Merge remote-tracking branch 'upstream/v4' into feature/refactor-parser

.github/ISSUE_TEMPLATE/01_bugs.md

@@ -10,7 +10,7 @@ about: Use this template if you came across a bug or unexpected behaviour differ
 <!-- Include a code example or the steps that led to the problem. Please try to be as specific as possible. -->
 
 ## Your Environment
-<!-- Include details of your environment. If you're using spaCy 1.7+, you can also type `python -m spacy info --markdown` and copy-paste the result here.-->
+<!-- Include details of your environment. You can also type `python -m spacy info --markdown` and copy-paste the result here.-->
 * Operating System:
 * Python Version Used:
 * spaCy Version Used:

.github/azure-steps.yml

@@ -1,76 +1,68 @@
 parameters:
   python_version: ''
-  architecture: ''
+  architecture: 'x64'
-  prefix: ''
+  num_build_jobs: 2
-  gpu: false
-  num_build_jobs: 1
 
 steps:
   - task: UsePythonVersion@0
     inputs:
       versionSpec: ${{ parameters.python_version }}
       architecture: ${{ parameters.architecture }}
+      allowUnstable: true
 
   - bash: |
       echo "##vso[task.setvariable variable=python_version]${{ parameters.python_version }}"
     displayName: 'Set variables'
 
   - script: |
-      ${{ parameters.prefix }} python -m pip install -U pip setuptools
+      python -m pip install -U build pip setuptools
-      ${{ parameters.prefix }} python -m pip install -U -r requirements.txt
+      python -m pip install -U -r requirements.txt
     displayName: "Install dependencies"
 
   - script: |
-      ${{ parameters.prefix }} python setup.py build_ext --inplace -j ${{ parameters.num_build_jobs }}
+      python -m build --sdist
-      ${{ parameters.prefix }} python setup.py sdist --formats=gztar
+    displayName: "Build sdist"
-    displayName: "Compile and build sdist"
 
-  - script: python -m mypy spacy
+  - script: |
+      python -m mypy spacy
     displayName: 'Run mypy'
-    condition: ne(variables['python_version'], '3.10')
+    condition: ne(variables['python_version'], '3.6')
 
   - task: DeleteFiles@1
     inputs:
       contents: "spacy"
     displayName: "Delete source directory"
 
+  - task: DeleteFiles@1
+    inputs:
+      contents: "*.egg-info"
+    displayName: "Delete egg-info directory"
+
   - script: |
-      ${{ parameters.prefix }} python -m pip freeze --exclude torch --exclude cupy-cuda110 > installed.txt
+      python -m pip freeze > installed.txt
-      ${{ parameters.prefix }} python -m pip uninstall -y -r installed.txt
+      python -m pip uninstall -y -r installed.txt
     displayName: "Uninstall all packages"
 
   - bash: |
-      ${{ parameters.prefix }} SDIST=$(python -c "import os;print(os.listdir('./dist')[-1])" 2>&1)
+      SDIST=$(python -c "import os;print(os.listdir('./dist')[-1])" 2>&1)
-      ${{ parameters.prefix }} SPACY_NUM_BUILD_JOBS=2 python -m pip install dist/$SDIST
+      SPACY_NUM_BUILD_JOBS=${{ parameters.num_build_jobs }} python -m pip install dist/$SDIST
     displayName: "Install from sdist"
 
   - script: |
-      ${{ parameters.prefix }} python -m pip install -U -r requirements.txt
+      python -W error -c "import spacy"
-    displayName: "Install test requirements"
+    displayName: "Test import"
 
-  - script: |
+#  - script: |
-      ${{ parameters.prefix }} python -m pip install -U cupy-cuda110 -f https://github.com/cupy/cupy/releases/v9.0.0
+#      python -m spacy download ca_core_news_sm
-      ${{ parameters.prefix }} python -m pip install "torch==1.7.1+cu110" -f https://download.pytorch.org/whl/torch_stable.html
+#      python -m spacy download ca_core_news_md
-    displayName: "Install GPU requirements"
+#      python -c "import spacy; nlp=spacy.load('ca_core_news_sm'); doc=nlp('test')"
-    condition: eq(${{ parameters.gpu }}, true)
+#    displayName: 'Test download CLI'
-
+#    condition: eq(variables['python_version'], '3.8')
-  - script: |
+#
-      ${{ parameters.prefix }} python -m pytest --pyargs spacy -W error
+#  - script: |
-    displayName: "Run CPU tests"
+#      python -W error -c "import ca_core_news_sm; nlp = ca_core_news_sm.load(); doc=nlp('test')"
-    condition: eq(${{ parameters.gpu }}, false)
+#    displayName: 'Test no warnings on load (#11713)'
-
+#    condition: eq(variables['python_version'], '3.8')
-  - script: |
-      ${{ parameters.prefix }} python -m pytest --pyargs spacy -W error -p spacy.tests.enable_gpu
-    displayName: "Run GPU tests"
-    condition: eq(${{ parameters.gpu }}, true)
-
-  # Re-enable when we have models trained for spacy.TransitionBasedParser.v3.
-  #- script: |
-  #     python -m spacy download ca_core_news_sm
-  #     python -m spacy download ca_core_news_md
-  #     python -c "import spacy; nlp=spacy.load('ca_core_news_sm'); doc=nlp('test')"
-  #   displayName: 'Test download CLI'
-  #   condition: eq(variables['python_version'], '3.8')
 
   - script: |
       python -m spacy convert extra/example_data/ner_example_data/ner-token-per-line-conll2003.json .
@@ -94,27 +86,34 @@ steps:
     displayName: 'Test train CLI'
     condition: eq(variables['python_version'], '3.8')
 
-  # Re-enable when we have models trained for spacy.TransitionBasedParser.v3.
+#  - script: |
-  # - script: |
+#      python -c "import spacy; config = spacy.util.load_config('ner.cfg'); config['components']['ner'] = {'source': 'ca_core_news_sm'}; config.to_disk('ner_source_sm.cfg')"
-  #     python -c "import spacy; config = spacy.util.load_config('ner.cfg'); config['components']['ner'] = {'source': 'ca_core_news_sm'}; config.to_disk('ner_source_sm.cfg')"
+#      PYTHONWARNINGS="error,ignore::DeprecationWarning" python -m spacy assemble ner_source_sm.cfg output_dir
-  #     PYTHONWARNINGS="error,ignore::DeprecationWarning" python -m spacy assemble ner_source_sm.cfg output_dir
+#    displayName: 'Test assemble CLI'
-  #   displayName: 'Test assemble CLI'
+#    condition: eq(variables['python_version'], '3.8')
-  #   condition: eq(variables['python_version'], '3.8')
+#
+#  - script: |
+#      python -c "import spacy; config = spacy.util.load_config('ner.cfg'); config['components']['ner'] = {'source': 'ca_core_news_md'}; config.to_disk('ner_source_md.cfg')"
+#      python -m spacy assemble ner_source_md.cfg output_dir 2>&1 | grep -q W113
+#    displayName: 'Test assemble CLI vectors warning'
+#    condition: eq(variables['python_version'], '3.8')
 
