Merge branch 'explosion:master' into rapidfuzz

This commit is contained in:
Kevin Humphreys 2022-10-17 14:59:16 -07:00 committed by GitHub
commit 920835e21e
No known key found for this signature in database
GPG Key ID: 4AEE18F83AFDEB23
45 changed files with 1318 additions and 146 deletions

View File

@ -10,7 +10,7 @@ about: Use this template if you came across a bug or unexpected behaviour differ
<!-- Include a code example or the steps that led to the problem. Please try to be as specific as possible. -->
## Your Environment
<!-- Include details of your environment. If you're using spaCy 1.7+, you can also type `python -m spacy info --markdown` and copy-paste the result here.-->
<!-- Include details of your environment. You can also type `python -m spacy info --markdown` and copy-paste the result here.-->
* Operating System:
* Python Version Used:
* spaCy Version Used:

View File

@ -27,7 +27,7 @@ steps:
- script: python -m mypy spacy
displayName: 'Run mypy'
condition: ne(variables['python_version'], '3.10')
condition: ne(variables['python_version'], '3.6')
- task: DeleteFiles@1
inputs:

View File

@ -6,7 +6,7 @@ repos:
language_version: python3.7
additional_dependencies: ['click==8.0.4']
- repo: https://gitlab.com/pycqa/flake8
rev: 3.9.2
rev: 5.0.4
hooks:
- id: flake8
args:

View File

@ -31,7 +31,7 @@ jobs:
inputs:
versionSpec: "3.7"
- script: |
pip install flake8==3.9.2
pip install flake8==5.0.4
python -m flake8 spacy --count --select=E901,E999,F821,F822,F823,W605 --show-source --statistics
displayName: "flake8"

View File

@ -15,7 +15,7 @@ pathy>=0.3.5
numpy>=1.15.0
requests>=2.13.0,<3.0.0
tqdm>=4.38.0,<5.0.0
pydantic>=1.7.4,!=1.8,!=1.8.1,<1.10.0
pydantic>=1.7.4,!=1.8,!=1.8.1,<1.11.0
jinja2
langcodes>=3.2.0,<4.0.0
# Official Python utilities
@ -28,11 +28,12 @@ cython>=0.25,<3.0
pytest>=5.2.0,!=7.1.0
pytest-timeout>=1.3.0,<2.0.0
mock>=2.0.0,<3.0.0
flake8>=3.8.0,<3.10.0
flake8>=3.8.0,<6.0.0
hypothesis>=3.27.0,<7.0.0
mypy>=0.910,<0.970; platform_machine!='aarch64'
mypy>=0.980,<0.990; platform_machine != "aarch64" and python_version >= "3.7"
types-dataclasses>=0.1.3; python_version < "3.7"
types-mock>=0.1.1
types-setuptools>=57.0.0
types-requests
types-setuptools>=57.0.0
black>=22.0,<23.0

View File

@ -56,7 +56,7 @@ install_requires =
tqdm>=4.38.0,<5.0.0
numpy>=1.15.0
requests>=2.13.0,<3.0.0
pydantic>=1.7.4,!=1.8,!=1.8.1,<1.10.0
pydantic>=1.7.4,!=1.8,!=1.8.1,<1.11.0
jinja2
# Official Python utilities
setuptools

View File

@ -31,9 +31,9 @@ def load(
name: Union[str, Path],
*,
vocab: Union[Vocab, bool] = True,
disable: Union[str, Iterable[str]] = util.SimpleFrozenList(),
enable: Union[str, Iterable[str]] = util.SimpleFrozenList(),
exclude: Union[str, Iterable[str]] = util.SimpleFrozenList(),
disable: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES,
enable: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES,
exclude: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES,
config: Union[Dict[str, Any], Config] = util.SimpleFrozenDict(),
) -> Language:
"""Load a spaCy model from an installed package or a local path.

View File

@ -573,3 +573,12 @@ def setup_gpu(use_gpu: int, silent=None) -> None:
local_msg.info("Using CPU")
if gpu_is_available():
local_msg.info("To switch to GPU 0, use the option: --gpu-id 0")
def _format_number(number: Union[int, float], ndigits: int = 2) -> str:
"""Formats a number (float or int) rounding to `ndigits`, without truncating trailing 0s,
as happens with `round(number, ndigits)`"""
if isinstance(number, float):
return f"{number:.{ndigits}f}"
else:
return str(number)

View File

@ -9,7 +9,7 @@ import typer
import math
from ._util import app, Arg, Opt, show_validation_error, parse_config_overrides
from ._util import import_code, debug_cli
from ._util import import_code, debug_cli, _format_number
from ..training import Example, remove_bilu_prefix
from ..training.initialize import get_sourced_components
from ..schemas import ConfigSchemaTraining
@ -989,7 +989,8 @@ def _get_kl_divergence(p: Counter, q: Counter) -> float:
def _format_span_row(span_data: List[Dict], labels: List[str]) -> List[Any]:
"""Compile into one list for easier reporting"""
d = {
label: [label] + list(round(d[label], 2) for d in span_data) for label in labels
label: [label] + list(_format_number(d[label]) for d in span_data)
for label in labels
}
return list(d.values())
@ -1004,6 +1005,10 @@ def _get_span_characteristics(
label: _gmean(l)
for label, l in compiled_gold["spans_length"][spans_key].items()
}
spans_per_type = {
label: len(spans)
for label, spans in compiled_gold["spans_per_type"][spans_key].items()
}
min_lengths = [min(l) for l in compiled_gold["spans_length"][spans_key].values()]
max_lengths = [max(l) for l in compiled_gold["spans_length"][spans_key].values()]
@ -1031,6 +1036,7 @@ def _get_span_characteristics(
return {
"sd": span_distinctiveness,
"bd": sb_distinctiveness,
"spans_per_type": spans_per_type,
"lengths": span_length,
"min_length": min(min_lengths),
"max_length": max(max_lengths),
@ -1045,12 +1051,15 @@ def _get_span_characteristics(
def _print_span_characteristics(span_characteristics: Dict[str, Any]):
"""Print all span characteristics into a table"""
headers = ("Span Type", "Length", "SD", "BD")
headers = ("Span Type", "Length", "SD", "BD", "N")
# Wasabi has this at 30 by default, but we might have some long labels
max_col = max(30, max(len(label) for label in span_characteristics["labels"]))
# Prepare table data with all span characteristics
table_data = [
span_characteristics["lengths"],
span_characteristics["sd"],
span_characteristics["bd"],
span_characteristics["spans_per_type"],
]
table = _format_span_row(
span_data=table_data, labels=span_characteristics["labels"]
@ -1061,8 +1070,18 @@ def _print_span_characteristics(span_characteristics: Dict[str, Any]):
span_characteristics["avg_sd"],
span_characteristics["avg_bd"],
]
footer = ["Wgt. Average"] + [str(round(f, 2)) for f in footer_data]
msg.table(table, footer=footer, header=headers, divider=True)
footer = (
["Wgt. Average"] + ["{:.2f}".format(round(f, 2)) for f in footer_data] + ["-"]
)
msg.table(
table,
footer=footer,
header=headers,
divider=True,
aligns=["l"] + ["r"] * (len(footer_data) + 1),
max_col=max_col,
)
def _get_spans_length_freq_dist(

View File

@ -299,8 +299,8 @@ def get_meta(
}
nlp = util.load_model_from_path(Path(model_path))
meta.update(nlp.meta)
meta.update(existing_meta)
meta["spacy_version"] = util.get_minor_version_range(about.__version__)
meta.update(existing_meta)
meta["vectors"] = {
"width": nlp.vocab.vectors_length,
"vectors": len(nlp.vocab.vectors),

View File

@ -1,5 +1,8 @@
from typing import Optional, List, Dict, Sequence, Any, Iterable
from typing import Optional, List, Dict, Sequence, Any, Iterable, Tuple
import os.path
from pathlib import Path
import pkg_resources
from wasabi import msg
from wasabi.util import locale_escape
import sys
@ -71,6 +74,12 @@ def project_run(
commands = {cmd["name"]: cmd for cmd in config.get("commands", [])}
workflows = config.get("workflows", {})
validate_subcommand(list(commands.keys()), list(workflows.keys()), subcommand)
req_path = project_dir / "requirements.txt"
if config.get("check_requirements", True) and os.path.exists(req_path):
with req_path.open() as requirements_file:
_check_requirements([req.replace("\n", "") for req in requirements_file])
if subcommand in workflows:
msg.info(f"Running workflow '{subcommand}'")
for cmd in workflows[subcommand]:
@ -310,3 +319,32 @@ def get_fileinfo(project_dir: Path, paths: List[str]) -> List[Dict[str, Optional
md5 = get_checksum(file_path) if file_path.exists() else None
data.append({"path": path, "md5": md5})
return data
def _check_requirements(requirements: List[str]) -> Tuple[bool, bool]:
"""Checks whether requirements are installed and free of version conflicts.
requirements (List[str]): List of requirements.
RETURNS (Tuple[bool, bool]): Whether (1) any packages couldn't be imported, (2) any packages with version conflicts
exist.
"""
failed_pkgs_msgs: List[str] = []
conflicting_pkgs_msgs: List[str] = []
for req in requirements:
try:
pkg_resources.require(req)
except pkg_resources.DistributionNotFound as dnf:
failed_pkgs_msgs.append(dnf.report())
except pkg_resources.VersionConflict as vc:
conflicting_pkgs_msgs.append(vc.report())
if len(failed_pkgs_msgs) or len(conflicting_pkgs_msgs):
msg.warn(
title="Missing requirements or requirement conflicts detected. Make sure your Python environment is set up "
"correctly and you installed all requirements specified in your project's requirements.txt: "
)
for pgk_msg in failed_pkgs_msgs + conflicting_pkgs_msgs:
msg.text(pgk_msg)
return len(failed_pkgs_msgs) > 0, len(conflicting_pkgs_msgs) > 0

View File

@ -212,6 +212,8 @@ class Warnings(metaclass=ErrorsWithCodes):
W121 = ("Attempting to trace non-existent method '{method}' in pipe '{pipe}'")
W122 = ("Couldn't trace method '{method}' in pipe '{pipe}'. This can happen if the pipe class "
"is a Cython extension type.")
W123 = ("Argument {arg} with value {arg_value} is used instead of {config_value} as specified in the config. Be "
"aware that this might affect other components in your pipeline.")
class Errors(metaclass=ErrorsWithCodes):
@ -937,8 +939,9 @@ class Errors(metaclass=ErrorsWithCodes):
E1040 = ("Doc.from_json requires all tokens to have the same attributes. "
"Some tokens do not contain annotation for: {partial_attrs}")
E1041 = ("Expected a string, Doc, or bytes as input, but got: {type}")
E1042 = ("Function was called with `{arg1}`={arg1_values} and "
"`{arg2}`={arg2_values} but these arguments are conflicting.")
E1042 = ("`enable={enable}` and `disable={disable}` are inconsistent with each other.\nIf you only passed "
"one of `enable` or `disable`, the other argument is specified in your pipeline's configuration.\nIn that "
"case pass an empty list for the previously not specified argument to avoid this error.")
E1043 = ("Expected None or a value in range [{range_start}, {range_end}] for entity linker threshold, but got "
"{value}.")

