from spacy.cli.package import _is_permitted_package_name from spacy.cli.project.remote_storage import RemoteStorage from spacy.cli.project.run import _check_requirements from spacy.cli.validate import get_model_pkgs +from spacy.cli.apply import apply from spacy.cli.find_threshold import find_threshold from spacy.lang.en import English from spacy.lang.nl import Dutch @@ -885,6 +887,82 @@ def test_span_length_freq_dist_output_must_be_correct(): assert list(span_freqs.keys()) == [3, 1, 4, 5, 2] +def test_applycli_empty_dir(): + with make_tempdir() as data_path: + output = data_path / "test.spacy" + apply(data_path, output, "blank:en", "text", 1, 1) + + +def test_applycli_docbin(): + with make_tempdir() as data_path: + output = data_path / "testout.spacy" + nlp = spacy.blank("en") + doc = nlp("testing apply cli.") + # test empty DocBin case + docbin = DocBin() + docbin.to_disk(data_path / "testin.spacy") + apply(data_path, output, "blank:en", "text", 1, 1) + docbin.add(doc) + docbin.to_disk(data_path / "testin.spacy") + apply(data_path, output, "blank:en", "text", 1, 1) + + +def test_applycli_jsonl(): + with make_tempdir() as data_path: + output = data_path / "testout.spacy" + data = [{"field": "Testing apply cli.", "key": 234}] + data2 = [{"field": "234"}] + srsly.write_jsonl(data_path / "test.jsonl", data) + apply(data_path, output, "blank:en", "field", 1, 1) + srsly.write_jsonl(data_path / "test2.jsonl", data2) + apply(data_path, output, "blank:en", "field", 1, 1) + + +def test_applycli_txt(): + with make_tempdir() as data_path: + output = data_path / "testout.spacy" + with open(data_path / "test.foo", "w") as ftest: + ftest.write("Testing apply cli.") + apply(data_path, output, "blank:en", "text", 1, 1) + + +def test_applycli_mixed(): + with make_tempdir() as data_path: + output = data_path / "testout.spacy" + text = "Testing apply cli" + nlp = spacy.blank("en") + doc = nlp(text) + jsonl_data = [{"text": text}] + srsly.write_jsonl(data_path / "test.jsonl", jsonl_data) + docbin = DocBin() + docbin.add(doc) + docbin.to_disk(data_path / "testin.spacy") + with open(data_path / "test.txt", "w") as ftest: + ftest.write(text) + apply(data_path, output, "blank:en", "text", 1, 1) + # Check whether it worked + result = list(DocBin().from_disk(output).get_docs(nlp.vocab)) + assert len(result) == 3 + for doc in result: + assert doc.text == text + + +def test_applycli_user_data(): + Doc.set_extension("ext", default=0) + val = ("ext", 0) + with make_tempdir() as data_path: + output = data_path / "testout.spacy" + nlp = spacy.blank("en") + doc = nlp("testing apply cli.") + doc._.ext = val + docbin = DocBin(store_user_data=True) + docbin.add(doc) + docbin.to_disk(data_path / "testin.spacy") + apply(data_path, output, "blank:en", "", 1, 1) + result = list(DocBin().from_disk(output).get_docs(nlp.vocab)) + assert result[0]._.ext == val + + def test_local_remote_storage(): with make_tempdir() as d: filename = "a.txt" diff --git a/website/docs/api/cli.md b/website/docs/api/cli.md index 8823a3bd8..275e37ee0 100644 --- a/website/docs/api/cli.md +++ b/website/docs/api/cli.md @@ -12,6 +12,7 @@ menu: - ['train', 'train'] - ['pretrain', 'pretrain'] - ['evaluate', 'evaluate'] + - ['apply', 'apply'] - ['find-threshold', 'find-threshold'] - ['assemble', 'assemble'] - ['package', 'package'] @@ -474,7 +475,7 @@ report span characteristics such as the average span length and the span (or span boundary) distinctiveness. The distinctiveness measure shows how different the tokens are with respect to the rest of the corpus using the KL-divergence of the token distributions. To learn more, you can check out Papay et al.'s work on -[*Dissecting Span Identification Tasks with Performance Prediction* (EMNLP 2020)](https://aclanthology.org/2020.emnlp-main.396/). +[_Dissecting Span Identification Tasks with Performance Prediction_ (EMNLP 2020)](https://aclanthology.org/2020.emnlp-main.396/). @@ -1162,6 +1163,37 @@ $ python -m spacy evaluate [model] [data_path] [--output] [--code] [--gold-prepr | `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | | **CREATES** | Training results and optional metrics and visualizations. | +## apply {#apply new="3.5" tag="command"} + +Applies a trained pipeline to data and stores the resulting annotated documents +in a `DocBin`. The input can be a single file or a directory. The recognized +input formats are: + +1. `.spacy` +2. `.jsonl` containing a user specified `text_key` +3. Files with any other extension are assumed to be plain