-  # Re-enable when we have models trained for spacy.TransitionBasedParser.v3.
+  - script: |
-  # - script: |
+      python -m pip install -U -r requirements.txt
-  #     python -c "import spacy; config = spacy.util.load_config('ner.cfg'); config['components']['ner'] = {'source': 'ca_core_news_md'}; config.to_disk('ner_source_md.cfg')"
+    displayName: "Install test requirements"
-  #     python -m spacy assemble ner_source_md.cfg output_dir 2>&1 | grep -q W113
+
-  #   displayName: 'Test assemble CLI vectors warning'
+  - script: |
-  #   condition: eq(variables['python_version'], '3.8')
+      python -m pytest --pyargs spacy -W error
+    displayName: "Run CPU tests"
+
+  - script: |
+      python -m pip install 'spacy[apple]'
+      python -m pytest --pyargs spacy
+    displayName: "Run CPU tests with thinc-apple-ops"
+    condition: and(startsWith(variables['imageName'], 'macos'), eq(variables['python.version'], '3.11'))
 
   - script: |
       python .github/validate_universe_json.py website/meta/universe.json
     displayName: 'Test website/meta/universe.json'
     condition: eq(variables['python_version'], '3.8')
 
-  - script: |
-      ${{ parameters.prefix }} python -m pip install --pre thinc-apple-ops
-      ${{ parameters.prefix }} python -m pytest --pyargs spacy
-    displayName: "Run CPU tests with thinc-apple-ops"
-    condition: and(startsWith(variables['imageName'], 'macos'), eq(variables['python.version'], '3.10'))

.github/workflows/autoblack.yml

@@ -12,10 +12,10 @@ jobs:
     if: github.repository_owner == 'explosion'
     runs-on: ubuntu-latest
     steps:
-      - uses: actions/checkout@v2
+      - uses: actions/checkout@v3
         with:
             ref: ${{ github.head_ref }}
-      - uses: actions/setup-python@v2
+      - uses: actions/setup-python@v4
       - run: pip install black
       - name: Auto-format code if needed
         run: black spacy
@@ -23,10 +23,11 @@ jobs:
       # code and makes GitHub think the action failed
       - name: Check for modified files
         id: git-check
-        run: echo ::set-output name=modified::$(if git diff-index --quiet HEAD --; then echo "false"; else echo "true"; fi)
+        run: echo modified=$(if git diff-index --quiet HEAD --; then echo "false"; else echo "true"; fi) >> $GITHUB_OUTPUT
+
       - name: Create Pull Request
         if: steps.git-check.outputs.modified == 'true'
-        uses: peter-evans/create-pull-request@v3
+        uses: peter-evans/create-pull-request@v4
         with:
             title: Auto-format code with black
             labels: meta

.github/workflows/explosionbot.yml

@@ -8,14 +8,14 @@ on:
 
 jobs:
   explosion-bot:
-    runs-on: ubuntu-18.04
+    runs-on: ubuntu-latest
     steps:
       - name: Dump GitHub context
         env:
           GITHUB_CONTEXT: ${{ toJson(github) }}
         run: echo "$GITHUB_CONTEXT"
-      - uses: actions/checkout@v1
+      - uses: actions/checkout@v3
-      - uses: actions/setup-python@v1
+      - uses: actions/setup-python@v4
       - name: Install and run explosion-bot
         run: |
           pip install git+https://${{ secrets.EXPLOSIONBOT_TOKEN }}@github.com/explosion/explosion-bot

.github/workflows/lock.yml

@@ -15,11 +15,11 @@ jobs:
   action:
     runs-on: ubuntu-latest
     steps:
-      - uses: dessant/lock-threads@v3
+      - uses: dessant/lock-threads@v4
         with:
           process-only: 'issues'
           issue-inactive-days: '30'
-          issue-comment: > 
+          issue-comment: >
-            This thread has been automatically locked since there 
+            This thread has been automatically locked since there
-            has not been any recent activity after it was closed. 
+            has not been any recent activity after it was closed.
             Please open a new issue for related bugs.

.github/workflows/slowtests.yml

@@ -14,7 +14,7 @@ jobs:
     runs-on: ubuntu-latest
     steps:
       - name: Checkout
-        uses: actions/checkout@v1
+        uses: actions/checkout@v3
         with:
           ref: ${{ matrix.branch }}
       - name: Get commits from past 24 hours
@@ -23,9 +23,9 @@ jobs:
           today=$(date '+%Y-%m-%d %H:%M:%S')
           yesterday=$(date -d "yesterday" '+%Y-%m-%d %H:%M:%S')
           if git log --after="$yesterday" --before="$today" | grep commit ; then
-            echo "::set-output name=run_tests::true"
+            echo run_tests=true >> $GITHUB_OUTPUT
           else
-            echo "::set-output name=run_tests::false"
+            echo run_tests=false >> $GITHUB_OUTPUT
           fi
 
       - name: Trigger buildkite build

.github/workflows/spacy_universe_alert.yml

@@ -17,8 +17,10 @@ jobs:
         run: |
           echo "$GITHUB_CONTEXT"
 
-      - uses: actions/checkout@v1
+      - uses: actions/checkout@v3
-      - uses: actions/setup-python@v1
+      - uses: actions/setup-python@v4
+        with:
+          python-version: '3.10'
       - name: Install Bernadette app dependency and send an alert
         env:
           SLACK_BOT_TOKEN: ${{ secrets.SLACK_BOT_TOKEN }}

.gitignore

@@ -24,6 +24,7 @@ quickstart-training-generator.js
 cythonize.json
 spacy/*.html
 *.cpp
+*.c
 *.so
 
 # Vim / VSCode / editors

.pre-commit-config.yaml

@@ -5,8 +5,8 @@ repos:
     - id: black
       language_version: python3.7
       additional_dependencies: ['click==8.0.4']
--   repo: https://gitlab.com/pycqa/flake8
+-   repo: https://github.com/pycqa/flake8
-    rev: 3.9.2
+    rev: 5.0.4
     hooks:
     - id: flake8
       args:

README.md

@@ -8,15 +8,15 @@ be used in real products.
 
 spaCy comes with
 [pretrained pipelines](https://spacy.io/models) and
-currently supports tokenization and training for **60+ languages**. It features
+currently supports tokenization and training for **70+ languages**. It features
 state-of-the-art speed and **neural network models** for tagging,
 parsing, **named entity recognition**, **text classification** and more,
 multi-task learning with pretrained **transformers** like BERT, as well as a
 production-ready [**training system**](https://spacy.io/usage/training) and easy
 model packaging, deployment and workflow management. spaCy is commercial
-open-source software, released under the MIT license.
+open-source software, released under the [MIT license](https://github.com/explosion/spaCy/blob/master/LICENSE).
 