View File

@ -23,7 +23,7 @@ class RussianLemmatizer(Lemmatizer):
overwrite: bool = False,
scorer: Optional[Callable] = lemmatizer_score,
) -> None:
if mode == "pymorphy2":
if mode in {"pymorphy2", "pymorphy2_lookup"}:
try:
from pymorphy2 import MorphAnalyzer
except ImportError:

View File

@ -18,7 +18,7 @@ class UkrainianLemmatizer(RussianLemmatizer):
overwrite: bool = False,
scorer: Optional[Callable] = lemmatizer_score,
) -> None:
if mode == "pymorphy2":
if mode in {"pymorphy2", "pymorphy2_lookup"}:
try:
from pymorphy2 import MorphAnalyzer
except ImportError:

View File

@ -1,4 +1,4 @@
from typing import Iterator, Optional, Any, Dict, Callable, Iterable, Collection
from typing import Iterator, Optional, Any, Dict, Callable, Iterable
from typing import Union, Tuple, List, Set, Pattern, Sequence
from typing import NoReturn, TYPE_CHECKING, TypeVar, cast, overload
@ -10,6 +10,7 @@ from contextlib import contextmanager
from copy import deepcopy
from pathlib import Path
import warnings
from thinc.api import get_current_ops, Config, CupyOps, Optimizer
import srsly
import multiprocessing as mp
@ -24,7 +25,7 @@ from .pipe_analysis import validate_attrs, analyze_pipes, print_pipe_analysis
from .training import Example, validate_examples
from .training.initialize import init_vocab, init_tok2vec
from .scorer import Scorer
from .util import registry, SimpleFrozenList, _pipe, raise_error
from .util import registry, SimpleFrozenList, _pipe, raise_error, _DEFAULT_EMPTY_PIPES
from .util import SimpleFrozenDict, combine_score_weights, CONFIG_SECTION_ORDER
from .util import warn_if_jupyter_cupy
from .lang.tokenizer_exceptions import URL_MATCH, BASE_EXCEPTIONS
@ -1698,9 +1699,9 @@ class Language:
config: Union[Dict[str, Any], Config] = {},
*,
vocab: Union[Vocab, bool] = True,
disable: Union[str, Iterable[str]] = SimpleFrozenList(),
enable: Union[str, Iterable[str]] = SimpleFrozenList(),
exclude: Union[str, Iterable[str]] = SimpleFrozenList(),
disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
meta: Dict[str, Any] = SimpleFrozenDict(),
auto_fill: bool = True,
validate: bool = True,
@ -1727,12 +1728,6 @@ class Language:
DOCS: https://spacy.io/api/language#from_config
"""
if isinstance(disable, str):
disable = [disable]
if isinstance(enable, str):
enable = [enable]
if isinstance(exclude, str):
exclude = [exclude]
if auto_fill:
config = Config(
cls.default_config, section_order=CONFIG_SECTION_ORDER
@ -1877,9 +1872,38 @@ class Language:
nlp.vocab.from_bytes(vocab_b)
# Resolve disabled/enabled settings.
if isinstance(disable, str):
disable = [disable]
if isinstance(enable, str):
enable = [enable]
if isinstance(exclude, str):
exclude = [exclude]
def fetch_pipes_status(value: Iterable[str], key: str) -> Iterable[str]:
"""Fetch value for `enable` or `disable` w.r.t. the specified config and passed arguments passed to
.load(). If both arguments and config specified values for this field, the passed arguments take precedence
and a warning is printed.
value (Iterable[str]): Passed value for `enable` or `disable`.
key (str): Key for field in config (either "enabled" or "disabled").
RETURN (Iterable[str]):
"""
# We assume that no argument was passed if the value is the specified default value.
if id(value) == id(_DEFAULT_EMPTY_PIPES):
return config["nlp"].get(key, [])
else:
if len(config["nlp"].get(key, [])):
warnings.warn(
Warnings.W123.format(
arg=key[:-1],
arg_value=value,
config_value=config["nlp"][key],
)
)
return value
disabled_pipes = cls._resolve_component_status(
[*config["nlp"]["disabled"], *disable],
[*config["nlp"].get("enabled", []), *enable],
fetch_pipes_status(disable, "disabled"),
fetch_pipes_status(enable, "enabled"),
config["nlp"]["pipeline"],
)
nlp._disabled = set(p for p in disabled_pipes if p not in exclude)
@ -2064,14 +2088,7 @@ class Language:
pipe_name for pipe_name in pipe_names if pipe_name not in enable
]
if disable and disable != to_disable:
raise ValueError(
Errors.E1042.format(
arg1="enable",
arg2="disable",
arg1_values=enable,
arg2_values=disable,
)
)
raise ValueError(Errors.E1042.format(enable=enable, disable=disable))
return tuple(to_disable)

View File

@ -1,7 +1,6 @@
from typing import cast, Any, Callable, Dict, Iterable, List, Optional
from typing import Sequence, Tuple, Union
from typing import Tuple
from collections import Counter
from copy import deepcopy
from itertools import islice
import numpy as np
@ -149,9 +148,7 @@ class EditTreeLemmatizer(TrainablePipe):
if not any(len(doc) for doc in docs):
# Handle cases where there are no tokens in any docs.
n_labels = len(self.cfg["labels"])
guesses: List[Ints2d] = [
self.model.ops.alloc((0, n_labels), dtype="i") for doc in docs
]
guesses: List[Ints2d] = [self.model.ops.alloc2i(0, n_labels) for _ in docs]
assert len(guesses) == n_docs
return guesses
scores = self.model.predict(docs)

View File

@ -1,6 +1,5 @@
import warnings
from typing import Optional, Union, List, Dict, Tuple, Iterable, Any, Callable, Sequence
from typing import cast
import warnings
from collections import defaultdict
from pathlib import Path
import srsly
@ -317,7 +316,7 @@ class EntityRuler(Pipe):
phrase_pattern["id"] = ent_id
phrase_patterns.append(phrase_pattern)
for entry in token_patterns + phrase_patterns: # type: ignore[operator]
label = entry["label"]
label = entry["label"] # type: ignore
if "id" in entry:
ent_label = label
label = self._create_label(label, entry["id"])

View File

@ -133,6 +133,9 @@ def make_spancat(
spans_key (str): Key of the doc.spans dict to save the spans under. During
initialization and training, the component will look for spans on the
reference document under the same key.
scorer (Optional[Callable]): The scoring method. Defaults to
Scorer.score_spans for the Doc.spans[spans_key] with overlapping
spans allowed.
threshold (float): Minimum probability to consider a prediction positive.
Spans with a positive prediction will be saved on the Doc. Defaults to
0.5.

View File

@ -96,8 +96,8 @@ def make_multilabel_textcat(
model: Model[List[Doc], List[Floats2d]],
threshold: float,
scorer: Optional[Callable],
) -> "TextCategorizer":
"""Create a TextCategorizer component. The text categorizer predicts categories
) -> "MultiLabel_TextCategorizer":
"""Create a MultiLabel_TextCategorizer component. The text categorizer predicts categories
over a whole document. It can learn one or more labels, and the labels are considered
to be non-mutually exclusive, which means that there can be zero or more labels
per doc).
@ -105,6 +105,7 @@ def make_multilabel_textcat(
model (Model[List[Doc], List[Floats2d]]): A model instance that predicts
scores for each category.
threshold (float): Cutoff to consider a prediction "positive".
scorer (Optional[Callable]): The scoring method.
"""
return MultiLabel_TextCategorizer(
nlp.vocab, model, name, threshold=threshold, scorer=scorer
@ -147,6 +148,7 @@ class MultiLabel_TextCategorizer(TextCategorizer):
name (str): The component instance name, used to add entries to the
losses during training.
threshold (float): Cutoff to consider a prediction "positive".
scorer (Optional[Callable]): The scoring method.
DOCS: https://spacy.io/api/textcategorizer#init
"""

View File

@ -187,12 +187,12 @@ class TokenPatternNumber(BaseModel):
IS_SUBSET: Optional[List[StrictInt]] = Field(None, alias="is_subset")
IS_SUPERSET: Optional[List[StrictInt]] = Field(None, alias="is_superset")
INTERSECTS: Optional[List[StrictInt]] = Field(None, alias="intersects")
EQ: Union[StrictInt, StrictFloat] = Field(None, alias="==")
NEQ: Union[StrictInt, StrictFloat] = Field(None, alias="!=")
GEQ: Union[StrictInt, StrictFloat] = Field(None, alias=">=")
LEQ: Union[StrictInt, StrictFloat] = Field(None, alias="<=")
GT: Union[StrictInt, StrictFloat] = Field(None, alias=">")
LT: Union[StrictInt, StrictFloat] = Field(None, alias="<")
EQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="==")
NEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="!=")
GEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias=">=")
LEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="<=")
GT: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias=">")
LT: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="<")
class Config:
extra = "forbid"
@ -436,7 +436,7 @@ class ProjectConfigAssetURL(BaseModel):
# fmt: off
dest: StrictStr = Field(..., title="Destination of downloaded asset")
url: Optional[StrictStr] = Field(None, title="URL of asset")
checksum: str = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
checksum: Optional[str] = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
description: StrictStr = Field("", title="Description of asset")
# fmt: on
@ -444,7 +444,7 @@ class ProjectConfigAssetURL(BaseModel):
class ProjectConfigAssetGit(BaseModel):
# fmt: off
git: ProjectConfigAssetGitItem = Field(..., title="Git repo information")
checksum: str = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
checksum: Optional[str] = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
description: Optional[StrictStr] = Field(None, title="Description of asset")
# fmt: on
@ -514,9 +514,9 @@ class DocJSONSchema(BaseModel):
None, title="Indices of sentences' start and end indices"
)
text: StrictStr = Field(..., title="Document text")
spans: Dict[StrictStr, List[Dict[StrictStr, Union[StrictStr, StrictInt]]]] = Field(
None, title="Span information - end/start indices, label, KB ID"
)
spans: Optional[
Dict[StrictStr, List[Dict[StrictStr, Union[StrictStr, StrictInt]]]]
] = Field(None, title="Span information - end/start indices, label, KB ID")
tokens: List[Dict[StrictStr, Union[StrictStr, StrictInt]]] = Field(
..., title="Token information - ID, start, annotations"
)

View File

@ -343,6 +343,14 @@ def ru_lemmatizer():
return get_lang_class("ru")().add_pipe("lemmatizer")
@pytest.fixture
def ru_lookup_lemmatizer():
pytest.importorskip("pymorphy2")
return get_lang_class("ru")().add_pipe(
"lemmatizer", config={"mode": "pymorphy2_lookup"}
)
@pytest.fixture(scope="session")
def sa_tokenizer():
return get_lang_class("sa")().tokenizer
@ -422,6 +430,15 @@ def uk_lemmatizer():
return get_lang_class("uk")().add_pipe("lemmatizer")
@pytest.fixture
def uk_lookup_lemmatizer():
pytest.importorskip("pymorphy2")
pytest.importorskip("pymorphy2_dicts_uk")
return get_lang_class("uk")().add_pipe(
"lemmatizer", config={"mode": "pymorphy2_lookup"}
)
@pytest.fixture(scope="session")
def ur_tokenizer():
return get_lang_class("ur")().tokenizer