text files containing + a single document. + +When a directory is provided it is traversed recursively to collect all files. + +```cli +$ python -m spacy apply [model] [data-path] [output-file] [--code] [--text-key] [--force-overwrite] [--gpu-id] [--batch-size] [--n-process] +``` + +| Name | Description | +| ----------------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | +| `model` | Pipeline to apply to the data. Can be a package or a path to a data directory. ~~str (positional)~~ | +| `data_path` | Location of data to be evaluated in spaCy's [binary format](/api/data-formats#training), jsonl, or plain text. ~~Path (positional)~~ | +| `output-file`, `-o` | Output `DocBin` path. ~~str (positional)~~ | +| `--code`, `-c` 3 | Path to Python file with additional code to be imported. Allows [registering custom functions](/usage/training#custom-functions) for new architectures. ~~Optional[Path] \(option)~~ | +| `--text-key`, `-tk` | The key for `.jsonl` files to use to grab the texts from. Defaults to `text`. ~~Optional[str] \(option)~~ | +| `--force-overwrite`, `-F` | If the provided `output-file` already exists, then force `apply` to overwrite it. If this is `False` (default) then quits with a warning instead. ~~bool (flag)~~ | +| `--gpu-id`, `-g` | GPU to use, if any. Defaults to `-1` for CPU. ~~int (option)~~ | +| `--batch-size`, `-b` | Batch size to use for prediction. Defaults to `1`. ~~int (option)~~ | +| `--n-process`, `-n` | Number of processes to use for prediction. Defaults to `1`. ~~int (option)~~ | +| `--help`, `-h` | Show help message and available arguments. ~~bool (flag)~~ | +| **CREATES** | A `DocBin` with the annotations from the `model` for all the files found in `data-path`. | + ## find-threshold {#find-threshold new="3.5" tag="command"} Runs prediction trials for a trained model with varying tresholds to maximize @@ -1187,7 +1219,6 @@ be provided. > $ python -m spacy find-threshold my_nlp data.spacy spancat threshold spans_sc_f > ``` - | Name | Description | | ----------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ | | `model` | Pipeline to evaluate. Can be a package or a path to a data directory. ~~str (positional)~~ | From eef3d950b4266ab9545143de8070456ce7967950 Mon Sep 17 00:00:00 2001 From: Raphael Mitsch Date: Wed, 21 Dec 2022 18:54:27 +0100 Subject: [PATCH 148/161] Fix `SpanGroup` and `Span` typing (#12009) * Correct Span.label, Span.kb_id types. Fix SpanGroup.__iter__(). * Extend test. * Rename test. Fix typo. * Add comment. * Fix types for Span.label, Span.kb_id, Span.char_span(). * Update spacy/tests/doc/test_span_group.py Co-authored-by: Adriane Boyd * Update docs. * Fix typo. * Update spacy/tokens/span_group.pyx Co-authored-by: Adriane Boyd Co-authored-by: Adriane Boyd --- spacy/tests/doc/test_span_group.py | 15 ++++++++++++++- spacy/tokens/span.pyi | 4 ++-- spacy/tokens/span_group.pyi | 1 + spacy/tokens/span_group.pyx | 10 ++++++++++ website/docs/api/spangroup.md | 17 +++++++++++++++++ 5 files changed, 44 insertions(+), 3 deletions(-) diff --git a/spacy/tests/doc/test_span_group.py b/spacy/tests/doc/test_span_group.py index 8c70a83e1..818569c64 100644 --- a/spacy/tests/doc/test_span_group.py +++ b/spacy/tests/doc/test_span_group.py @@ -1,7 +1,10 @@ +from typing import List + import pytest from random import Random from spacy.matcher import Matcher -from spacy.tokens import Span, SpanGroup +from spacy.tokens import Span, SpanGroup, Doc +from spacy.util import filter_spans @pytest.fixture @@ -240,3 +243,13 @@ def test_span_group_extend(doc): def test_span_group_dealloc(span_group): with pytest.raises(AttributeError): print(span_group.doc) + + +@pytest.mark.issue(11975) +def test_span_group_typing(doc: Doc): + """Tests whether typing of `SpanGroup` as `Iterable[Span]`-like object is accepted by mypy.""" + span_group: SpanGroup = doc.spans["SPANS"] + spans: List[Span] = list(span_group) + for i, span in enumerate(span_group): + assert span == span_group[i] == spans[i] + filter_spans(span_group) diff --git a/spacy/tokens/span.pyi b/spacy/tokens/span.pyi index 0a6f306a6..9986a90e6 100644 --- a/spacy/tokens/span.pyi +++ b/spacy/tokens/span.pyi @@ -95,8 +95,8 @@ class Span: self, start_idx: int, end_idx: int, - label: int = ..., - kb_id: int = ..., + label: Union[int, str] = ..., + kb_id: Union[int, str] = ..., vector: Optional[Floats1d] = ..., ) -> Span: ... @property diff --git a/spacy/tokens/span_group.pyi b/spacy/tokens/span_group.pyi index 21cd124ab..0b4aa83aa 100644 --- a/spacy/tokens/span_group.pyi +++ b/spacy/tokens/span_group.pyi @@ -18,6 +18,7 @@ class SpanGroup: def doc(self) -> Doc: ... @property def has_overlap(self) -> bool: ... + def __iter__(self): ... def __len__(self) -> int: ... def append(self, span: Span) -> None: ... def extend(self, spans: Iterable[Span]) -> None: ... diff --git a/spacy/tokens/span_group.pyx b/spacy/tokens/span_group.pyx index 1aa3c0bc8..608dda283 100644 --- a/spacy/tokens/span_group.pyx +++ b/spacy/tokens/span_group.pyx @@ -158,6 +158,16 @@ cdef class SpanGroup: return self._concat(other) return NotImplemented + def __iter__(self): + """ + Iterate over the spans in this SpanGroup. + YIELDS (Span): A span in this SpanGroup. + + DOCS: https://spacy.io/api/spangroup#iter + """ + for i in range(self.c.size()): + yield self[i] + def append(self, Span span): """Add a span to the group. The span must refer to the same Doc object as the span group. diff --git a/website/docs/api/spangroup.md b/website/docs/api/spangroup.md index 2d1cf73c4..bd9659acb 100644 --- a/website/docs/api/spangroup.md +++ b/website/docs/api/spangroup.md @@ -202,6 +202,23 @@ already present in the current span group. | `other` | The span group or spans to append. ~~Union[SpanGroup, Iterable[Span]]~~ | | **RETURNS** | The span group. ~~SpanGroup~~ | +## SpanGroup.\_\_iter\_\_ {#iter tag="method" new="3.5"} + +Iterate over the spans in this span group. + +> #### Example +> +> ```python +> doc = nlp("Their goi ng home") +> doc.spans["errors"] = [doc[0:1], doc[1:3]] +> for error_span in doc.spans["errors"]: +> print(error_span) +> ``` + +| Name | Description | +| ---------- | ----------------------------------- | +| **YIELDS** | A span in this span group. ~~Span~~ | + ## SpanGroup.append {#append tag="method"} Add a [`Span`](/api/span) object to the group. The span must refer to the same From 2f08deea2a419d9e7378a159eaa5d67dd7f96dae Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Danie=CC=88l=20de=20Kok?= Date: Thu, 22 Dec 2022 10:23:31 +0100 Subject: [PATCH 149/161] Fix fallout from a previous merge --- spacy/pipeline/textcat_multilabel.py | 5 +---- 1 file changed, 1 insertion(+), 4 deletions(-) diff --git a/spacy/pipeline/textcat_multilabel.py b/spacy/pipeline/textcat_multilabel.py index bdf933c10..d64be66f6 100644 --- a/spacy/pipeline/textcat_multilabel.py +++ b/spacy/pipeline/textcat_multilabel.py @@ -155,11 +155,8 @@ class MultiLabel_TextCategorizer(TextCategorizer): name (str): The component instance name, used to add entries to the losses during training. threshold (float): Cutoff to consider a prediction "positive". -<<<<<<< HEAD - save_activations (bool): save model activations in Doc when annotating. -======= scorer (Optional[Callable]): The scoring method. ->>>>>>> upstream/master + save_activations (bool): save model activations in Doc when annotating. DOCS: https://spacy.io/api/textcategorizer#init """ From 64d2d27c5dbf8e5657187975d2c9627f30e108a2 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Thu, 22 Dec 2022 10:53:16 +0100 Subject: [PATCH 150/161] Add classifier for python 3.11 (#12013) --- setup.cfg | 1 + 1 file changed, 1 insertion(+) diff --git a/setup.cfg b/setup.cfg index cf6e6f84b..d290d706c 100644 --- a/setup.cfg +++ b/setup.cfg @@ -22,6 +22,7 @@ classifiers = Programming Language :: Python :: 3.8 Programming Language :: Python :: 3.9 Programming Language :: Python :: 3.10 + Programming Language :: Python :: 3.11 Topic :: Scientific/Engineering project_urls = Release notes = https://github.com/explosion/spaCy/releases From 90896504a5dba1babac04a2b88662179409ae006 Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Fri, 23 Dec 2022 12:44:07 +0100 Subject: [PATCH 151/161] Auto-format code with black (#12019) Co-authored-by: explosion-bot --- spacy/cli/apply.py | 10 +++++----- 1 file changed, 5 insertions(+), 5 deletions(-) diff --git a/spacy/cli/apply.py b/spacy/cli/apply.py index 9d170bc95..f0df4e757 100644 --- a/spacy/cli/apply.py +++ b/spacy/cli/apply.py @@ -53,9 +53,7 @@ def _stream_jsonl(path: Path, field: str) -> Iterable[str]: """ for entry in srsly.read_jsonl(path): if field not in entry: - msg.fail( - f"{path} does not contain the required '{field}' field.", exits=1 - ) + msg.fail(f"{path} does not contain the required '{field}' field.", exits=1) else: yield entry[field] @@ -118,8 +116,10 @@ def apply( paths = walk_directory(data_path) if len(paths) == 0: docbin.to_disk(output_file) - msg.warn("Did not find data to process," - f" {data_path} seems to be an empty