-💫 **Version 3.4.0 out now!**
+💫 **Version 3.4 out now!**
 [Check out the release notes here.](https://github.com/explosion/spaCy/releases)
 
 [![Azure Pipelines](https://img.shields.io/azure-devops/build/explosion-ai/public/8/master.svg?logo=azure-pipelines&style=flat-square&label=build)](https://dev.azure.com/explosion-ai/public/_build?definitionId=8)
@@ -46,6 +46,7 @@ open-source software, released under the MIT license.
 | 🛠 **[Changelog]**                                                                                                                                                                                                         | Changes and version history.                                                                                                                                                                                                                                                                                                 |
 | 💝 **[Contribute]**                                                                                                                                                                                                       | How to contribute to the spaCy project and code base.                                                                                                                                                                                                                                                                        |
 | <a href="https://explosion.ai/spacy-tailored-pipelines"><img src="https://user-images.githubusercontent.com/13643239/152853098-1c761611-ccb0-4ec6-9066-b234552831fe.png" width="125" alt="spaCy Tailored Pipelines"/></a> | Get a custom spaCy pipeline, tailor-made for your NLP problem by spaCy's core developers. Streamlined, production-ready, predictable and maintainable. Start by completing our 5-minute questionnaire to tell us what you need and we'll be in touch! **[Learn more &rarr;](https://explosion.ai/spacy-tailored-pipelines)** |
+| <a href="https://explosion.ai/spacy-tailored-analysis"><img src="https://user-images.githubusercontent.com/1019791/206151300-b00cd189-e503-4797-aa1e-1bb6344062c5.png" width="125" alt="spaCy Tailored Pipelines"/></a> | Bespoke advice for problem solving, strategy and analysis for applied NLP projects. Services include data strategy, code reviews, pipeline design and annotation coaching. Curious? Fill in our 5-minute questionnaire to tell us what you need and we'll be in touch! **[Learn more &rarr;](https://explosion.ai/spacy-tailored-analysis)** |
 
 [spacy 101]: https://spacy.io/usage/spacy-101
 [new in v3.0]: https://spacy.io/usage/v3
@@ -59,6 +60,7 @@ open-source software, released under the MIT license.
 [changelog]: https://spacy.io/usage#changelog
 [contribute]: https://github.com/explosion/spaCy/blob/master/CONTRIBUTING.md
 
+
 ## 💬 Where to ask questions
 
 The spaCy project is maintained by the [spaCy team](https://explosion.ai/about).
@@ -79,7 +81,7 @@ more people can benefit from it.
 
 ## Features
 
-- Support for **60+ languages**
+- Support for **70+ languages**
 - **Trained pipelines** for different languages and tasks
 - Multi-task learning with pretrained **transformers** like BERT
 - Support for pretrained **word vectors** and embeddings

azure-pipelines.yml

@@ -31,7 +31,7 @@ jobs:
         inputs:
           versionSpec: "3.7"
       - script: |
-          pip install flake8==3.9.2
+          pip install flake8==5.0.4
           python -m flake8 spacy --count --select=E901,E999,F821,F822,F823,W605 --show-source --statistics
         displayName: "flake8"
 
@@ -41,7 +41,7 @@ jobs:
       matrix:
         # We're only running one platform per Python version to speed up builds
         Python36Linux:
-          imageName: "ubuntu-latest"
+          imageName: "ubuntu-20.04"
           python.version: "3.6"
         #        Python36Windows:
         #          imageName: "windows-latest"
@@ -50,7 +50,7 @@ jobs:
         #          imageName: "macos-latest"
         #          python.version: "3.6"
         #        Python37Linux:
-        #          imageName: "ubuntu-latest"
+        #          imageName: "ubuntu-20.04"
         #          python.version: "3.7"
         Python37Windows:
           imageName: "windows-latest"
@@ -76,15 +76,24 @@ jobs:
         #        Python39Mac:
         #          imageName: "macos-latest"
         #          python.version: "3.9"
-        Python310Linux:
+        #        Python310Linux:
-          imageName: "ubuntu-latest"
+        #          imageName: "ubuntu-latest"
-          python.version: "3.10"
+        #          python.version: "3.10"
         Python310Windows:
           imageName: "windows-latest"
           python.version: "3.10"
-        Python310Mac:
+        #        Python310Mac:
-          imageName: "macos-latest"
+        #          imageName: "macos-latest"
-          python.version: "3.10"
+        #          python.version: "3.10"
+        Python311Linux:
+          imageName: 'ubuntu-latest'
+          python.version: '3.11'
+        Python311Windows:
+          imageName: 'windows-latest'
+          python.version: '3.11'
+        Python311Mac:
+          imageName: 'macos-latest'
+          python.version: '3.11'
       maxParallel: 4
     pool:
       vmImage: $(imageName)
@@ -92,20 +101,3 @@ jobs:
       - template: .github/azure-steps.yml
         parameters:
           python_version: '$(python.version)'
-          architecture: 'x64'
-
-#  - job: "TestGPU"
-#    dependsOn: "Validate"
-#    strategy:
-#      matrix:
-#        Python38LinuxX64_GPU:
-#          python.version: '3.8'
-#    pool:
-#      name: "LinuxX64_GPU"
-#    steps:
-#      - template: .github/azure-steps.yml
-#        parameters:
-#          python_version: '$(python.version)'
-#          architecture: 'x64'
-#          gpu: true
-#          num_build_jobs: 24

build-constraints.txt

@@ -5,4 +5,5 @@ numpy==1.17.3; python_version=='3.8' and platform_machine!='aarch64'
 numpy==1.19.2; python_version=='3.8' and platform_machine=='aarch64'
 numpy==1.19.3; python_version=='3.9'
 numpy==1.21.3; python_version=='3.10'
-numpy; python_version>='3.11'
+numpy==1.23.2; python_version=='3.11'
+numpy; python_version>='3.12'