View File

@ -82,6 +82,21 @@ def test_issue2396(en_vocab):
assert (span.get_lca_matrix() == matrix).all()
@pytest.mark.issue(11499)
def test_init_args_unmodified(en_vocab):
words = ["A", "sentence"]
ents = ["B-TYPE1", ""]
sent_starts = [True, False]
Doc(
vocab=en_vocab,
words=words,
ents=ents,
sent_starts=sent_starts,
)
assert ents == ["B-TYPE1", ""]
assert sent_starts == [True, False]
@pytest.mark.parametrize("text", ["-0.23", "+123,456", "±1"])
@pytest.mark.parametrize("lang_cls", [English, MultiLanguage])
@pytest.mark.issue(2782)

View File

@ -78,3 +78,17 @@ def test_ru_lemmatizer_punct(ru_lemmatizer):
assert ru_lemmatizer.pymorphy2_lemmatize(doc[0]) == ['"']
doc = Doc(ru_lemmatizer.vocab, words=["»"], pos=["PUNCT"])
assert ru_lemmatizer.pymorphy2_lemmatize(doc[0]) == ['"']
def test_ru_doc_lookup_lemmatization(ru_lookup_lemmatizer):
words = ["мама", "мыла", "раму"]
pos = ["NOUN", "VERB", "NOUN"]
morphs = [
"Animacy=Anim|Case=Nom|Gender=Fem|Number=Sing",
"Aspect=Imp|Gender=Fem|Mood=Ind|Number=Sing|Tense=Past|VerbForm=Fin|Voice=Act",
"Animacy=Anim|Case=Acc|Gender=Fem|Number=Sing",
]
doc = Doc(ru_lookup_lemmatizer.vocab, words=words, pos=pos, morphs=morphs)
doc = ru_lookup_lemmatizer(doc)
lemmas = [token.lemma_ for token in doc]
assert lemmas == ["мама", "мыла", "раму"]

View File

@ -9,3 +9,11 @@ def test_uk_lemmatizer(uk_lemmatizer):
"""Check that the default uk lemmatizer runs."""
doc = Doc(uk_lemmatizer.vocab, words=["a", "b", "c"])
uk_lemmatizer(doc)
assert [token.lemma for token in doc]
def test_uk_lookup_lemmatizer(uk_lookup_lemmatizer):
"""Check that the lookup uk lemmatizer runs."""
doc = Doc(uk_lookup_lemmatizer.vocab, words=["a", "b", "c"])
uk_lookup_lemmatizer(doc)
assert [token.lemma for token in doc]

View File

@ -28,8 +28,16 @@ from spacy.matcher import levenshtein
(4, "いあうう", "ううああ"),
(3, "いあいい", "ういああ"),
(3, "いいああ", "ううあう"),
(166,"TCTGGGCACGGATTCGTCAGATTCCATGTCCATATTTGAGGCTCTTGCAGGCAAAATTTGGGCATGTGAACTCCTTATAGTCCCCGTGC","ATATGGATTGGGGGCATTCAAAGATACGGTTTCCCTTTCTTCAGTTTCGCGCGGCGCACGTCCGGGTGCGAGCCAGTTCGTCTTACTCACATTGTCGACTTCACGAATCGCGCATGATGTGCTTAGCCTGTACTTACGAACGAACTTTCGGTCCAAATACATTCTATCAACACCGAGGTATCCGTGCCACACGCCGAAGCTCGACCGTGTTCGTTGAGAGGTGGAAATGGTAAAAGATGAACATAGTC"),
(111,"GGTTCGGCCGAATTCATAGAGCGTGGTAGTCGACGGTATCCCGCCTGGTAGGGGCCCCTTCTACCTAGCGGAAGTTTGTCAGTACTCTATAACACGAGGGCCTCTCACACCCTAGATCGTCCAGCCACTCGAAGATCGCAGCACCCTTACAGAAAGGCATTAATGTTTCTCCTAGCACTTGTGCAATGGTGAAGGAGTGATG","CGTAACACTTCGCGCTACTGGGCTGCAACGTCTTGGGCATACATGCAAGATTATCTAATGCAAGCTTGAGCCCCGCTTGCGGAATTTCCCTAATCGGGGTCCCTTCCTGTTACGATAAGGACGCGTGCACT"),
(
166,
"TCTGGGCACGGATTCGTCAGATTCCATGTCCATATTTGAGGCTCTTGCAGGCAAAATTTGGGCATGTGAACTCCTTATAGTCCCCGTGC",
"ATATGGATTGGGGGCATTCAAAGATACGGTTTCCCTTTCTTCAGTTTCGCGCGGCGCACGTCCGGGTGCGAGCCAGTTCGTCTTACTCACATTGTCGACTTCACGAATCGCGCATGATGTGCTTAGCCTGTACTTACGAACGAACTTTCGGTCCAAATACATTCTATCAACACCGAGGTATCCGTGCCACACGCCGAAGCTCGACCGTGTTCGTTGAGAGGTGGAAATGGTAAAAGATGAACATAGTC",
),
(
111,
"GGTTCGGCCGAATTCATAGAGCGTGGTAGTCGACGGTATCCCGCCTGGTAGGGGCCCCTTCTACCTAGCGGAAGTTTGTCAGTACTCTATAACACGAGGGCCTCTCACACCCTAGATCGTCCAGCCACTCGAAGATCGCAGCACCCTTACAGAAAGGCATTAATGTTTCTCCTAGCACTTGTGCAATGGTGAAGGAGTGATG",
"CGTAACACTTCGCGCTACTGGGCTGCAACGTCTTGGGCATACATGCAAGATTATCTAATGCAAGCTTGAGCCCCGCTTGCGGAATTTCCCTAATCGGGGTCCCTTCCTGTTACGATAAGGACGCGTGCACT",
),
],
)
def test_levenshtein(dist, a, b):

View File

@ -605,10 +605,35 @@ def test_update_with_annotates():
assert results[component] == ""
def test_load_disable_enable() -> None:
"""
Tests spacy.load() with dis-/enabling components.
"""
@pytest.mark.issue(11443)
def test_enable_disable_conflict_with_config():
"""Test conflict between enable/disable w.r.t. `nlp.disabled` set in the config."""
nlp = English()
nlp.add_pipe("tagger")
nlp.add_pipe("senter")
nlp.add_pipe("sentencizer")
with make_tempdir() as tmp_dir:
nlp.to_disk(tmp_dir)
# Expected to fail, as config and arguments conflict.
with pytest.raises(ValueError):
spacy.load(
tmp_dir, enable=["tagger"], config={"nlp": {"disabled": ["senter"]}}
)
# Expected to succeed without warning due to the lack of a conflicting config option.
spacy.load(tmp_dir, enable=["tagger"])
# Expected to succeed with a warning, as disable=[] should override the config setting.
with pytest.warns(UserWarning):
spacy.load(
tmp_dir,
enable=["tagger"],
disable=[],
config={"nlp": {"disabled": ["senter"]}},
)
def test_load_disable_enable():
"""Tests spacy.load() with dis-/enabling components."""
base_nlp = English()
for pipe in ("sentencizer", "tagger", "parser"):

View File

@ -404,10 +404,11 @@ def test_serialize_pipeline_disable_enable():
assert nlp3.component_names == ["ner", "tagger"]
with make_tempdir() as d:
nlp3.to_disk(d)
with pytest.warns(UserWarning):
nlp4 = spacy.load(d, disable=["ner"])
assert nlp4.pipe_names == []
assert nlp4.pipe_names == ["tagger"]
assert nlp4.component_names == ["ner", "tagger"]
assert nlp4.disabled == ["ner", "tagger"]
assert nlp4.disabled == ["ner"]
with make_tempdir() as d:
nlp.to_disk(d)
nlp5 = spacy.load(d, exclude=["tagger"])

View File

@ -31,7 +31,7 @@ def doc(nlp):
words = ["Sarah", "'s", "sister", "flew", "to", "Silicon", "Valley", "via", "London", "."]
tags = ["NNP", "POS", "NN", "VBD", "IN", "NNP", "NNP", "IN", "NNP", "."]
pos = ["PROPN", "PART", "NOUN", "VERB", "ADP", "PROPN", "PROPN", "ADP", "PROPN", "PUNCT"]
ents = ["B-PERSON", "I-PERSON", "O", "O", "O", "B-LOC", "I-LOC", "O", "B-GPE", "O"]
ents = ["B-PERSON", "I-PERSON", "O", "", "O", "B-LOC", "I-LOC", "O", "B-GPE", "O"]
cats = {"TRAVEL": 1.0, "BAKING": 0.0}
# fmt: on
doc = Doc(nlp.vocab, words=words, tags=tags, pos=pos, ents=ents)
@ -106,6 +106,7 @@ def test_lowercase_augmenter(nlp, doc):
assert [(e.start, e.end, e.label) for e in eg.reference.ents] == ents
for ref_ent, orig_ent in zip(eg.reference.ents, doc.ents):
assert ref_ent.text == orig_ent.text.lower()
assert [t.ent_iob for t in doc] == [t.ent_iob for t in eg.reference]
assert [t.pos_ for t in eg.reference] == [t.pos_ for t in doc]
# check that augmentation works when lowercasing leads to different
@ -166,7 +167,7 @@ def test_make_whitespace_variant(nlp):
lemmas = ["they", "fly", "to", "New", "York", "City", ".", "\n", "then", "they", "drive", "to", "Washington", ",", "D.C."]
heads = [1, 1, 1, 4, 5, 2, 1, 10, 10, 10, 10, 10, 11, 12, 12]
deps = ["nsubj", "ROOT", "prep", "compound", "compound", "pobj", "punct", "dep", "advmod", "nsubj", "ROOT", "prep", "pobj", "punct", "appos"]
ents = ["O", "O", "O", "B-GPE", "I-GPE", "I-GPE", "O", "O", "O", "O", "O", "O", "B-GPE", "O", "B-GPE"]
ents = ["O", "", "O", "B-GPE", "I-GPE", "I-GPE", "O", "O", "O", "O", "O", "O", "B-GPE", "O", "B-GPE"]
# fmt: on
doc = Doc(
nlp.vocab,
@ -215,6 +216,8 @@ def test_make_whitespace_variant(nlp):
assert mod_ex2.reference[j].head.i == j - 1
# entities are well-formed
assert len(doc.ents) == len(mod_ex.reference.ents)
# there is one token with missing entity information
assert any(t.ent_iob == 0 for t in mod_ex.reference)
for ent in mod_ex.reference.ents:
assert not ent[0].is_space
assert not ent[-1].is_space

View File

@ -72,7 +72,7 @@ class Doc:
lemmas: Optional[List[str]] = ...,
heads: Optional[List[int]] = ...,
deps: Optional[List[str]] = ...,
sent_starts: Optional[List[Union[bool, None]]] = ...,
sent_starts: Optional[List[Union[bool, int, None]]] = ...,
ents: Optional[List[str]] = ...,
) -> None: ...
@property