directory.") + msg.warn( + "Did not find data to process," + f" {data_path} seems to be an empty directory." + ) return nlp = load_model(model) msg.good(f"Loaded model {model}") From aa2b471a6e289d1c1bb51558df779ae028671225 Mon Sep 17 00:00:00 2001 From: Madeesh Kannan Date: Fri, 23 Dec 2022 15:21:44 +0100 Subject: [PATCH 152/161] New console logger with expanded progress tracking (#11972) * Add `ConsoleLogger.v3` This addition expands the progress bar feature to count up the training/distillation steps to either the next evaluation pass or the maximum number of steps. * Rename progress bar types * Add defaults to docs Minor fixes * Move comment * Minor punctuation fixes * Explicitly check for `None` when validating progress bar type Co-authored-by: Paul O'Leary McCann --- spacy/errors.py | 1 + spacy/training/loggers.py | 48 ++++++++++++++++++++++++++++++++--- website/docs/api/top-level.md | 34 ++++++++++++++++++++----- 3 files changed, 74 insertions(+), 9 deletions(-) diff --git a/spacy/errors.py b/spacy/errors.py index 0e5ef91ed..cd9281e91 100644 --- a/spacy/errors.py +++ b/spacy/errors.py @@ -962,6 +962,7 @@ class Errors(metaclass=ErrorsWithCodes): E1046 = ("{cls_name} is an abstract class and cannot be instantiated. If you are looking for spaCy's default " "knowledge base, use `InMemoryLookupKB`.") E1047 = ("`find_threshold()` only supports components with a `scorer` attribute.") + E1048 = ("Got '{unexpected}' as console progress bar type, but expected one of the following: {expected}") # Deprecated model shortcuts, only used in errors and warnings diff --git a/spacy/training/loggers.py b/spacy/training/loggers.py index 408ea7140..7de31822e 100644 --- a/spacy/training/loggers.py +++ b/spacy/training/loggers.py @@ -26,6 +26,8 @@ def setup_table( return final_cols, final_widths, ["r" for _ in final_widths] +# We cannot rename this method as it's directly imported +# and used by external packages such as spacy-loggers. @registry.loggers("spacy.ConsoleLogger.v2") def console_logger( progress_bar: bool = False, @@ -33,7 +35,27 @@ def console_logger( output_file: Optional[Union[str, Path]] = None, ): """The ConsoleLogger.v2 prints out training logs in the console and/or saves them to a jsonl file. - progress_bar (bool): Whether the logger should print the progress bar. + progress_bar (bool): Whether the logger should print a progress bar tracking the steps till the next evaluation pass. + console_output (bool): Whether the logger should print the logs on the console. + output_file (Optional[Union[str, Path]]): The file to save the training logs to. + """ + return console_logger_v3( + progress_bar=None if progress_bar is False else "eval", + console_output=console_output, + output_file=output_file, + ) + + +@registry.loggers("spacy.ConsoleLogger.v3") +def console_logger_v3( + progress_bar: Optional[str] = None, + console_output: bool = True, + output_file: Optional[Union[str, Path]] = None, +): + """The ConsoleLogger.v3 prints out training logs in the console and/or saves them to a jsonl file. + progress_bar (Optional[str]): Type of progress bar to show in the console. Allowed values: + train - Tracks the number of steps from the beginning of training until the full training run is complete (training.max_steps is reached). + eval - Tracks the number of steps between the previous and next evaluation (training.eval_frequency is reached). console_output (bool): Whether the logger should print the logs on the console. output_file (Optional[Union[str, Path]]): The file to save the training logs to. """ @@ -70,6 +92,7 @@ def console_logger( for name, proc in nlp.pipeline if hasattr(proc, "is_trainable") and proc.is_trainable ] + max_steps = nlp.config["training"]["max_steps"] eval_frequency = nlp.config["training"]["eval_frequency"] score_weights = nlp.config["training"]["score_weights"] score_cols = [col for col, value in score_weights.items() if value is not None] @@ -84,6 +107,13 @@ def console_logger( write(msg.row(table_header, widths=table_widths, spacing=spacing)) write(msg.row(["-" * width for width in table_widths], spacing=spacing)) progress = None + expected_progress_types = ("train", "eval") + if progress_bar is not None and progress_bar not in expected_progress_types: + raise ValueError( + Errors.E1048.format( + unexpected=progress_bar, expected=expected_progress_types + ) + ) def log_step(info: Optional[Dict[str, Any]]) -> None: nonlocal progress @@ -141,11 +171,23 @@ def console_logger( ) ) if progress_bar: + if progress_bar == "train": + total = max_steps + desc = f"Last Eval Epoch: {info['epoch']}" + initial = info["step"] + else: + total = eval_frequency + desc = f"Epoch {info['epoch']+1}" + initial = 0 # Set disable=None, so that it disables on non-TTY progress = tqdm.tqdm( - total=eval_frequency, disable=None, leave=False, file=stderr + total=total, + disable=None, + leave=False, + file=stderr, + initial=initial, ) - progress.set_description(f"Epoch {info['epoch']+1}") + progress.set_description(desc) def finalize() -> None: if output_stream: diff --git a/website/docs/api/top-level.md b/website/docs/api/top-level.md index 26a5d42f4..883c5e3b9 100644 --- a/website/docs/api/top-level.md +++ b/website/docs/api/top-level.md @@ -513,7 +513,7 @@ a [Weights & Biases](https://www.wandb.com/) dashboard. Instead of using one of the built-in loggers, you can [implement your own](/usage/training#custom-logging). -#### spacy.ConsoleLogger.v2 {#ConsoleLogger tag="registered function"} +#### spacy.ConsoleLogger.v2 {tag="registered function"} > #### Example config > @@ -564,11 +564,33 @@ start decreasing across epochs. -| Name | Description | -| ---------------- | --------------------------------------------------------------------- | -| `progress_bar` | Whether the logger should print the progress bar ~~bool~~ | -| `console_output` | Whether the logger should print the logs on the console. ~~bool~~ | -| `output_file` | The file to save the training logs to. ~~Optional[Union[str, Path]]~~ | +| Name | Description | +| ---------------- | ---------------------------------------------------------------------------------------------------------------------------- | +| `progress_bar` | Whether the logger should print a progress bar tracking the steps till the next evaluation pass (default: `False`). ~~bool~~ | +| `console_output` | Whether the logger should print the logs in the console (default: `True`). ~~bool~~ | +| `output_file` | The file to save the training logs to (default: `None`). ~~Optional[Union[str, Path]]~~ | + +#### spacy.ConsoleLogger.v3 {#ConsoleLogger tag="registered function"} + +> #### Example config +> +> ```ini +> [training.logger] +> @loggers = "spacy.ConsoleLogger.v3" +> progress_bar = "all_steps" +> console_output = true +> output_file = "training_log.jsonl" +> ``` + +Writes the results of a training step to the console in a tabular format and +optionally saves them to a `jsonl` file. + +| Name | Description | +| ---------------- | --------------------------------------------------------------------------------------------------------------------------------------------------------- | +| `progress_bar` | Type of progress bar to show in the console: `"train"`, `"eval"` or `None`. | +| | The bar tracks the number of steps until `training.max_steps` and `training.eval_frequency` are reached respectively (default: `None`). ~~Optional[str]~~ | +| `console_output` | Whether the logger should print the logs in the console (default: `True`). ~~bool~~ | +| `output_file` | The file to save the training logs to (default: `None`). ~~Optional[Union[str, Path]]~~ | ## Readers {#readers} From 933b54ac798a7d64f9cde4d85b55556e84e44bd6 Mon Sep 17 00:00:00 2001 From: kadarakos Date: Mon, 26 Dec 2022 13:26:35 +0100 Subject: [PATCH 153/161] typo fix (#11995) --- spacy/pipeline/span_ruler.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/pipeline/span_ruler.py b/spacy/pipeline/span_ruler.py index 807a4ffe5..0e7e9ebf7 100644 --- a/spacy/pipeline/span_ruler.py +++ b/spacy/pipeline/span_ruler.py @@ -170,7 +170,7 @@ def prioritize_existing_ents_filter( @registry.misc("spacy.prioritize_existing_ents_filter.v1") -def make_preverse_existing_ents_filter(): +def make_preserve_existing_ents_filter(): return prioritize_existing_ents_filter From 20b63943f50b9ca5cc888cee4060f317cda9e5f3 Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Dani=C3=ABl=20de=20Kok?