extra/DEVELOPER_DOCS/Satellite Packages.md

@@ -0,0 +1,82 @@
+# spaCy Satellite Packages
+
+This is a list of all the active repos relevant to spaCy besides the main one, with short descriptions, history, and current status. Archived repos will not be covered.
+
+## Always Included in spaCy
+
+These packages are always pulled in when you install spaCy. Most of them are direct dependencies, but some are transitive dependencies through other packages.
+
+- [spacy-legacy](https://github.com/explosion/spacy-legacy): When an architecture in spaCy changes enough to get a new version, the old version is frozen and moved to spacy-legacy. This allows us to keep the core library slim while also preserving backwards compatability.
+- [thinc](https://github.com/explosion/thinc): Thinc is the machine learning library that powers trainable components in spaCy. It wraps backends like Numpy, PyTorch, and Tensorflow to provide a functional interface for specifying architectures.
+- [catalogue](https://github.com/explosion/catalogue): Small library for adding function registries, like those used for model architectures in spaCy.
+- [confection](https://github.com/explosion/confection): This library contains the functionality for config parsing that was formerly contained directly in Thinc.
+- [spacy-loggers](https://github.com/explosion/spacy-loggers): Contains loggers beyond the default logger available in spaCy's core code base. This includes loggers integrated with third-party services, which may differ in release cadence from spaCy itself.
+- [wasabi](https://github.com/explosion/wasabi): A command line formatting library, used for terminal output in spaCy.
+- [srsly](https://github.com/explosion/srsly): A wrapper that vendors several serialization libraries for spaCy. Includes parsers for JSON, JSONL, MessagePack, (extended) Pickle, and YAML.
+- [preshed](https://github.com/explosion/preshed): A Cython library for low-level data structures like hash maps, used for memory efficient data storage.
+- [cython-blis](https://github.com/explosion/cython-blis): Fast matrix multiplication using BLIS without depending on system libraries. Required by Thinc, rather than spaCy directly.
+- [murmurhash](https://github.com/explosion/murmurhash): A wrapper library for a C++ murmurhash implementation, used for string IDs in spaCy and preshed.
+- [cymem](https://github.com/explosion/cymem): A small library for RAII-style memory management in Cython. 
+
+## Optional Extensions for spaCy
+
+These are repos that can be used by spaCy but aren't part of a default installation. Many of these are wrappers to integrate various kinds of third-party libraries.
+
+- [spacy-transformers](https://github.com/explosion/spacy-transformers): A wrapper for the [HuggingFace Transformers](https://huggingface.co/docs/transformers/index) library, this handles the extensive conversion necessary to coordinate spaCy's powerful `Doc` representation, training pipeline, and the Transformer embeddings. When released, this was known as `spacy-pytorch-transformers`, but it changed to the current name when HuggingFace update the name of their library as well.
+- [spacy-huggingface-hub](https://github.com/explosion/spacy-huggingface-hub): This package has a CLI script for uploading a packaged spaCy pipeline (created with `spacy package`) to the [Hugging Face Hub](https://huggingface.co/models).
+- [spacy-alignments](https://github.com/explosion/spacy-alignments): A wrapper for the tokenizations library (mentioned below) with a modified build system to simplify cross-platform wheel creation. Used in spacy-transformers for aligning spaCy and HuggingFace tokenizations.
+- [spacy-experimental](https://github.com/explosion/spacy-experimental): Experimental components that are not quite ready for inclusion in the main spaCy library. Usually there are unresolved questions around their APIs, so the experimental library allows us to expose them to the community for feedback before fully integrating them. 
+- [spacy-lookups-data](https://github.com/explosion/spacy-lookups-data): A repository of linguistic data, such as lemmas, that takes up a lot of disk space. Originally created to reduce the size of the spaCy core library. This is mainly useful if you want the data included but aren't using a pretrained pipeline; for the affected languages, the relevant data is included in pretrained pipelines directly.
+- [coreferee](https://github.com/explosion/coreferee): Coreference resolution for English, French, German and Polish, optimised for limited training data and easily extensible for further languages. Used as a spaCy pipeline component.
+- [spacy-stanza](https://github.com/explosion/spacy-stanza): This is a wrapper that allows the use of Stanford's Stanza library in spaCy. 
+- [spacy-streamlit](https://github.com/explosion/spacy-streamlit): A wrapper for the Streamlit dashboard building library to help with integrating [displaCy](https://spacy.io/api/top-level/#displacy).
+- [spacymoji](https://github.com/explosion/spacymoji): A library to add extra support for emoji to spaCy, such as including character names.
+- [thinc-apple-ops](https://github.com/explosion/thinc-apple-ops): A special backend for OSX that uses Apple's native libraries for improved performance.
+- [os-signpost](https://github.com/explosion/os-signpost): A Python package that allows you to use the `OSSignposter` API in OSX for performance analysis.
+- [spacy-ray](https://github.com/explosion/spacy-ray): A wrapper to integrate spaCy with Ray, a distributed training framework. Currently a work in progress.
+
+## Prodigy
+
+[Prodigy](https://prodi.gy) is Explosion's easy to use and highly customizable tool for annotating data. Prodigy itself requires a license, but the repos below contain documentation, examples, and editor or notebook integrations.
+
+- [prodigy-recipes](https://github.com/explosion/prodigy-recipes): Sample recipes for Prodigy, along with notebooks and other examples of usage.
+- [vscode-prodigy](https://github.com/explosion/vscode-prodigy): A VS Code extension that lets you run Prodigy inside VS Code.
+- [jupyterlab-prodigy](https://github.com/explosion/jupyterlab-prodigy): An extension for JupyterLab that lets you run Prodigy inside JupyterLab.
+
+## Independent Tools or Projects
+
+These are tools that may be related to or use spaCy, but are functional independent projects in their own right as well.
+
+- [floret](https://github.com/explosion/floret): A modification of fastText to use Bloom Embeddings. Can be used to add vectors with subword features to spaCy, and also works independently in the same manner as fastText.
+- [sense2vec](https://github.com/explosion/sense2vec): A library to make embeddings of noun phrases or words coupled with their part of speech. This library uses spaCy.
+- [spacy-vectors-builder](https://github.com/explosion/spacy-vectors-builder): This is a spaCy project that builds vectors using floret and a lot of input text. It handles downloading the input data as well as the actual building of vectors.
+- [holmes-extractor](https://github.com/explosion/holmes-extractor): Information extraction from English and German texts based on predicate logic. Uses spaCy.
+- [healthsea](https://github.com/explosion/healthsea): Healthsea is a project to extract information from comments about health supplements. Structurally, it's a self-contained, large spaCy project.
+- [spacy-pkuseg](https://github.com/explosion/spacy-pkuseg): A fork of the pkuseg Chinese tokenizer. Used for Chinese support in spaCy, but also works independently.
+- [ml-datasets](https://github.com/explosion/ml-datasets): This repo includes loaders for several standard machine learning datasets, like MNIST or WikiNER, and has historically been used in spaCy example code and documentation.
+
+## Documentation and Informational Repos
+
+These repos are used to support the spaCy docs or otherwise present information about spaCy or other Explosion projects.
+
+- [projects](https://github.com/explosion/projects): The projects repo is used to show detailed examples of spaCy usage. Individual projects can be checked out using the spaCy command line tool, rather than checking out the projects repo directly.
+- [spacy-course](https://github.com/explosion/spacy-course): Home to the interactive spaCy course for learning about how to use the library and some basic NLP principles.
+- [spacy-io-binder](https://github.com/explosion/spacy-io-binder): Home to the notebooks used for interactive examples in the documentation.
+
+## Organizational / Meta
+
+These repos are used for organizing data around spaCy, but are not something an end user would need to install as part of using the library.
+
+- [spacy-models](https://github.com/explosion/spacy-models): This repo contains metadata (but not training data) for all the spaCy models. This includes information about where their training data came from, version compatability, and performance information. It also includes tests for the model packages, and the built models are hosted as releases of this repo.
+- [wheelwright](https://github.com/explosion/wheelwright): A tool for automating our PyPI builds and releases.
+- [ec2buildwheel](https://github.com/explosion/ec2buildwheel): A small project that allows you to build Python packages in the manner of cibuildwheel, but on any EC2 image. Used by wheelwright.
+
+## Other
+
+Repos that don't fit in any of the above categories.
+
+- [blis](https://github.com/explosion/blis): A fork of the official BLIS library. The main branch is not updated, but work continues in various branches. This is used for cython-blis.
+- [tokenizations](https://github.com/explosion/tokenizations): A library originally by Yohei Tamura to align strings with tolerance to some variations in features like case and diacritics, used for aligning tokens and wordpieces. Adopted and maintained by Explosion, but usually spacy-alignments is used instead.
+- [conll-2012](https://github.com/explosion/conll-2012): A repo to hold some slightly cleaned up versions of the official scripts for the CoNLL 2012 shared task involving coreference resolution. Used in the coref project.
+- [fastapi-explosion-extras](https://github.com/explosion/fastapi-explosion-extras): Some small tweaks to FastAPI used at Explosion.
+