View File

@ -217,9 +217,9 @@ cdef class Doc:
head in the doc. Defaults to None.
deps (Optional[List[str]]): A list of unicode strings, of the same
length as words, to assign as token.dep. Defaults to None.
sent_starts (Optional[List[Union[bool, None]]]): A list of values, of
the same length as words, to assign as token.is_sent_start. Will be
overridden by heads if heads is provided. Defaults to None.
sent_starts (Optional[List[Union[bool, int, None]]]): A list of values,
of the same length as words, to assign as token.is_sent_start. Will
be overridden by heads if heads is provided. Defaults to None.
ents (Optional[List[str]]): A list of unicode strings, of the same
length as words, as IOB tags to assign as token.ent_iob and
token.ent_type. Defaults to None.
@ -285,6 +285,7 @@ cdef class Doc:
heads = [0] * len(deps)
if heads and not deps:
raise ValueError(Errors.E1017)
sent_starts = list(sent_starts) if sent_starts is not None else None
if sent_starts is not None:
for i in range(len(sent_starts)):
if sent_starts[i] is True:
@ -300,12 +301,11 @@ cdef class Doc:
ent_iobs = None
ent_types = None
if ents is not None:
ents = [ent if ent != "" else None for ent in ents]
iob_strings = Token.iob_strings()
# make valid IOB2 out of IOB1 or IOB2
for i, ent in enumerate(ents):
if ent is "":
ents[i] = None
elif ent is not None and not isinstance(ent, str):
if ent is not None and not isinstance(ent, str):
raise ValueError(Errors.E177.format(tag=ent))
if i < len(ents) - 1:
# OI -> OB

View File

@ -6,7 +6,7 @@ from functools import partial
from ..util import registry
from .example import Example
from .iob_utils import split_bilu_label
from .iob_utils import split_bilu_label, _doc_to_biluo_tags_with_partial
if TYPE_CHECKING:
from ..language import Language # noqa: F401
@ -62,6 +62,9 @@ def combined_augmenter(
if orth_variants and random.random() < orth_level:
raw_text = example.text
orig_dict = example.to_dict()
orig_dict["doc_annotation"]["entities"] = _doc_to_biluo_tags_with_partial(
example.reference
)
variant_text, variant_token_annot = make_orth_variants(
nlp,
raw_text,
@ -128,6 +131,9 @@ def lower_casing_augmenter(
def make_lowercase_variant(nlp: "Language", example: Example):
example_dict = example.to_dict()
example_dict["doc_annotation"]["entities"] = _doc_to_biluo_tags_with_partial(
example.reference
)
doc = nlp.make_doc(example.text.lower())
example_dict["token_annotation"]["ORTH"] = [t.lower_ for t in example.reference]
return example.from_dict(doc, example_dict)
@ -146,6 +152,9 @@ def orth_variants_augmenter(
else:
raw_text = example.text
orig_dict = example.to_dict()
orig_dict["doc_annotation"]["entities"] = _doc_to_biluo_tags_with_partial(
example.reference
)
variant_text, variant_token_annot = make_orth_variants(
nlp,
raw_text,
@ -248,6 +257,9 @@ def make_whitespace_variant(
RETURNS (Example): Example with one additional space token.
"""
example_dict = example.to_dict()
example_dict["doc_annotation"]["entities"] = _doc_to_biluo_tags_with_partial(
example.reference
)
doc_dict = example_dict.get("doc_annotation", {})
token_dict = example_dict.get("token_annotation", {})
# returned unmodified if:

View File

@ -60,6 +60,14 @@ def doc_to_biluo_tags(doc: Doc, missing: str = "O"):
)
def _doc_to_biluo_tags_with_partial(doc: Doc) -> List[str]:
ents = doc_to_biluo_tags(doc, missing="-")
for i, token in enumerate(doc):
if token.ent_iob == 2:
ents[i] = "O"
return ents
def offsets_to_biluo_tags(
doc: Doc, entities: Iterable[Tuple[int, int, Union[str, int]]], missing: str = "O"
) -> List[str]:

View File

@ -67,7 +67,6 @@ LEXEME_NORM_LANGS = ["cs", "da", "de", "el", "en", "id", "lb", "mk", "pt", "ru",
CONFIG_SECTION_ORDER = ["paths", "variables", "system", "nlp", "components", "corpora", "training", "pretraining", "initialize"]
# fmt: on
logger = logging.getLogger("spacy")
logger_stream_handler = logging.StreamHandler()
logger_stream_handler.setFormatter(
@ -394,13 +393,17 @@ def get_module_path(module: ModuleType) -> Path:
return file_path.parent
# Default value for passed enable/disable values.
_DEFAULT_EMPTY_PIPES = SimpleFrozenList()
def load_model(
name: Union[str, Path],
*,
vocab: Union["Vocab", bool] = True,
disable: Union[str, Iterable[str]] = SimpleFrozenList(),
enable: Union[str, Iterable[str]] = SimpleFrozenList(),
exclude: Union[str, Iterable[str]] = SimpleFrozenList(),
disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
config: Union[Dict[str, Any], Config] = SimpleFrozenDict(),
) -> "Language":
"""Load a model from a package or data path.
@ -470,9 +473,9 @@ def load_model_from_path(
*,
meta: Optional[Dict[str, Any]] = None,
vocab: Union["Vocab", bool] = True,
disable: Union[str, Iterable[str]] = SimpleFrozenList(),
enable: Union[str, Iterable[str]] = SimpleFrozenList(),
exclude: Union[str, Iterable[str]] = SimpleFrozenList(),
disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
config: Union[Dict[str, Any], Config] = SimpleFrozenDict(),
) -> "Language":
"""Load a model from a data directory path. Creates Language class with
@ -516,9 +519,9 @@ def load_model_from_config(
*,
meta: Dict[str, Any] = SimpleFrozenDict(),
vocab: Union["Vocab", bool] = True,
disable: Union[str, Iterable[str]] = SimpleFrozenList(),
enable: Union[str, Iterable[str]] = SimpleFrozenList(),
exclude: Union[str, Iterable[str]] = SimpleFrozenList(),
disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
auto_fill: bool = False,
validate: bool = True,
) -> "Language":

View File

@ -11,6 +11,7 @@ menu:
- ['Text Classification', 'textcat']
- ['Span Classification', 'spancat']
- ['Entity Linking', 'entitylinker']
- ['Coreference', 'coref-architectures']
---
A **model architecture** is a function that wires up a
@ -587,8 +588,8 @@ consists of either two or three subnetworks:
run once for each batch.
- **lower**: Construct a feature-specific vector for each `(token, feature)`
pair. This is also run once for each batch. Constructing the state
representation is then a matter of summing the component features and
applying the non-linearity.
representation is then a matter of summing the component features and applying
the non-linearity.
- **upper** (optional): A feed-forward network that predicts scores from the
state representation. If not present, the output from the lower model is used
as action scores directly.
@ -628,8 +629,8 @@ same signature, but the `use_upper` argument was `True` by default.
> ```
Build a tagger model, using a provided token-to-vector component. The tagger
model adds a linear layer with softmax activation to predict scores given
the token vectors.
model adds a linear layer with softmax activation to predict scores given the
token vectors.
| Name | Description |
| ----------- | ------------------------------------------------------------------------------------------ |
@ -920,5 +921,84 @@ A function that reads an existing `KnowledgeBase` from file.
A function that takes as input a [`KnowledgeBase`](/api/kb) and a
[`Span`](/api/span) object denoting a named entity, and returns a list of
plausible [`Candidate`](/api/kb/#candidate) objects. The default
`CandidateGenerator` uses the text of a mention to find its potential
aliases in the `KnowledgeBase`. Note that this function is case-dependent.
`CandidateGenerator` uses the text of a mention to find its potential aliases in
the `KnowledgeBase`. Note that this function is case-dependent.
## Coreference {#coref-architectures tag="experimental"}
A [`CoreferenceResolver`](/api/coref) component identifies tokens that refer to
the same entity. A [`SpanResolver`](/api/span-resolver) component infers spans
from single tokens. Together these components can be used to reproduce
traditional coreference models. You can also omit the `SpanResolver` if working
with only token-level clusters is acceptable.
### spacy-experimental.Coref.v1 {#Coref tag="experimental"}
> #### Example Config
>
> ```ini
>
> [model]
> @architectures = "spacy-experimental.Coref.v1"
> distance_embedding_size = 20
> dropout = 0.3
> hidden_size = 1024
> depth = 2
> antecedent_limit = 50
> antecedent_batch_size = 512
>
> [model.tok2vec]
> @architectures = "spacy-transformers.TransformerListener.v1"
> grad_factor = 1.0
> upstream = "transformer"
> pooling = {"@layers":"reduce_mean.v1"}
> ```
The `Coref` model architecture is a Thinc `Model`.
| Name | Description |
| ------------------------- | ---------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| `tok2vec` | The [`tok2vec`](#tok2vec) layer of the model. ~~Model~~ |
| `distance_embedding_size` | A representation of the distance between candidates. ~~int~~ |
| `dropout` | The dropout to use internally. Unlike some Thinc models, this has separate dropout for the internal PyTorch layers. ~~float~~ |
| `hidden_size` | Size of the main internal layers. ~~int~~ |
| `depth` | Depth of the internal network. ~~int~~ |
| `antecedent_limit` | How many candidate antecedents to keep after rough scoring. This has a significant effect on memory usage. Typical values would be 50 to 200, or higher for very long documents. ~~int~~ |
| `antecedent_batch_size` | Internal batch size. ~~int~~ |
| **CREATES** | The model using the architecture. ~~Model[List[Doc], Floats2d]~~ |
### spacy-experimental.SpanResolver.v1 {#SpanResolver tag="experimental"}
> #### Example Config
>
> ```ini
>
> [model]
> @architectures = "spacy-experimental.SpanResolver.v1"
> hidden_size = 1024
> distance_embedding_size = 64
> conv_channels = 4
> window_size = 1
> max_distance = 128
> prefix = "coref_head_clusters"
>
> [model.tok2vec]
> @architectures = "spacy-transformers.TransformerListener.v1"
> grad_factor = 1.0
> upstream = "transformer"
> pooling = {"@layers":"reduce_mean.v1"}
> ```
The `SpanResolver` model architecture is a Thinc `Model`. Note that
`MentionClusters` is `List[List[Tuple[int, int]]]`.
| Name | Description |
| ------------------------- | -------------------------------------------------------------------------------------------------------------------- |
| `tok2vec` | The [`tok2vec`](#tok2vec) layer of the model. ~~Model~~ |
| `hidden_size` | Size of the main internal layers. ~~int~~ |
| `distance_embedding_size` | A representation of the distance between two candidates. ~~int~~ |
| `conv_channels` | The number of channels in the internal CNN. ~~int~~ |
| `window_size` | The number of neighboring tokens to consider in the internal CNN. `1` means consider one token on each side. ~~int~~ |
| `max_distance` | The longest possible length of a predicted span. ~~int~~ |
| `prefix` | The prefix that indicates spans to use for input data. ~~string~~ |
| **CREATES** | The model using the architecture. ~~Model[List[Doc], List[MentionClusters]]~~ |