= Date: Thu, 29 Dec 2022 08:03:24 +0100 Subject: [PATCH 154/161] Adjust to new `Schedule` class and pass scores to `Optimizer` (#12008) * Adjust to new `Schedule` class and pass scores to `Optimizer` Requires https://github.com/explosion/thinc/pull/804 * Bump minimum Thinc requirement to 9.0.0.dev1 --- pyproject.toml | 2 +- requirements.txt | 2 +- setup.cfg | 2 +- spacy/training/batchers.py | 26 ++++++++++++++++---------- spacy/training/loop.py | 3 ++- spacy/util.py | 8 ++++---- 6 files changed, 25 insertions(+), 18 deletions(-) diff --git a/pyproject.toml b/pyproject.toml index 4b0da39b9..72f04dee3 100644 --- a/pyproject.toml +++ b/pyproject.toml @@ -5,7 +5,7 @@ requires = [ "cymem>=2.0.2,<2.1.0", "preshed>=3.0.2,<3.1.0", "murmurhash>=0.28.0,<1.1.0", - "thinc>=9.0.0.dev0,<9.1.0", + "thinc>=9.0.0.dev1,<9.1.0", "numpy>=1.15.0", ] build-backend = "setuptools.build_meta" diff --git a/requirements.txt b/requirements.txt index 2bf16ec2b..02479f946 100644 --- a/requirements.txt +++ b/requirements.txt @@ -3,7 +3,7 @@ spacy-legacy>=3.0.10,<3.1.0 spacy-loggers>=1.0.0,<2.0.0 cymem>=2.0.2,<2.1.0 preshed>=3.0.2,<3.1.0 -thinc>=9.0.0.dev0,<9.1.0 +thinc>=9.0.0.dev1,<9.1.0 ml_datasets>=0.2.0,<0.3.0 murmurhash>=0.28.0,<1.1.0 wasabi>=0.9.1,<1.2.0 diff --git a/setup.cfg b/setup.cfg index 5158a1086..4a8c350cd 100644 --- a/setup.cfg +++ b/setup.cfg @@ -38,7 +38,7 @@ install_requires = murmurhash>=0.28.0,<1.1.0 cymem>=2.0.2,<2.1.0 preshed>=3.0.2,<3.1.0 - thinc>=9.0.0.dev0,<9.1.0 + thinc>=9.0.0.dev1,<9.1.0 wasabi>=0.9.1,<1.2.0 srsly>=2.4.3,<3.0.0 catalogue>=2.0.6,<2.1.0 diff --git a/spacy/training/batchers.py b/spacy/training/batchers.py index f0b6c3123..73678c7fc 100644 --- a/spacy/training/batchers.py +++ b/spacy/training/batchers.py @@ -2,11 +2,12 @@ from typing import Union, Iterable, Sequence, TypeVar, List, Callable, Iterator from typing import Optional, Any from functools import partial import itertools +from thinc.schedules import Schedule, constant as constant_schedule from ..util import registry, minibatch -Sizing = Union[Sequence[int], int] +Sizing = Union[Sequence[int], int, Schedule[int]] ItemT = TypeVar("ItemT") BatcherT = Callable[[Iterable[ItemT]], Iterable[List[ItemT]]] @@ -111,12 +112,13 @@ def minibatch_by_padded_size( The `len` function is used by default. """ if isinstance(size, int): - size_ = itertools.repeat(size) # type: Iterator[int] + size_ = constant_schedule(size) else: - size_ = iter(size) - for outer_batch in minibatch(seqs, size=buffer): + assert isinstance(size, Schedule) + size_ = size + for step, outer_batch in enumerate(minibatch(seqs, size=buffer)): outer_batch = list(outer_batch) - target_size = next(size_) + target_size = size_(step) for indices in _batch_by_length(outer_batch, target_size, get_length): subbatch = [outer_batch[i] for i in indices] padded_size = max(len(seq) for seq in subbatch) * len(subbatch) @@ -147,10 +149,12 @@ def minibatch_by_words( item. The `len` function is used by default. """ if isinstance(size, int): - size_ = itertools.repeat(size) # type: Iterator[int] + size_ = constant_schedule(size) else: - size_ = iter(size) - target_size = next(size_) + assert isinstance(size, Schedule) + size_ = size + step = 0 + target_size = size_(step) tol_size = target_size * tolerance batch = [] overflow = [] @@ -175,7 +179,8 @@ def minibatch_by_words( else: if batch: yield batch - target_size = next(size_) + step += 1 + target_size = size_(step) tol_size = target_size * tolerance batch = overflow batch_size = overflow_size @@ -193,7 +198,8 @@ def minibatch_by_words( else: if batch: yield batch - target_size = next(size_) + step += 1 + target_size = size_(step) tol_size = target_size * tolerance batch = [seq] batch_size = n_words diff --git a/spacy/training/loop.py b/spacy/training/loop.py index 885257772..c93cba7a7 100644 --- a/spacy/training/loop.py +++ b/spacy/training/loop.py @@ -204,7 +204,7 @@ def train_while_improving( if before_update: before_update_args = {"step": step, "epoch": epoch} before_update(nlp, before_update_args) - dropout = next(dropouts) # type: ignore + dropout = dropouts(optimizer.step) # type: ignore for subbatch in subdivide_batch(batch, accumulate_gradient): nlp.update( subbatch, @@ -230,6 +230,7 @@ def train_while_improving( score, other_scores = evaluate() else: score, other_scores = evaluate() + optimizer.last_score = score results.append((score, step)) is_best_checkpoint = score == max(results)[0] else: diff --git a/spacy/util.py b/spacy/util.py index d674fb9ce..aafbbb5de 100644 --- a/spacy/util.py +++ b/spacy/util.py @@ -9,7 +9,7 @@ import re from pathlib import Path import thinc from thinc.api import NumpyOps, get_current_ops, Adam, Config, Optimizer -from thinc.api import ConfigValidationError, Model +from thinc.api import ConfigValidationError, Model, constant as constant_schedule import functools import itertools import numpy @@ -1582,12 +1582,12 @@ def minibatch(items, size): so that batch-size can vary on each step. """ if isinstance(size, int): - size_ = itertools.repeat(size) + size_ = constant_schedule(size) else: size_ = size items = iter(items) - while True: - batch_size = next(size_) + for step in itertools.count(): + batch_size = size_(step) batch = list(itertools.islice(items, int(batch_size))) if len(batch) == 0: break From ef9e504eacc806162666c964bd00d152fc15f9e3 Mon Sep 17 00:00:00 2001 From: Adriane Boyd Date: Thu, 29 Dec 2022 14:01:08 +0100 Subject: [PATCH 155/161] Rename modified textcat scorer to v2 (#11971) As a follow-up to #11696, rename the modified scorer to v2 and move the v1 scorer to `spacy-legacy`. --- requirements.txt | 2 +- setup.cfg | 2 +- spacy/pipeline/textcat.py | 4 ++-- spacy/tests/pipeline/test_textcat.py | 17 +++++++++++++++++ 4 files changed, 21 insertions(+), 4 deletions(-) diff --git a/requirements.txt b/requirements.txt index 0440835f2..5bc1c8684 100644 --- a/requirements.txt +++ b/requirements.txt @@ -1,5 +1,5 @@ # Our libraries -spacy-legacy>=3.0.10,<3.1.0 +spacy-legacy>=3.0.11,<3.1.0 spacy-loggers>=1.0.0,<2.0.0 cymem>=2.0.2,<2.1.0 preshed>=3.0.2,<3.1.0 diff --git a/setup.cfg b/setup.cfg index d290d706c..cee8c0c33 100644 --- a/setup.cfg +++ b/setup.cfg @@ -42,7 +42,7 @@ setup_requires = thinc>=8.1.0,<8.2.0 install_requires = # Our libraries - spacy-legacy>=3.0.10,<3.1.0 + spacy-legacy>=3.0.11,<3.1.0 spacy-loggers>=1.0.0,<2.0.0 murmurhash>=0.28.0,<1.1.0 cymem>=2.0.2,<2.1.0 diff --git a/spacy/pipeline/textcat.py b/spacy/pipeline/textcat.py index 65121114d..650a01949 100644 --- a/spacy/pipeline/textcat.py +++ b/spacy/pipeline/textcat.py @@ -74,7 +74,7 @@ subword_features = true default_config={ "threshold": 0.0, "model": DEFAULT_SINGLE_TEXTCAT_MODEL, - "scorer": {"@scorers": "spacy.textcat_scorer.v1"}, + "scorer": {"@scorers": "spacy.textcat_scorer.v2"}, }, default_score_weights={ "cats_score": 1.0, @@ -117,7 +117,7 @@ def textcat_score(examples: Iterable[Example], **kwargs) -> Dict[str, Any]: ) -@registry.scorers("spacy.textcat_scorer.v1") +@registry.scorers("spacy.textcat_scorer.v2") def make_textcat_scorer(): return textcat_score diff --git a/spacy/tests/pipeline/test_textcat.py b/spacy/tests/pipeline/test_textcat.py index 155ce99a2..eafe4c128 100644 --- a/spacy/tests/pipeline/test_textcat.py +++ b/spacy/tests/pipeline/test_textcat.py @@ -895,3 +895,20 @@ def test_textcat_multi_threshold(): scores = nlp.evaluate(train_examples, scorer_cfg={"threshold": 0}) assert scores["cats_f_per_type"]["POSITIVE"]["r"] == 1.0 + + +@pytest.mark.parametrize("component_name,scorer", [("textcat", "spacy.textcat_scorer.v1")]) +def test_textcat_legacy_scorers(component_name, scorer): + """Check that legacy scorers are registered and produce the expected score + keys.""" + nlp = English() + nlp.add_pipe(component_name, config={"scorer": {"@scorers": scorer}}) + + train_examples = [] + for text, annotations in TRAIN_DATA_SINGLE_LABEL: + train_examples.append(Example.from_dict(nlp.make_doc(text), annotations)) + nlp.initialize(get_examples=lambda: train_examples) + + # score the model (it's not actually trained but that doesn't matter) + scores = nlp.evaluate(train_examples) + assert 0 <= scores["cats_score"] <= 1 From abb0ab109d33d2deaa6155a61fad649a25472f9c Mon Sep 17 00:00:00 2001 From: "github-actions[bot]" <41898282+github-actions[bot]@users.noreply.github.com> Date: Mon, 2 Jan 2023 11:59:57 +0100 Subject: [PATCH 156/161] Auto-format code with black (#12035) Co-authored-by: explosion-bot --- spacy/tests/pipeline/test_textcat.py | 4 +++- 1 file changed, 3 insertions(+), 1 deletion(-) diff --git a/spacy/tests/pipeline/test_textcat.py b/spacy/tests/pipeline/test_textcat.py index eafe4c128..048586cec 100644 --- a/spacy/tests/pipeline/test_textcat.py +++ b/spacy/tests/pipeline/test_textcat.py @@ -897,7 +897,9 @@ def test_textcat_multi_threshold(): assert scores["cats_f_per_type"]["POSITIVE"]["r"] == 1.0 -@pytest.mark.parametrize("component_name,scorer", [("textcat", "spacy.textcat_scorer.v1")]) +@pytest.mark.parametrize( + "component_name,scorer", [("textcat", "spacy.textcat_scorer.v1")] +) def test_textcat_legacy_scorers(component_name, scorer): """Check that legacy scorers are registered and produce the expected score keys.""" From 31c1beba787446059de58a1478e6aec197fd0bbb Mon Sep 17 00:00:00 2001 From: Wannaphong Phatthiyaphaibun Date: Tue, 3 Jan 2023 15:03:59 +0700 Subject: [PATCH 157/161] Add spacy-pythainlp (#12038) * Add spacy-pythainlp * Move submission to right section * Minor cleanup * Remove extra list call * Update universe.json Co-authored-by: Paul O'Leary McCann --- website/meta/universe.json | 27 +++++++++++++++++++++++++++ 1 file changed, 27 insertions(+) diff --git