licenses/3rd_party_licenses.txt

@@ -127,3 +127,34 @@ distributed under the License is distributed on an "AS IS" BASIS,
 WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
 See the License for the specific language governing permissions and
 limitations under the License.
+
+
+polyleven
+---------
+
+* Files: spacy/matcher/polyleven.c
+
+MIT License
+
+Copyright (c) 2021 Fujimoto Seiji <fujimoto@ceptord.net>
+Copyright (c) 2021 Max Bachmann <kontakt@maxbachmann.de>
+Copyright (c) 2022 Nick Mazuk
+Copyright (c) 2022 Michael Weiss <code@mweiss.ch>
+
+Permission is hereby granted, free of charge, to any person obtaining a copy
+of this software and associated documentation files (the "Software"), to deal
+in the Software without restriction, including without limitation the rights
+to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+copies of the Software, and to permit persons to whom the Software is
+furnished to do so, subject to the following conditions:
+
+The above copyright notice and this permission notice shall be included in all
+copies or substantial portions of the Software.
+
+THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+SOFTWARE.

pyproject.toml

@@ -5,7 +5,7 @@ requires = [
     "cymem>=2.0.2,<2.1.0",
     "preshed>=3.0.2,<3.1.0",
     "murmurhash>=0.28.0,<1.1.0",
-    "thinc>=8.1.0,<8.2.0",
+    "thinc>=9.0.0.dev1,<9.1.0",
     "numpy>=1.15.0",
 ]
 build-backend = "setuptools.build_meta"

requirements.txt

@@ -1,21 +1,22 @@
 # Our libraries
-spacy-legacy>=3.0.10,<3.1.0
+spacy-legacy>=3.0.11,<3.1.0
 spacy-loggers>=1.0.0,<2.0.0
 cymem>=2.0.2,<2.1.0
 preshed>=3.0.2,<3.1.0
-thinc>=8.1.0,<8.2.0
+thinc>=9.0.0.dev1,<9.1.0
 ml_datasets>=0.2.0,<0.3.0
 murmurhash>=0.28.0,<1.1.0
-wasabi>=0.9.1,<1.1.0
+wasabi>=0.9.1,<1.2.0
 srsly>=2.4.3,<3.0.0
 catalogue>=2.0.6,<2.1.0
-typer>=0.3.0,<0.5.0
+typer>=0.3.0,<0.8.0
-pathy>=0.3.5
+pathy>=0.10.0
+smart-open>=5.2.1,<7.0.0
 # Third party dependencies
 numpy>=1.15.0
 requests>=2.13.0,<3.0.0
 tqdm>=4.38.0,<5.0.0
-pydantic>=1.7.4,!=1.8,!=1.8.1,<1.10.0
+pydantic>=1.7.4,!=1.8,!=1.8.1,<1.11.0
 jinja2
 langcodes>=3.2.0,<4.0.0
 # Official Python utilities
@@ -28,11 +29,12 @@ cython>=0.25,<3.0
 pytest>=5.2.0,!=7.1.0
 pytest-timeout>=1.3.0,<2.0.0
 mock>=2.0.0,<3.0.0
-flake8>=3.8.0,<3.10.0
+flake8>=3.8.0,<6.0.0
 hypothesis>=3.27.0,<7.0.0
-mypy>=0.910,<0.970; platform_machine!='aarch64'
+mypy>=0.990,<0.1000; platform_machine != "aarch64" and python_version >= "3.7"
 types-dataclasses>=0.1.3; python_version < "3.7"
 types-mock>=0.1.1
+types-setuptools>=57.0.0
 types-requests
 types-setuptools>=57.0.0
 black>=22.0,<23.0