353
website/docs/api/coref.md Normal file
View File

@ -0,0 +1,353 @@
---
title: CoreferenceResolver
tag: class,experimental
source: spacy-experimental/coref/coref_component.py
teaser: 'Pipeline component for word-level coreference resolution'
api_base_class: /api/pipe
api_string_name: coref
api_trainable: true
---
> #### Installation
>
> ```bash
> $ pip install -U spacy-experimental
> ```
<Infobox title="Important note" variant="warning">
This component is not yet integrated into spaCy core, and is available via the
extension package
[`spacy-experimental`](https://github.com/explosion/spacy-experimental) starting
in version 0.6.0. It exposes the component via
[entry points](/usage/saving-loading/#entry-points), so if you have the package
installed, using `factory = "experimental_coref"` in your
[training config](/usage/training#config) or
`nlp.add_pipe("experimental_coref")` will work out-of-the-box.
</Infobox>
A `CoreferenceResolver` component groups tokens into clusters that refer to the
same thing. Clusters are represented as SpanGroups that start with a prefix
(`coref_clusters` by default).
A `CoreferenceResolver` component can be paired with a
[`SpanResolver`](/api/span-resolver) to expand single tokens to spans.
## Assigned Attributes {#assigned-attributes}
Predictions will be saved to `Doc.spans` as a [`SpanGroup`](/api/spangroup). The
span key will be a prefix plus a serial number referring to the coreference
cluster, starting from zero.
The span key prefix defaults to `"coref_clusters"`, but can be passed as a
parameter.
| Location | Value |
| ------------------------------------------ | ------------------------------------------------------------------------------------------------------- |
| `Doc.spans[prefix + "_" + cluster_number]` | One coreference cluster, represented as single-token spans. Cluster numbers start from 1. ~~SpanGroup~~ |
## Config and implementation {#config}
The default config is defined by the pipeline component factory and describes
how the component should be configured. You can override its settings via the
`config` argument on [`nlp.add_pipe`](/api/language#add_pipe) or in your
[`config.cfg` for training](/usage/training#config). See the
[model architectures](/api/architectures#coref-architectures) documentation for
details on the architectures and their arguments and hyperparameters.
> #### Example
>
> ```python
> from spacy_experimental.coref.coref_component import DEFAULT_COREF_MODEL
> from spacy_experimental.coref.coref_util import DEFAULT_CLUSTER_PREFIX
> config={
> "model": DEFAULT_COREF_MODEL,
> "span_cluster_prefix": DEFAULT_CLUSTER_PREFIX,
> },
> nlp.add_pipe("experimental_coref", config=config)
> ```
| Setting | Description |
| --------------------- | ---------------------------------------------------------------------------------------------------------------------------------------- |
| `model` | The [`Model`](https://thinc.ai/docs/api-model) powering the pipeline component. Defaults to [Coref](/api/architectures#Coref). ~~Model~~ |
| `span_cluster_prefix` | The prefix for the keys for clusters saved to `doc.spans`. Defaults to `coref_clusters`. ~~str~~ |
## CoreferenceResolver.\_\_init\_\_ {#init tag="method"}
> #### Example
>
> ```python
> # Construction via add_pipe with default model
> coref = nlp.add_pipe("experimental_coref")
>
> # Construction via add_pipe with custom model
> config = {"model": {"@architectures": "my_coref.v1"}}
> coref = nlp.add_pipe("experimental_coref", config=config)
>
> # Construction from class
> from spacy_experimental.coref.coref_component import CoreferenceResolver
> coref = CoreferenceResolver(nlp.vocab, model)
> ```
Create a new pipeline instance. In your application, you would normally use a
shortcut for this and instantiate the component using its string name and
[`nlp.add_pipe`](/api/language#add_pipe).
| Name | Description |
| --------------------- | --------------------------------------------------------------------------------------------------- |
| `vocab` | The shared vocabulary. ~~Vocab~~ |
| `model` | The [`Model`](https://thinc.ai/docs/api-model) powering the pipeline component. ~~Model~~ |
| `name` | String name of the component instance. Used to add entries to the `losses` during training. ~~str~~ |
| _keyword-only_ | |
| `span_cluster_prefix` | The prefix for the key for saving clusters of spans. ~~bool~~ |
## CoreferenceResolver.\_\_call\_\_ {#call tag="method"}
Apply the pipe to one document. The document is modified in place and returned.
This usually happens under the hood when the `nlp` object is called on a text
and all pipeline components are applied to the `Doc` in order. Both
[`__call__`](/api/coref#call) and [`pipe`](/api/coref#pipe) delegate to the
[`predict`](/api/coref#predict) and
[`set_annotations`](/api/coref#set_annotations) methods.
> #### Example
>
> ```python
> doc = nlp("This is a sentence.")
> coref = nlp.add_pipe("experimental_coref")
> # This usually happens under the hood
> processed = coref(doc)
> ```
| Name | Description |
| ----------- | -------------------------------- |
| `doc` | The document to process. ~~Doc~~ |
| **RETURNS** | The processed document. ~~Doc~~ |
## CoreferenceResolver.pipe {#pipe tag="method"}
Apply the pipe to a stream of documents. This usually happens under the hood
when the `nlp` object is called on a text and all pipeline components are
applied to the `Doc` in order. Both [`__call__`](/api/coref#call) and
[`pipe`](/api/coref#pipe) delegate to the [`predict`](/api/coref#predict) and
[`set_annotations`](/api/coref#set_annotations) methods.
> #### Example
>
> ```python
> coref = nlp.add_pipe("experimental_coref")
> for doc in coref.pipe(docs, batch_size=50):
> pass
> ```
| Name | Description |
| -------------- | ------------------------------------------------------------- |
| `stream` | A stream of documents. ~~Iterable[Doc]~~ |
| _keyword-only_ | |
| `batch_size` | The number of documents to buffer. Defaults to `128`. ~~int~~ |
| **YIELDS** | The processed documents in order. ~~Doc~~ |
## CoreferenceResolver.initialize {#initialize tag="method"}
Initialize the component for training. `get_examples` should be a function that
returns an iterable of [`Example`](/api/example) objects. **At least one example
should be supplied.** The data examples are used to **initialize the model** of
the component and can either be the full training data or a representative
sample. Initialization includes validating the network,
[inferring missing shapes](https://thinc.ai/docs/usage-models#validation) and
setting up the label scheme based on the data. This method is typically called
by [`Language.initialize`](/api/language#initialize).
> #### Example
>
> ```python
> coref = nlp.add_pipe("experimental_coref")
> coref.initialize(lambda: examples, nlp=nlp)
> ```
| Name | Description |
| -------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| `get_examples` | Function that returns gold-standard annotations in the form of [`Example`](/api/example) objects. Must contain at least one `Example`. ~~Callable[[], Iterable[Example]]~~ |
| _keyword-only_ | |
| `nlp` | The current `nlp` object. Defaults to `None`. ~~Optional[Language]~~ |
## CoreferenceResolver.predict {#predict tag="method"}
Apply the component's model to a batch of [`Doc`](/api/doc) objects, without
modifying them. Clusters are returned as a list of `MentionClusters`, one for
each input `Doc`. A `MentionClusters` instance is just a list of lists of pairs
of `int`s, where each item corresponds to a cluster, and the `int`s correspond
to token indices.
> #### Example
>
> ```python
> coref = nlp.add_pipe("experimental_coref")
> clusters = coref.predict([doc1, doc2])
> ```
| Name | Description |
| ----------- | ---------------------------------------------------------------------------- |
| `docs` | The documents to predict. ~~Iterable[Doc]~~ |
| **RETURNS** | The predicted coreference clusters for the `docs`. ~~List[MentionClusters]~~ |
## CoreferenceResolver.set_annotations {#set_annotations tag="method"}
Modify a batch of documents, saving coreference clusters in `Doc.spans`.
> #### Example
>
> ```python
> coref = nlp.add_pipe("experimental_coref")
> clusters = coref.predict([doc1, doc2])
> coref.set_annotations([doc1, doc2], clusters)
> ```
| Name | Description |
| ---------- | ---------------------------------------------------------------------------- |
| `docs` | The documents to modify. ~~Iterable[Doc]~~ |
| `clusters` | The predicted coreference clusters for the `docs`. ~~List[MentionClusters]~~ |
## CoreferenceResolver.update {#update tag="method"}
Learn from a batch of [`Example`](/api/example) objects. Delegates to
[`predict`](/api/coref#predict).
> #### Example
>
> ```python
> coref = nlp.add_pipe("experimental_coref")
> optimizer = nlp.initialize()
> losses = coref.update(examples, sgd=optimizer)
> ```
| Name | Description |
| -------------- | ------------------------------------------------------------------------------------------------------------------------ |
| `examples` | A batch of [`Example`](/api/example) objects to learn from. ~~Iterable[Example]~~ |
| _keyword-only_ | |
| `drop` | The dropout rate. ~~float~~ |
| `sgd` | An optimizer. Will be created via [`create_optimizer`](#create_optimizer) if not set. ~~Optional[Optimizer]~~ |
| `losses` | Optional record of the loss during training. Updated using the component name as the key. ~~Optional[Dict[str, float]]~~ |
| **RETURNS** | The updated `losses` dictionary. ~~Dict[str, float]~~ |
## CoreferenceResolver.create_optimizer {#create_optimizer tag="method"}
Create an optimizer for the pipeline component.
> #### Example
>
> ```python
> coref = nlp.add_pipe("experimental_coref")
> optimizer = coref.create_optimizer()
> ```
| Name | Description |
| ----------- | ---------------------------- |
| **RETURNS** | The optimizer. ~~Optimizer~~ |
## CoreferenceResolver.use_params {#use_params tag="method, contextmanager"}
Modify the pipe's model, to use the given parameter values. At the end of the
context, the original parameters are restored.
> #### Example
>
> ```python
> coref = nlp.add_pipe("experimental_coref")
> with coref.use_params(optimizer.averages):
> coref.to_disk("/best_model")
> ```
| Name | Description |
| -------- | -------------------------------------------------- |
| `params` | The parameter values to use in the model. ~~dict~~ |
## CoreferenceResolver.to_disk {#to_disk tag="method"}
Serialize the pipe to disk.
> #### Example
>
> ```python
> coref = nlp.add_pipe("experimental_coref")
> coref.to_disk("/path/to/coref")
> ```
| Name | Description |
| -------------- | ------------------------------------------------------------------------------------------------------------------------------------------ |
| `path` | A path to a directory, which will be created if it doesn't exist. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ |
| _keyword-only_ | |
| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ |
## CoreferenceResolver.from_disk {#from_disk tag="method"}
Load the pipe from disk. Modifies the object in place and returns it.
> #### Example
>
> ```python
> coref = nlp.add_pipe("experimental_coref")
> coref.from_disk("/path/to/coref")
> ```
| Name | Description |
| -------------- | ----------------------------------------------------------------------------------------------- |
| `path` | A path to a directory. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ |
| _keyword-only_ | |
| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ |
| **RETURNS** | The modified `CoreferenceResolver` object. ~~CoreferenceResolver~~ |
## CoreferenceResolver.to_bytes {#to_bytes tag="method"}
> #### Example
>
> ```python
> coref = nlp.add_pipe("experimental_coref")
> coref_bytes = coref.to_bytes()
> ```
Serialize the pipe to a bytestring, including the `KnowledgeBase`.
| Name | Description |
| -------------- | ------------------------------------------------------------------------------------------- |
| _keyword-only_ | |
| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ |
| **RETURNS** | The serialized form of the `CoreferenceResolver` object. ~~bytes~~ |
## CoreferenceResolver.from_bytes {#from_bytes tag="method"}
Load the pipe from a bytestring. Modifies the object in place and returns it.
> #### Example
>
> ```python
> coref_bytes = coref.to_bytes()
> coref = nlp.add_pipe("experimental_coref")
> coref.from_bytes(coref_bytes)
> ```
| Name | Description |
| -------------- | ------------------------------------------------------------------------------------------- |
| `bytes_data` | The data to load from. ~~bytes~~ |
| _keyword-only_ | |
| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ |
| **RETURNS** | The `CoreferenceResolver` object. ~~CoreferenceResolver~~ |
## Serialization fields {#serialization-fields}
During serialization, spaCy will export several data fields used to restore
different aspects of the object. If needed, you can exclude them from
serialization by passing in the string names via the `exclude` argument.
> #### Example
>
> ```python
> data = coref.to_disk("/path", exclude=["vocab"])
> ```
| Name | Description |
| ------- | -------------------------------------------------------------- |
| `vocab` | The shared [`Vocab`](/api/vocab). |
| `cfg` | The config file. You usually don't want to exclude this. |
| `model` | The binary model data. You usually don't want to exclude this. |