a/website/meta/universe.json b/website/meta/universe.json index db533c3b2..99d121507 100644 --- a/website/meta/universe.json +++ b/website/meta/universe.json @@ -4062,6 +4062,33 @@ "author_links": { "github": "yasufumy" } + }, + { + "id": "spacy-pythainlp", + "title": "spaCy-PyThaiNLP", + "slogan": "PyThaiNLP for spaCy", + "description": "This package wraps the PyThaiNLP library to add support for Thai to spaCy.", + "github": "PyThaiNLP/spaCy-PyThaiNLP", + "code_example": [ + "import spacy", + "import spacy_pythainlp.core", + "", + "nlp = spacy.blank('th')", + "nlp.add_pipe('pythainlp')", + "doc = nlp('ผมเป็นคนไทย แต่มะลิอยากไปโรงเรียนส่วนผมจะไปไหน ผมอยากไปเที่ยว')", + "", + "print(list(doc.sents))", + "# output: [ผมเป็นคนไทย แต่มะลิอยากไปโรงเรียนส่วนผมจะไปไหน , ผมอยากไปเที่ยว]" + ], + "code_language": "python", + "author": "Wannaphong Phatthiyaphaibun", + "author_links": { + "twitter": "@wannaphong_p", + "github": "wannaphong", + "website": "https://iam.wannaphong.com/" + }, + "category": ["pipeline", "research"], + "tags": ["Thai"] } ], From b510fbd0aacfdb96bbb0f25d3cb5960ce74d1a92 Mon Sep 17 00:00:00 2001 From: Tetsuo Kiso Date: Wed, 4 Jan 2023 01:43:09 +0900 Subject: [PATCH 158/161] Delete unused imports for StringStore (#12040) --- spacy/lexeme.pxd | 1 - spacy/tokenizer.pxd | 1 - 2 files changed, 2 deletions(-) diff --git a/spacy/lexeme.pxd b/spacy/lexeme.pxd index 8dea0d6a2..2d14edcd6 100644 --- a/spacy/lexeme.pxd +++ b/spacy/lexeme.pxd @@ -5,7 +5,6 @@ from .attrs cimport attr_id_t from .attrs cimport ID, ORTH, LOWER, NORM, SHAPE, PREFIX, SUFFIX, LENGTH, LANG from .structs cimport LexemeC -from .strings cimport StringStore from .vocab cimport Vocab diff --git a/spacy/tokenizer.pxd b/spacy/tokenizer.pxd index 86e62ddbf..6f9dfc90f 100644 --- a/spacy/tokenizer.pxd +++ b/spacy/tokenizer.pxd @@ -4,7 +4,6 @@ from cymem.cymem cimport Pool from .typedefs cimport hash_t from .structs cimport LexemeC, SpanC, TokenC -from .strings cimport StringStore from .tokens.doc cimport Doc from .vocab cimport Vocab, LexemesOrTokens, _Cached from .matcher.phrasematcher cimport PhraseMatcher From a231bf65af99c8e71212f59fcd7df350dd01597c Mon Sep 17 00:00:00 2001 From: Madeesh Kannan Date: Mon, 9 Jan 2023 20:15:02 +0100 Subject: [PATCH 159/161] Pass `step=0` to `Schedule` class to yield initial learning rate (#12078) --- spacy/training/loop.py | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/training/loop.py b/spacy/training/loop.py index c93cba7a7..fc929816d 100644 --- a/spacy/training/loop.py +++ b/spacy/training/loop.py @@ -100,7 +100,7 @@ def train( stdout.write( msg.info(f"Set annotations on update for: {annotating_components}") + "\n" ) - stdout.write(msg.info(f"Initial learn rate: {optimizer.learn_rate}") + "\n") + stdout.write(msg.info(f"Initial learn rate: {optimizer.learn_rate(step=0)}") + "\n") with nlp.select_pipes(disable=frozen_components): log_step, finalize_logger = train_logger(nlp, stdout, stderr) try: From 5fd419caf89aba7595a8cc0e0c65ffbe2788a79e Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Danie=CC=88l=20de=20Kok?= Date: Tue, 10 Jan 2023 19:26:47 +0100 Subject: [PATCH 160/161] Fix a rename that was missed in #10878. So that rehearsal tests pass. --- spacy/pipeline/_parser_internals/batch.pyx | 2 +- 1 file changed, 1 insertion(+), 1 deletion(-) diff --git a/spacy/pipeline/_parser_internals/batch.pyx b/spacy/pipeline/_parser_internals/batch.pyx index 93b8e08c1..91073b52e 100644 --- a/spacy/pipeline/_parser_internals/batch.pyx +++ b/spacy/pipeline/_parser_internals/batch.pyx @@ -33,7 +33,7 @@ class GreedyBatch(Batch): self._next_states = self._moves.transition_states(self._next_states, scores) def advance_with_actions(self, actions): - self._next_states = self._moves.apply_transitions(self._next_states, actions) + self._next_states = self._moves.apply_actions(self._next_states, actions) def get_states(self): return self._states From 8c3b6d0af40016cf32f0f373cdf1bbedd9babe9d Mon Sep 17 00:00:00 2001 From: =?UTF-8?q?Danie=CC=88l=20de=20Kok?= Date: Tue, 10 Jan 2023 20:31:06 +0100 Subject: [PATCH 161/161] Remove module from setup.py that got added during the merge --- setup.py | 1 - 1 file changed, 1 deletion(-) diff --git a/setup.py b/setup.py index f90c145b6..d5b82ec68 100755 --- a/setup.py +++ b/setup.py @@ -33,7 +33,6 @@ MOD_NAMES = [ "spacy.kb.candidate", "spacy.kb.kb", "spacy.kb.kb_in_memory", - "spacy.ml.parser_model", "spacy.ml.tb_framework", "spacy.morphology", "spacy.pipeline._edit_tree_internals.edit_trees",