setup.cfg

@@ -22,6 +22,7 @@ classifiers =
     Programming Language :: Python :: 3.8
     Programming Language :: Python :: 3.9
     Programming Language :: Python :: 3.10
+    Programming Language :: Python :: 3.11
     Topic :: Scientific/Engineering
 project_urls =
     Release notes = https://github.com/explosion/spaCy/releases
@@ -33,22 +34,23 @@ include_package_data = true
 python_requires = >=3.6
 install_requires =
     # Our libraries
-    spacy-legacy>=3.0.10,<3.1.0
+    spacy-legacy>=3.0.11,<3.1.0
     spacy-loggers>=1.0.0,<2.0.0
     murmurhash>=0.28.0,<1.1.0
     cymem>=2.0.2,<2.1.0
     preshed>=3.0.2,<3.1.0
-    thinc>=8.1.0,<8.2.0
+    thinc>=9.0.0.dev1,<9.1.0
-    wasabi>=0.9.1,<1.1.0
+    wasabi>=0.9.1,<1.2.0
     srsly>=2.4.3,<3.0.0
     catalogue>=2.0.6,<2.1.0
     # Third-party dependencies
-    typer>=0.3.0,<0.5.0
+    typer>=0.3.0,<0.8.0
-    pathy>=0.3.5
+    pathy>=0.10.0
+    smart-open>=5.2.1,<7.0.0
     tqdm>=4.38.0,<5.0.0
     numpy>=1.15.0
     requests>=2.13.0,<3.0.0
-    pydantic>=1.7.4,!=1.8,!=1.8.1,<1.10.0
+    pydantic>=1.7.4,!=1.8,!=1.8.1,<1.11.0
     jinja2
     # Official Python utilities
     setuptools
@@ -68,37 +70,41 @@ transformers =
 ray =
     spacy_ray>=0.1.0,<1.0.0
 cuda =
-    cupy>=5.0.0b4,<11.0.0
+    cupy>=5.0.0b4,<12.0.0
 cuda80 =
-    cupy-cuda80>=5.0.0b4,<11.0.0
+    cupy-cuda80>=5.0.0b4,<12.0.0
 cuda90 =
-    cupy-cuda90>=5.0.0b4,<11.0.0
+    cupy-cuda90>=5.0.0b4,<12.0.0
 cuda91 =
-    cupy-cuda91>=5.0.0b4,<11.0.0
+    cupy-cuda91>=5.0.0b4,<12.0.0
 cuda92 =
-    cupy-cuda92>=5.0.0b4,<11.0.0
+    cupy-cuda92>=5.0.0b4,<12.0.0
 cuda100 =
-    cupy-cuda100>=5.0.0b4,<11.0.0
+    cupy-cuda100>=5.0.0b4,<12.0.0
 cuda101 =
-    cupy-cuda101>=5.0.0b4,<11.0.0
+    cupy-cuda101>=5.0.0b4,<12.0.0
 cuda102 =
-    cupy-cuda102>=5.0.0b4,<11.0.0
+    cupy-cuda102>=5.0.0b4,<12.0.0
 cuda110 =
-    cupy-cuda110>=5.0.0b4,<11.0.0
+    cupy-cuda110>=5.0.0b4,<12.0.0
 cuda111 =
-    cupy-cuda111>=5.0.0b4,<11.0.0
+    cupy-cuda111>=5.0.0b4,<12.0.0
 cuda112 =
-    cupy-cuda112>=5.0.0b4,<11.0.0
+    cupy-cuda112>=5.0.0b4,<12.0.0
 cuda113 =
-    cupy-cuda113>=5.0.0b4,<11.0.0
+    cupy-cuda113>=5.0.0b4,<12.0.0
 cuda114 =
-    cupy-cuda114>=5.0.0b4,<11.0.0
+    cupy-cuda114>=5.0.0b4,<12.0.0
 cuda115 =
-    cupy-cuda115>=5.0.0b4,<11.0.0
+    cupy-cuda115>=5.0.0b4,<12.0.0
 cuda116 =
-    cupy-cuda116>=5.0.0b4,<11.0.0
+    cupy-cuda116>=5.0.0b4,<12.0.0
 cuda117 =
-    cupy-cuda117>=5.0.0b4,<11.0.0
+    cupy-cuda117>=5.0.0b4,<12.0.0
+cuda11x =
+    cupy-cuda11x>=11.0.0,<12.0.0
+cuda-autodetect =
+    cupy-wheel>=11.0.0,<12.0.0
 apple =
     thinc-apple-ops>=0.1.0.dev0,<1.0.0
 # Language tokenizers with external dependencies

setup.py

@@ -30,12 +30,14 @@ MOD_NAMES = [
     "spacy.lexeme",
     "spacy.vocab",
     "spacy.attrs",
-    "spacy.kb",
+    "spacy.kb.candidate",
+    "spacy.kb.kb",
+    "spacy.kb.kb_in_memory",
+    "spacy.ml.parser_model",
     "spacy.ml.tb_framework",
     "spacy.morphology",
     "spacy.pipeline._edit_tree_internals.edit_trees",
     "spacy.pipeline.morphologizer",
-    "spacy.pipeline.multitask",
     "spacy.pipeline.pipe",
     "spacy.pipeline.trainable_pipe",
     "spacy.pipeline.sentencizer",
@@ -207,6 +209,17 @@ def setup_package():
         get_python_inc(plat_specific=True),
     ]
     ext_modules = []
+    ext_modules.append(
+        Extension(
+            "spacy.matcher.levenshtein",
+            [
+                "spacy/matcher/levenshtein.pyx",
+                "spacy/matcher/polyleven.c",
+            ],
+            language="c",
+            include_dirs=include_dirs,
+        )
+    )
     for name in MOD_NAMES:
         mod_path = name.replace(".", "/") + ".pyx"
         ext = Extension(

spacy/__init__.py

@@ -31,9 +31,9 @@ def load(
     name: Union[str, Path],
     *,
     vocab: Union[Vocab, bool] = True,
-    disable: Union[str, Iterable[str]] = util.SimpleFrozenList(),
+    disable: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES,
-    enable: Union[str, Iterable[str]] = util.SimpleFrozenList(),
+    enable: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES,
-    exclude: Union[str, Iterable[str]] = util.SimpleFrozenList(),
+    exclude: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES,
     config: Union[Dict[str, Any], Config] = util.SimpleFrozenDict(),
 ) -> Language:
     """Load a spaCy model from an installed package or a local path.

spacy/about.py

@@ -1,6 +1,6 @@
 # fmt: off
 __title__ = "spacy"
-__version__ = "3.4.1"
+__version__ = "3.5.0"
 __download_url__ = "https://github.com/explosion/spacy-models/releases/download"
 __compatibility__ = "https://raw.githubusercontent.com/explosion/spacy-models/master/compatibility.json"
 __projects__ = "https://github.com/explosion/projects"

spacy/cli/__init__.py

@@ -16,6 +16,7 @@ from .debug_config import debug_config  # noqa: F401
 from .debug_model import debug_model  # noqa: F401
 from .debug_diff import debug_diff  # noqa: F401
 from .evaluate import evaluate  # noqa: F401
+from .apply import apply  # noqa: F401
 from .convert import convert  # noqa: F401
 from .init_pipeline import init_pipeline_cli  # noqa: F401
 from .init_config import init_config, fill_config  # noqa: F401
@@ -27,6 +28,7 @@ from .project.dvc import project_update_dvc  # noqa: F401
 from .project.push import project_push  # noqa: F401
 from .project.pull import project_pull  # noqa: F401
 from .project.document import project_document  # noqa: F401
+from .find_threshold import find_threshold  # noqa: F401
 