View File

@ -32,7 +32,7 @@ Construct a `Doc` object. The most common way to get a `Doc` object is via the
> ```
| Name | Description |
| ---------------------------------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| ---------------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| `vocab` | A storage container for lexical types. ~~Vocab~~ |
| `words` | A list of strings or integer hash values to add to the document as words. ~~Optional[List[Union[str,int]]]~~ |
| `spaces` | A list of boolean values indicating whether each word has a subsequent space. Must have the same length as `words`, if specified. Defaults to a sequence of `True`. ~~Optional[List[bool]]~~ |
@ -44,7 +44,7 @@ Construct a `Doc` object. The most common way to get a `Doc` object is via the
| `lemmas` <Tag variant="new">3</Tag> | A list of strings, of the same length as `words`, to assign as `token.lemma` for each word. Defaults to `None`. ~~Optional[List[str]]~~ |
| `heads` <Tag variant="new">3</Tag> | A list of values, of the same length as `words`, to assign as the head for each word. Head indices are the absolute position of the head in the `Doc`. Defaults to `None`. ~~Optional[List[int]]~~ |
| `deps` <Tag variant="new">3</Tag> | A list of strings, of the same length as `words`, to assign as `token.dep` for each word. Defaults to `None`. ~~Optional[List[str]]~~ |
| `sent_starts` <Tag variant="new">3</Tag> | A list of values, of the same length as `words`, to assign as `token.is_sent_start`. Will be overridden by heads if `heads` is provided. Defaults to `None`. ~~Optional[List[Optional[bool]]]~~ |
| `sent_starts` <Tag variant="new">3</Tag> | A list of values, of the same length as `words`, to assign as `token.is_sent_start`. Will be overridden by heads if `heads` is provided. Defaults to `None`. ~~Optional[List[Union[bool, int, None]]]~~ |
| `ents` <Tag variant="new">3</Tag> | A list of strings, of the same length of `words`, to assign the token-based IOB tag. Defaults to `None`. ~~Optional[List[str]]~~ |
## Doc.\_\_getitem\_\_ {#getitem tag="method"}

View File

@ -23,11 +23,13 @@ both documents.
> ```python
> from spacy.tokens import Doc
> from spacy.training import Example
>
> words = ["hello", "world", "!"]
> spaces = [True, False, False]
> predicted = Doc(nlp.vocab, words=words, spaces=spaces)
> reference = parse_gold_doc(my_data)
> pred_words = ["Apply", "some", "sunscreen"]
> pred_spaces = [True, True, False]
> gold_words = ["Apply", "some", "sun", "screen"]
> gold_spaces = [True, True, False, False]
> gold_tags = ["VERB", "DET", "NOUN", "NOUN"]
> predicted = Doc(nlp.vocab, words=pred_words, spaces=pred_spaces)
> reference = Doc(nlp.vocab, words=gold_words, spaces=gold_spaces, tags=gold_tags)
> example = Example(predicted, reference)
> ```

View File

@ -164,6 +164,9 @@ examples, see the
Apply the pipeline to some text. The text can span multiple sentences, and can
contain arbitrary whitespace. Alignment into the original string is preserved.
Instead of text, a `Doc` can be passed as input, in which case tokenization is
skipped, but the rest of the pipeline is run.
> #### Example
>
> ```python
@ -173,7 +176,7 @@ contain arbitrary whitespace. Alignment into the original string is preserved.
| Name | Description |
| --------------- | ---------------------------------------------------------------------------------------------------------------------------------------------- |
| `text` | The text to be processed. ~~str~~ |
| `text` | The text to be processed, or a Doc. ~~Union[str, Doc]~~ |
| _keyword-only_ | |
| `disable` | Names of pipeline components to [disable](/usage/processing-pipelines#disabling). ~~List[str]~~ |
| `component_cfg` | Optional dictionary of keyword arguments for components, keyed by component names. Defaults to `None`. ~~Optional[Dict[str, Dict[str, Any]]]~~ |
@ -184,6 +187,9 @@ contain arbitrary whitespace. Alignment into the original string is preserved.
Process texts as a stream, and yield `Doc` objects in order. This is usually
more efficient than processing texts one-by-one.
Instead of text, a `Doc` object can be passed as input. In this case
tokenization is skipped but the rest of the pipeline is run.
> #### Example
>
> ```python
@ -194,7 +200,7 @@ more efficient than processing texts one-by-one.
| Name | Description |
| ------------------------------------------ | ------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| `texts` | A sequence of strings. ~~Iterable[str]~~ |
| `texts` | A sequence of strings (or `Doc` objects). ~~Iterable[Union[str, Doc]]~~ |
| _keyword-only_ | |
| `as_tuples` | If set to `True`, inputs should be a sequence of `(text, context)` tuples. Output will then be a sequence of `(doc, context)` tuples. Defaults to `False`. ~~bool~~ |
| `batch_size` | The number of texts to buffer. ~~Optional[int]~~ |

View File

@ -153,3 +153,36 @@ whole pipeline has run.
| `attrs` | A dict of the `Doc` attributes and the values to set them to. Defaults to `{"tensor": None, "_.trf_data": None}` to clean up after `tok2vec` and `transformer` components. ~~dict~~ |
| `silent` | If `False`, show warnings if attributes aren't found or can't be set. Defaults to `True`. ~~bool~~ |
| **RETURNS** | The modified `Doc` with the modified attributes. ~~Doc~~ |
## span_cleaner {#span_cleaner tag="function,experimental"}
Remove `SpanGroup`s from `doc.spans` based on a key prefix. This is used to
clean up after the [`CoreferenceResolver`](/api/coref) when it's paired with a
[`SpanResolver`](/api/span-resolver).
<Infobox title="Important note" variant="warning">
This pipeline function is not yet integrated into spaCy core, and is available
via the extension package
[`spacy-experimental`](https://github.com/explosion/spacy-experimental) starting
in version 0.6.0. It exposes the component via
[entry points](/usage/saving-loading/#entry-points), so if you have the package
installed, using `factory = "span_cleaner"` in your
[training config](/usage/training#config) or `nlp.add_pipe("span_cleaner")` will
work out-of-the-box.
</Infobox>
> #### Example
>
> ```python
> config = {"prefix": "coref_head_clusters"}
> nlp.add_pipe("span_cleaner", config=config)
> doc = nlp("text")
> assert "coref_head_clusters_1" not in doc.spans
> ```
| Setting | Description |
| ----------- | ------------------------------------------------------------------------------------------------------------------------- |
| `prefix` | A prefix to check `SpanGroup` keys for. Any matching groups will be removed. Defaults to `"coref_head_clusters"`. ~~str~~ |
| **RETURNS** | The modified `Doc` with any matching spans removed. ~~Doc~~ |

View File

@ -270,3 +270,62 @@ Compute micro-PRF and per-entity PRF scores.
| Name | Description |
| ---------- | ------------------------------------------------------------------------------------------------------------------- |
| `examples` | The `Example` objects holding both the predictions and the correct gold-standard annotations. ~~Iterable[Example]~~ |
## score_coref_clusters {#score_coref_clusters tag="experimental"}
Returns LEA ([Moosavi and Strube, 2016](https://aclanthology.org/P16-1060/)) PRF
scores for coreference clusters.
<Infobox title="Important note" variant="warning">
Note this scoring function is not yet included in spaCy core - for details, see
the [CoreferenceResolver](/api/coref) docs.
</Infobox>
> #### Example
>
> ```python
> scores = score_coref_clusters(
> examples,
> span_cluster_prefix="coref_clusters",
> )
> print(scores["coref_f"])
> ```
| Name | Description |
| --------------------- | ------------------------------------------------------------------------------------------------------------------- |
| `examples` | The `Example` objects holding both the predictions and the correct gold-standard annotations. ~~Iterable[Example]~~ |
| _keyword-only_ | |
| `span_cluster_prefix` | The prefix used for spans representing coreference clusters. ~~str~~ |
| **RETURNS** | A dictionary containing the scores. ~~Dict[str, Optional[float]]~~ |
## score_span_predictions {#score_span_predictions tag="experimental"}
Return accuracy for reconstructions of spans from single tokens. Only exactly
correct predictions are counted as correct, there is no partial credit for near
answers. Used by the [SpanResolver](/api/span-resolver).
<Infobox title="Important note" variant="warning">
Note this scoring function is not yet included in spaCy core - for details, see
the [SpanResolver](/api/span-resolver) docs.
</Infobox>
> #### Example
>
> ```python
> scores = score_span_predictions(
> examples,
> output_prefix="coref_clusters",
> )
> print(scores["span_coref_clusters_accuracy"])
> ```
| Name | Description |
| --------------- | ------------------------------------------------------------------------------------------------------------------- |
| `examples` | The `Example` objects holding both the predictions and the correct gold-standard annotations. ~~Iterable[Example]~~ |
| _keyword-only_ | |
| `output_prefix` | The prefix used for spans representing the final predicted spans. ~~str~~ |
| **RETURNS** | A dictionary containing the scores. ~~Dict[str, Optional[float]]~~ |