 
 @app.command("link", no_args_is_help=True, deprecated=True, hidden=True)

spacy/cli/_util.py

@@ -23,7 +23,7 @@ from ..util import is_compatible_version, SimpleFrozenDict, ENV_VARS
 from .. import about
 
 if TYPE_CHECKING:
-    from pathy import Pathy  # noqa: F401
+    from pathy import FluidPath  # noqa: F401
 
 
 SDIST_SUFFIX = ".tar.gz"
@@ -158,15 +158,15 @@ def load_project_config(
         sys.exit(1)
     validate_project_version(config)
     validate_project_commands(config)
+    if interpolate:
+        err = f"{PROJECT_FILE} validation error"
+        with show_validation_error(title=err, hint_fill=False):
+            config = substitute_project_variables(config, overrides)
     # Make sure directories defined in config exist
     for subdir in config.get("directories", []):
         dir_path = path / subdir
         if not dir_path.exists():
             dir_path.mkdir(parents=True)
-    if interpolate:
-        err = f"{PROJECT_FILE} validation error"
-        with show_validation_error(title=err, hint_fill=False):
-            config = substitute_project_variables(config, overrides)
     return config
 
 
@@ -331,7 +331,7 @@ def import_code(code_path: Optional[Union[Path, str]]) -> None:
             msg.fail(f"Couldn't load Python code: {code_path}", e, exits=1)
 
 
-def upload_file(src: Path, dest: Union[str, "Pathy"]) -> None:
+def upload_file(src: Path, dest: Union[str, "FluidPath"]) -> None:
     """Upload a file.
 
     src (Path): The source path.
@@ -339,13 +339,20 @@ def upload_file(src: Path, dest: Union[str, "Pathy"]) -> None:
     """
     import smart_open
 
+    # Create parent directories for local paths
+    if isinstance(dest, Path):
+        if not dest.parent.exists():
+            dest.parent.mkdir(parents=True)
+
     dest = str(dest)
     with smart_open.open(dest, mode="wb") as output_file:
         with src.open(mode="rb") as input_file:
             output_file.write(input_file.read())
 
 
-def download_file(src: Union[str, "Pathy"], dest: Path, *, force: bool = False) -> None:
+def download_file(
+    src: Union[str, "FluidPath"], dest: Path, *, force: bool = False
+) -> None:
     """Download a file using smart_open.
 
     url (str): The URL of the file.
@@ -358,7 +365,7 @@ def download_file(src: Union[str, "Pathy"], dest: Path, *, force: bool = False)
     if dest.exists() and not force:
         return None
     src = str(src)
-    with smart_open.open(src, mode="rb", ignore_ext=True) as input_file:
+    with smart_open.open(src, mode="rb", compression="disable") as input_file:
         with dest.open(mode="wb") as output_file:
             shutil.copyfileobj(input_file, output_file)
 
@@ -368,7 +375,7 @@ def ensure_pathy(path):
     slow and annoying Google Cloud warning)."""
     from pathy import Pathy  # noqa: F811
 
-    return Pathy(path)
+    return Pathy.fluid(path)
 
 
 def git_checkout(
@@ -573,3 +580,35 @@ def setup_gpu(use_gpu: int, silent=None) -> None:
         local_msg.info("Using CPU")
         if gpu_is_available():
             local_msg.info("To switch to GPU 0, use the option: --gpu-id 0")
+
+
+def walk_directory(path: Path, suffix: Optional[str] = None) -> List[Path]:
+    if not path.is_dir():
+        return [path]
+    paths = [path]
+    locs = []
+    seen = set()
+    for path in paths:
+        if str(path) in seen:
+            continue
+        seen.add(str(path))
+        if path.parts[-1].startswith("."):
+            continue
+        elif path.is_dir():
+            paths.extend(path.iterdir())
+        elif suffix is not None and not path.parts[-1].endswith(suffix):
+            continue
+        else:
+            locs.append(path)
+    # It's good to sort these, in case the ordering messes up cache.
+    locs.sort()
+    return locs
+
+
+def _format_number(number: Union[int, float], ndigits: int = 2) -> str:
+    """Formats a number (float or int) rounding to `ndigits`, without truncating trailing 0s,
+    as happens with `round(number, ndigits)`"""
+    if isinstance(number, float):
+        return f"{number:.{ndigits}f}"
+    else:
+        return str(number)