View File

@ -0,0 +1,356 @@
---
title: SpanResolver
tag: class,experimental
source: spacy-experimental/coref/span_resolver_component.py
teaser: 'Pipeline component for resolving tokens into spans'
api_base_class: /api/pipe
api_string_name: span_resolver
api_trainable: true
---
> #### Installation
>
> ```bash
> $ pip install -U spacy-experimental
> ```
<Infobox title="Important note" variant="warning">
This component not yet integrated into spaCy core, and is available via the
extension package
[`spacy-experimental`](https://github.com/explosion/spacy-experimental) starting
in version 0.6.0. It exposes the component via
[entry points](/usage/saving-loading/#entry-points), so if you have the package
installed, using `factory = "experimental_span_resolver"` in your
[training config](/usage/training#config) or
`nlp.add_pipe("experimental_span_resolver")` will work out-of-the-box.
</Infobox>
A `SpanResolver` component takes in tokens (represented as `Span` objects of
length 1) and resolves them into `Span` objects of arbitrary length. The initial
use case is as a post-processing step on word-level
[coreference resolution](/api/coref). The input and output keys used to store
`Span` objects are configurable.
## Assigned Attributes {#assigned-attributes}
Predictions will be saved to `Doc.spans` as [`SpanGroup`s](/api/spangroup).
Input token spans will be read in using an input prefix, by default
`"coref_head_clusters"`, and output spans will be saved using an output prefix
(default `"coref_clusters"`) plus a serial number starting from one. The
prefixes are configurable.
| Location | Value |
| ------------------------------------------------- | ------------------------------------------------------------------------- |
| `Doc.spans[output_prefix + "_" + cluster_number]` | One group of predicted spans. Cluster number starts from 1. ~~SpanGroup~~ |
## Config and implementation {#config}
The default config is defined by the pipeline component factory and describes
how the component should be configured. You can override its settings via the
`config` argument on [`nlp.add_pipe`](/api/language#add_pipe) or in your
[`config.cfg` for training](/usage/training#config). See the
[model architectures](/api/architectures#coref-architectures) documentation for
details on the architectures and their arguments and hyperparameters.
> #### Example
>
> ```python
> from spacy_experimental.coref.span_resolver_component import DEFAULT_SPAN_RESOLVER_MODEL
> from spacy_experimental.coref.coref_util import DEFAULT_CLUSTER_PREFIX, DEFAULT_CLUSTER_HEAD_PREFIX
> config={
> "model": DEFAULT_SPAN_RESOLVER_MODEL,
> "input_prefix": DEFAULT_CLUSTER_HEAD_PREFIX,
> "output_prefix": DEFAULT_CLUSTER_PREFIX,
> },
> nlp.add_pipe("experimental_span_resolver", config=config)
> ```
| Setting | Description |
| --------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------ |
| `model` | The [`Model`](https://thinc.ai/docs/api-model) powering the pipeline component. Defaults to [SpanResolver](/api/architectures#SpanResolver). ~~Model~~ |
| `input_prefix` | The prefix to use for input `SpanGroup`s. Defaults to `coref_head_clusters`. ~~str~~ |
| `output_prefix` | The prefix for predicted `SpanGroup`s. Defaults to `coref_clusters`. ~~str~~ |
## SpanResolver.\_\_init\_\_ {#init tag="method"}
> #### Example
>
> ```python
> # Construction via add_pipe with default model
> span_resolver = nlp.add_pipe("experimental_span_resolver")
>
> # Construction via add_pipe with custom model
> config = {"model": {"@architectures": "my_span_resolver.v1"}}
> span_resolver = nlp.add_pipe("experimental_span_resolver", config=config)
>
> # Construction from class
> from spacy_experimental.coref.span_resolver_component import SpanResolver
> span_resolver = SpanResolver(nlp.vocab, model)
> ```
Create a new pipeline instance. In your application, you would normally use a
shortcut for this and instantiate the component using its string name and
[`nlp.add_pipe`](/api/language#add_pipe).
| Name | Description |
| --------------- | --------------------------------------------------------------------------------------------------- |
| `vocab` | The shared vocabulary. ~~Vocab~~ |
| `model` | The [`Model`](https://thinc.ai/docs/api-model) powering the pipeline component. ~~Model~~ |
| `name` | String name of the component instance. Used to add entries to the `losses` during training. ~~str~~ |
| _keyword-only_ | |
| `input_prefix` | The prefix to use for input `SpanGroup`s. Defaults to `coref_head_clusters`. ~~str~~ |
| `output_prefix` | The prefix for predicted `SpanGroup`s. Defaults to `coref_clusters`. ~~str~~ |
## SpanResolver.\_\_call\_\_ {#call tag="method"}
Apply the pipe to one document. The document is modified in place and returned.
This usually happens under the hood when the `nlp` object is called on a text
and all pipeline components are applied to the `Doc` in order. Both
[`__call__`](#call) and [`pipe`](#pipe) delegate to the [`predict`](#predict)
and [`set_annotations`](#set_annotations) methods.
> #### Example
>
> ```python
> doc = nlp("This is a sentence.")
> span_resolver = nlp.add_pipe("experimental_span_resolver")
> # This usually happens under the hood
> processed = span_resolver(doc)
> ```
| Name | Description |
| ----------- | -------------------------------- |
| `doc` | The document to process. ~~Doc~~ |
| **RETURNS** | The processed document. ~~Doc~~ |
## SpanResolver.pipe {#pipe tag="method"}
Apply the pipe to a stream of documents. This usually happens under the hood
when the `nlp` object is called on a text and all pipeline components are
applied to the `Doc` in order. Both [`__call__`](/api/span-resolver#call) and
[`pipe`](/api/span-resolver#pipe) delegate to the
[`predict`](/api/span-resolver#predict) and
[`set_annotations`](/api/span-resolver#set_annotations) methods.
> #### Example
>
> ```python
> span_resolver = nlp.add_pipe("experimental_span_resolver")
> for doc in span_resolver.pipe(docs, batch_size=50):
> pass
> ```
| Name | Description |
| -------------- | ------------------------------------------------------------- |
| `stream` | A stream of documents. ~~Iterable[Doc]~~ |
| _keyword-only_ | |
| `batch_size` | The number of documents to buffer. Defaults to `128`. ~~int~~ |
| **YIELDS** | The processed documents in order. ~~Doc~~ |
## SpanResolver.initialize {#initialize tag="method"}
Initialize the component for training. `get_examples` should be a function that
returns an iterable of [`Example`](/api/example) objects. **At least one example
should be supplied.** The data examples are used to **initialize the model** of
the component and can either be the full training data or a representative
sample. Initialization includes validating the network,
[inferring missing shapes](https://thinc.ai/docs/usage-models#validation) and
setting up the label scheme based on the data. This method is typically called
by [`Language.initialize`](/api/language#initialize).
> #### Example
>
> ```python
> span_resolver = nlp.add_pipe("experimental_span_resolver")
> span_resolver.initialize(lambda: examples, nlp=nlp)
> ```
| Name | Description |
| -------------- | -------------------------------------------------------------------------------------------------------------------------------------------------------------------------- |
| `get_examples` | Function that returns gold-standard annotations in the form of [`Example`](/api/example) objects. Must contain at least one `Example`. ~~Callable[[], Iterable[Example]]~~ |
| _keyword-only_ | |
| `nlp` | The current `nlp` object. Defaults to `None`. ~~Optional[Language]~~ |
## SpanResolver.predict {#predict tag="method"}
Apply the component's model to a batch of [`Doc`](/api/doc) objects, without
modifying them. Predictions are returned as a list of `MentionClusters`, one for
each input `Doc`. A `MentionClusters` instance is just a list of lists of pairs
of `int`s, where each item corresponds to an input `SpanGroup`, and the `int`s
correspond to token indices.
> #### Example
>
> ```python
> span_resolver = nlp.add_pipe("experimental_span_resolver")
> spans = span_resolver.predict([doc1, doc2])
> ```
| Name | Description |
| ----------- | ------------------------------------------------------------- |
| `docs` | The documents to predict. ~~Iterable[Doc]~~ |
| **RETURNS** | The predicted spans for the `Doc`s. ~~List[MentionClusters]~~ |
## SpanResolver.set_annotations {#set_annotations tag="method"}
Modify a batch of documents, saving predictions using the output prefix in
`Doc.spans`.
> #### Example
>
> ```python
> span_resolver = nlp.add_pipe("experimental_span_resolver")
> spans = span_resolver.predict([doc1, doc2])
> span_resolver.set_annotations([doc1, doc2], spans)
> ```
| Name | Description |
| ------- | ------------------------------------------------------------- |
| `docs` | The documents to modify. ~~Iterable[Doc]~~ |
| `spans` | The predicted spans for the `docs`. ~~List[MentionClusters]~~ |
## SpanResolver.update {#update tag="method"}
Learn from a batch of [`Example`](/api/example) objects. Delegates to
[`predict`](/api/span-resolver#predict).
> #### Example
>
> ```python
> span_resolver = nlp.add_pipe("experimental_span_resolver")
> optimizer = nlp.initialize()
> losses = span_resolver.update(examples, sgd=optimizer)
> ```
| Name | Description |
| -------------- | ------------------------------------------------------------------------------------------------------------------------ |
| `examples` | A batch of [`Example`](/api/example) objects to learn from. ~~Iterable[Example]~~ |
| _keyword-only_ | |
| `drop` | The dropout rate. ~~float~~ |
| `sgd` | An optimizer. Will be created via [`create_optimizer`](#create_optimizer) if not set. ~~Optional[Optimizer]~~ |
| `losses` | Optional record of the loss during training. Updated using the component name as the key. ~~Optional[Dict[str, float]]~~ |
| **RETURNS** | The updated `losses` dictionary. ~~Dict[str, float]~~ |
## SpanResolver.create_optimizer {#create_optimizer tag="method"}
Create an optimizer for the pipeline component.
> #### Example
>
> ```python
> span_resolver = nlp.add_pipe("experimental_span_resolver")
> optimizer = span_resolver.create_optimizer()
> ```
| Name | Description |
| ----------- | ---------------------------- |
| **RETURNS** | The optimizer. ~~Optimizer~~ |
## SpanResolver.use_params {#use_params tag="method, contextmanager"}
Modify the pipe's model, to use the given parameter values. At the end of the
context, the original parameters are restored.
> #### Example
>
> ```python
> span_resolver = nlp.add_pipe("experimental_span_resolver")
> with span_resolver.use_params(optimizer.averages):
> span_resolver.to_disk("/best_model")
> ```
| Name | Description |
| -------- | -------------------------------------------------- |
| `params` | The parameter values to use in the model. ~~dict~~ |
## SpanResolver.to_disk {#to_disk tag="method"}
Serialize the pipe to disk.
> #### Example
>
> ```python
> span_resolver = nlp.add_pipe("experimental_span_resolver")
> span_resolver.to_disk("/path/to/span_resolver")
> ```
| Name | Description |
| -------------- | ------------------------------------------------------------------------------------------------------------------------------------------ |
| `path` | A path to a directory, which will be created if it doesn't exist. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ |
| _keyword-only_ | |
| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ |
## SpanResolver.from_disk {#from_disk tag="method"}
Load the pipe from disk. Modifies the object in place and returns it.
> #### Example
>
> ```python
> span_resolver = nlp.add_pipe("experimental_span_resolver")
> span_resolver.from_disk("/path/to/span_resolver")
> ```
| Name | Description |
| -------------- | ----------------------------------------------------------------------------------------------- |
| `path` | A path to a directory. Paths may be either strings or `Path`-like objects. ~~Union[str, Path]~~ |
| _keyword-only_ | |
| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ |
| **RETURNS** | The modified `SpanResolver` object. ~~SpanResolver~~ |
## SpanResolver.to_bytes {#to_bytes tag="method"}
> #### Example
>
> ```python
> span_resolver = nlp.add_pipe("experimental_span_resolver")
> span_resolver_bytes = span_resolver.to_bytes()
> ```
Serialize the pipe to a bytestring.
| Name | Description |
| -------------- | ------------------------------------------------------------------------------------------- |
| _keyword-only_ | |
| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ |
| **RETURNS** | The serialized form of the `SpanResolver` object. ~~bytes~~ |
## SpanResolver.from_bytes {#from_bytes tag="method"}
Load the pipe from a bytestring. Modifies the object in place and returns it.
> #### Example
>
> ```python
> span_resolver_bytes = span_resolver.to_bytes()
> span_resolver = nlp.add_pipe("experimental_span_resolver")
> span_resolver.from_bytes(span_resolver_bytes)
> ```
| Name | Description |
| -------------- | ------------------------------------------------------------------------------------------- |
| `bytes_data` | The data to load from. ~~bytes~~ |
| _keyword-only_ | |
| `exclude` | String names of [serialization fields](#serialization-fields) to exclude. ~~Iterable[str]~~ |
| **RETURNS** | The `SpanResolver` object. ~~SpanResolver~~ |
## Serialization fields {#serialization-fields}
During serialization, spaCy will export several data fields used to restore
different aspects of the object. If needed, you can exclude them from
serialization by passing in the string names via the `exclude` argument.
> #### Example
>
> ```python
> data = span_resolver.to_disk("/path", exclude=["vocab"])
> ```
| Name | Description |
| ------- | -------------------------------------------------------------- |
| `vocab` | The shared [`Vocab`](/api/vocab). |
| `cfg` | The config file. You usually don't want to exclude this. |
| `model` | The binary model data. You usually don't want to exclude this. |

View File

@ -148,6 +148,13 @@ skipped. You can also set `--force` to force re-running a command, or `--dry` to
perform a "dry run" and see what would happen (without actually running the
script).
Since spaCy v3.4.2, `spacy projects run` checks your installed dependencies to
verify that your environment is properly set up and aligns with the project's
`requirements.txt`, if there is one. If missing or conflicting dependencies are
detected, a corresponding warning is displayed. If you'd like to disable the
dependency check, set `check_requirements: false` in your project's
`project.yml`.
### 4. Run a workflow {#run-workfow}
> #### project.yml
@ -226,17 +233,18 @@ pipelines.
```yaml
%%GITHUB_PROJECTS/pipelines/tagger_parser_ud/project.yml
```
> #### Tip: Overriding variables on the CLI
>
> If you want to override one or more variables on the CLI and are not already specifying a
> project directory, you need to add `.` as a placeholder:
> If you want to override one or more variables on the CLI and are not already
> specifying a project directory, you need to add `.` as a placeholder:
>
> ```
> python -m spacy project run test . --vars.foo bar
> ```
| Section | Description |
| --------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ |
| --------------------------------------------------- | ------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------------ |
| `title` | An optional project title used in `--help` message and [auto-generated docs](#custom-docs). |
| `description` | An optional project description used in [auto-generated docs](#custom-docs). |
| `vars` | A dictionary of variables that can be referenced in paths, URLs and scripts and overriden on the CLI, just like [`config.cfg` variables](/usage/training#config-interpolation). For example, `${vars.name}` will use the value of the variable `name`. Variables need to be defined in the section `vars`, but can be a nested dict, so you're able to reference `${vars.model.name}`. |
@ -246,6 +254,7 @@ pipelines.
| `workflows` | A dictionary of workflow names, mapped to a list of command names, to execute in order. Workflows can be run with the [`project run`](/api/cli#project-run) command. |
| `commands` | A list of named commands. A command can define an optional help message (shown in the CLI when the user adds `--help`) and the `script`, a list of commands to run. The `deps` and `outputs` let you define the created file the command depends on and produces, respectively. This lets spaCy determine whether a command needs to be re-run because its dependencies or outputs changed. Commands can be run as part of a workflow, or separately with the [`project run`](/api/cli#project-run) command. |
| `spacy_version` | Optional spaCy version range like `>=3.0.0,<3.1.0` that the project is compatible with. If it's loaded with an incompatible version, an error is raised when the project is loaded. |
| `check_requirements` <Tag variant="new">3.4.2</Tag> | A flag determining whether to verify that the installed dependencies align with the project's `requirements.txt`. Defaults to `true`. |
### Data assets {#data-assets}

View File

@ -65,10 +65,10 @@ The English CNN pipelines have new word vectors:
| Package | Model Version | TAG | Parser LAS | NER F |
| ----------------------------------------------- | ------------- | ---: | ---------: | ----: |
| [`en_core_news_md`](/models/en#en_core_news_md) | v3.3.0 | 97.3 | 90.1 | 84.6 |
| [`en_core_news_md`](/models/en#en_core_news_lg) | v3.4.0 | 97.2 | 90.3 | 85.5 |
| [`en_core_news_lg`](/models/en#en_core_news_md) | v3.3.0 | 97.4 | 90.1 | 85.3 |
| [`en_core_news_lg`](/models/en#en_core_news_lg) | v3.4.0 | 97.3 | 90.2 | 85.6 |
| [`en_core_web_md`](/models/en#en_core_web_md) | v3.3.0 | 97.3 | 90.1 | 84.6 |
| [`en_core_web_md`](/models/en#en_core_web_lg) | v3.4.0 | 97.2 | 90.3 | 85.5 |
| [`en_core_web_lg`](/models/en#en_core_web_md) | v3.3.0 | 97.4 | 90.1 | 85.3 |
| [`en_core_web_lg`](/models/en#en_core_web_lg) | v3.4.0 | 97.3 | 90.2 | 85.6 |
## Notes about upgrading from v3.3 {#upgrading}

View File

@ -12,7 +12,6 @@
{ "text": "New in v3.0", "url": "/usage/v3" },
{ "text": "New in v3.1", "url": "/usage/v3-1" },
{ "text": "New in v3.2", "url": "/usage/v3-2" },
{ "text": "New in v3.2", "url": "/usage/v3-2" },
{ "text": "New in v3.3", "url": "/usage/v3-3" },
{ "text": "New in v3.4", "url": "/usage/v3-4" }
]
@ -95,6 +94,7 @@
"label": "Pipeline",
"items": [
{ "text": "AttributeRuler", "url": "/api/attributeruler" },
{ "text": "CoreferenceResolver", "url": "/api/coref" },
{ "text": "DependencyParser", "url": "/api/dependencyparser" },
{ "text": "EditTreeLemmatizer", "url": "/api/edittreelemmatizer" },
{ "text": "EntityLinker", "url": "/api/entitylinker" },
@ -105,6 +105,7 @@
{ "text": "SentenceRecognizer", "url": "/api/sentencerecognizer" },
{ "text": "Sentencizer", "url": "/api/sentencizer" },
{ "text": "SpanCategorizer", "url": "/api/spancategorizer" },
{ "text": "SpanResolver", "url": "/api/span-resolver" },
{ "text": "SpanRuler", "url": "/api/spanruler" },
{ "text": "Tagger", "url": "/api/tagger" },
{ "text": "TextCategorizer", "url": "/api/textcategorizer" },

View File

@ -1,5 +1,62 @@
{
"resources": [
{
"id": "Zshot",
"title": "Zshot",
"slogan": "Zero and Few shot named entity & relationships recognition",
"github": "ibm/zshot",
"pip": "zshot",
"code_example": [
"import spacy",
"from zshot import PipelineConfig, displacy",
"from zshot.linker import LinkerRegen",
"from zshot.mentions_extractor import MentionsExtractorSpacy",
"from zshot.utils.data_models import Entity",
"",
"nlp = spacy.load('en_core_web_sm')",
"# zero shot definition of entities",
"nlp_config = PipelineConfig(",
" mentions_extractor=MentionsExtractorSpacy(),",
" linker=LinkerRegen(),",
" entities=[",
" Entity(name='Paris',",
" description='Paris is located in northern central France, in a north-bending arc of the river Seine'),",
" Entity(name='IBM',",
" description='International Business Machines Corporation (IBM) is an American multinational technology corporation headquartered in Armonk, New York'),",
" Entity(name='New York', description='New York is a city in U.S. state'),",
" Entity(name='Florida', description='southeasternmost U.S. state'),",
" Entity(name='American',",
" description='American, something of, from, or related to the United States of America, commonly known as the United States or America'),",
" Entity(name='Chemical formula',",
" description='In chemistry, a chemical formula is a way of presenting information about the chemical proportions of atoms that constitute a particular chemical compound or molecul'),",
" Entity(name='Acetamide',",
" description='Acetamide (systematic name: ethanamide) is an organic compound with the formula CH3CONH2. It is the simplest amide derived from acetic acid. It finds some use as a plasticizer and as an industrial solvent.'),",
" Entity(name='Armonk',",
" description='Armonk is a hamlet and census-designated place (CDP) in the town of North Castle, located in Westchester County, New York, United States.'),",
" Entity(name='Acetic Acid',",
" description='Acetic acid, systematically named ethanoic acid, is an acidic, colourless liquid and organic compound with the chemical formula CH3COOH'),",
" Entity(name='Industrial solvent',",
" description='Acetamide (systematic name: ethanamide) is an organic compound with the formula CH3CONH2. It is the simplest amide derived from acetic acid. It finds some use as a plasticizer and as an industrial solvent.'),",
" ]",
")",
"nlp.add_pipe('zshot', config=nlp_config, last=True)",
"",
"text = 'International Business Machines Corporation (IBM) is an American multinational technology corporation' \\",
" ' headquartered in Armonk, New York, with operations in over 171 countries.'",
"",
"doc = nlp(text)",
"displacy.serve(doc, style='ent')"
],
"thumb": "https://ibm.github.io/zshot/img/graph.png",
"url": "https://ibm.github.io/zshot/",
"author": "IBM Research",
"author_links": {
"github": "ibm",
"twitter": "IBMResearch",
"website": "https://research.ibm.com/labs/ireland/"
},
"category": ["scientific", "models", "research"]
},
{
"id": "concepcy",
"title": "concepCy",
@ -2403,20 +2460,20 @@
"import spacy",
"from spacy_wordnet.wordnet_annotator import WordnetAnnotator ",
"",
"# Load an spacy model (supported models are \"es\" and \"en\") ",
"nlp = spacy.load('en')",
"# Spacy 3.x",
"nlp.add_pipe(\"spacy_wordnet\", after='tagger', config={'lang': nlp.lang})",
"# Spacy 2.x",
"# Load a spaCy model (supported languages are \"es\" and \"en\") ",
"nlp = spacy.load('en_core_web_sm')",
"# spaCy 3.x",
"nlp.add_pipe(\"spacy_wordnet\", after='tagger')",
"# spaCy 2.x",
"# nlp.add_pipe(WordnetAnnotator(nlp.lang), after='tagger')",
"token = nlp('prices')[0]",
"",
"# wordnet object link spacy token with nltk wordnet interface by giving acces to",
"# WordNet object links spaCy token with NLTK WordNet interface by giving access to",
"# synsets and lemmas ",
"token._.wordnet.synsets()",
"token._.wordnet.lemmas()",
"",
"# And automatically tags with wordnet domains",
"# And automatically add info about WordNet domains",
"token._.wordnet.wordnet_domains()"
],
"author": "recognai",
@ -3984,7 +4041,21 @@
},
"category": ["pipeline"],
"tags": ["interpretation", "ja"]
},
{
"id": "spacy-partial-tagger",
"title": "spaCy - Partial Tagger",
"slogan": "Sequence Tagger for Partially Annotated Dataset in spaCy",
"description": "This is a library to build a CRF tagger with a partially annotated dataset in spaCy. You can build your own tagger only from dictionary.",
"github": "doccano/spacy-partial-tagger",
"pip": "spacy-partial-tagger",
"category": ["pipeline", "training"],
"author": "Yasufumi Taniguchi",
"author_links": {
"github": "yasufumy"
}
}
],
"categories": [