spacy/cli/apply.py

@@ -0,0 +1,143 @@
+import tqdm
+import srsly
+
+from itertools import chain
+from pathlib import Path
+from typing import Optional, List, Iterable, cast, Union
+
+from wasabi import msg
+
+from ._util import app, Arg, Opt, setup_gpu, import_code, walk_directory
+
+from ..tokens import Doc, DocBin
+from ..vocab import Vocab
+from ..util import ensure_path, load_model
+
+
+path_help = """Location of the documents to predict on.
+Can be a single file in .spacy format or a .jsonl file.
+Files with other extensions are treated as single plain text documents.
+If a directory is provided it is traversed recursively to grab
+all files to be processed.
+The files can be a mixture of .spacy, .jsonl and text files.
+If .jsonl is provided the specified field is going
+to be grabbed ("text" by default)."""
+
+out_help = "Path to save the resulting .spacy file"
+code_help = (
+    "Path to Python file with additional " "code (registered functions) to be imported"
+)
+gold_help = "Use gold preprocessing provided in the .spacy files"
+force_msg = (
+    "The provided output file already exists. "
+    "To force overwriting the output file, set the --force or -F flag."
+)
+
+
+DocOrStrStream = Union[Iterable[str], Iterable[Doc]]
+
+
+def _stream_docbin(path: Path, vocab: Vocab) -> Iterable[Doc]:
+    """
+    Stream Doc objects from DocBin.
+    """
+    docbin = DocBin().from_disk(path)
+    for doc in docbin.get_docs(vocab):
+        yield doc
+
+
+def _stream_jsonl(path: Path, field: str) -> Iterable[str]:
+    """
+    Stream "text" field from JSONL. If the field "text" is
+    not found it raises error.
+    """
+    for entry in srsly.read_jsonl(path):
+        if field not in entry:
+            msg.fail(f"{path} does not contain the required '{field}' field.", exits=1)
+        else:
+            yield entry[field]
+
+
+def _stream_texts(paths: Iterable[Path]) -> Iterable[str]:
+    """
+    Yields strings from text files in paths.
+    """
+    for path in paths:
+        with open(path, "r") as fin:
+            text = fin.read()
+            yield text
+
+
+@app.command("apply")
+def apply_cli(
+    # fmt: off
+    model: str = Arg(..., help="Model name or path"),
+    data_path: Path = Arg(..., help=path_help, exists=True),
+    output_file: Path = Arg(..., help=out_help, dir_okay=False),
+    code_path: Optional[Path] = Opt(None, "--code", "-c", help=code_help),
+    text_key: str = Opt("text", "--text-key", "-tk", help="Key containing text string for JSONL"),
+    force_overwrite: bool = Opt(False, "--force", "-F", help="Force overwriting the output file"),
+    use_gpu: int = Opt(-1, "--gpu-id", "-g", help="GPU ID or -1 for CPU."),
+    batch_size: int = Opt(1, "--batch-size", "-b", help="Batch size."),
+    n_process: int = Opt(1, "--n-process", "-n", help="number of processors to use.")
+):
+    """
+    Apply a trained pipeline to documents to get predictions.
+    Expects a loadable spaCy pipeline and path to the data, which
+    can be a directory or a file.
+    The data files can be provided in multiple formats:
+        1. .spacy files
+        2. .jsonl files with a specified "field" to read the text from.
+        3. Files with any other extension are assumed to be containing
+           a single document.
+    DOCS: https://spacy.io/api/cli#apply
+    """
+    data_path = ensure_path(data_path)
+    output_file = ensure_path(output_file)
+    code_path = ensure_path(code_path)
+    if output_file.exists() and not force_overwrite:
+        msg.fail(force_msg, exits=1)
+    if not data_path.exists():
+        msg.fail(f"Couldn't find data path: {data_path}", exits=1)
+    import_code(code_path)
+    setup_gpu(use_gpu)
+    apply(data_path, output_file, model, text_key, batch_size, n_process)
+
+
+def apply(
+    data_path: Path,
+    output_file: Path,
+    model: str,
+    json_field: str,
+    batch_size: int,
+    n_process: int,
+):
+    docbin = DocBin(store_user_data=True)
+    paths = walk_directory(data_path)
+    if len(paths) == 0:
+        docbin.to_disk(output_file)
+        msg.warn(
+            "Did not find data to process,"
+            f" {data_path} seems to be an empty directory."
+        )
+        return
+    nlp = load_model(model)
+    msg.good(f"Loaded model {model}")
+    vocab = nlp.vocab
+    streams: List[DocOrStrStream] = []
+    text_files = []
+    for path in paths:
+        if path.suffix == ".spacy":
+            streams.append(_stream_docbin(path, vocab))
+        elif path.suffix == ".jsonl":
+            streams.append(_stream_jsonl(path, json_field))
+        else:
+            text_files.append(path)
+    if len(text_files) > 0:
+        streams.append(_stream_texts(text_files))
+    datagen = cast(DocOrStrStream, chain(*streams))
+    for doc in tqdm.tqdm(nlp.pipe(datagen, batch_size=batch_size, n_process=n_process)):
+        docbin.add(doc)
+    if output_file.suffix == "":
+        output_file = output_file.with_suffix(".spacy")
+    docbin.to_disk(output_file)

spacy/cli/convert.py

@@ -1,4 +1,4 @@
-from typing import Callable, Iterable, Mapping, Optional, Any, List, Union
+from typing import Callable, Iterable, Mapping, Optional, Any, Union
 from enum import Enum
 from pathlib import Path
 from wasabi import Printer
@@ -7,7 +7,7 @@ import re
 import sys
 import itertools
 
-from ._util import app, Arg, Opt
+from ._util import app, Arg, Opt, walk_directory
 from ..training import docs_to_json
 from ..tokens import Doc, DocBin
 from ..training.converters import iob_to_docs, conll_ner_to_docs, json_to_docs
@@ -189,33 +189,6 @@ def autodetect_ner_format(input_data: str) -> Optional[str]:
     return None
 
 
-def walk_directory(path: Path, converter: str) -> List[Path]:
-    if not path.is_dir():
-        return [path]
-    paths = [path]
-    locs = []
-    seen = set()
-    for path in paths:
-        if str(path) in seen:
-            continue
-        seen.add(str(path))
-        if path.parts[-1].startswith("."):
-            continue
-        elif path.is_dir():
-            paths.extend(path.iterdir())
-        elif converter == "json" and not path.parts[-1].endswith("json"):
-            continue
-        elif converter == "conll" and not path.parts[-1].endswith("conll"):
-            continue
-        elif converter == "iob" and not path.parts[-1].endswith("iob"):
-            continue
-        else:
-            locs.append(path)
-    # It's good to sort these, in case the ordering messes up cache.
-    locs.sort()
-    return locs
-
-
 def verify_cli_args(
     msg: Printer,
     input_path: Path,

spacy/cli/debug_data.py

@@ -9,10 +9,11 @@ import typer
 import math
 
 from ._util import app, Arg, Opt, show_validation_error, parse_config_overrides
-from ._util import import_code, debug_cli
+from ._util import import_code, debug_cli, _format_number
 from ..training import Example, remove_bilu_prefix
 from ..training.initialize import get_sourced_components
 from ..schemas import ConfigSchemaTraining
+from ..pipeline import TrainablePipe
 from ..pipeline._parser_internals import nonproj
 from ..pipeline._parser_internals.nonproj import DELIMITER
 from ..pipeline import Morphologizer, SpanCategorizer
@@ -934,6 +935,7 @@ def _get_labels_from_model(nlp: Language, factory_name: str) -> Set[str]:
     labels: Set[str] = set()
     for pipe_name in pipe_names:
         pipe = nlp.get_pipe(pipe_name)
+        assert isinstance(pipe, TrainablePipe)
         labels.update(pipe.labels)
     return labels
 
@@ -989,7 +991,8 @@ def _get_kl_divergence(p: Counter, q: Counter) -> float:
 def _format_span_row(span_data: List[Dict], labels: List[str]) -> List[Any]:
     """Compile into one list for easier reporting"""
     d = {
-        label: [label] + list(round(d[label], 2) for d in span_data) for label in labels
+        label: [label] + list(_format_number(d[label]) for d in span_data)
+        for label in labels
     }
     return list(d.values())
 
@@ -1004,6 +1007,10 @@ def _get_span_characteristics(
         label: _gmean(l)
         for label, l in compiled_gold["spans_length"][spans_key].items()
     }
+    spans_per_type = {
+        label: len(spans)
+        for label, spans in compiled_gold["spans_per_type"][spans_key].items()
+    }
     min_lengths = [min(l) for l in compiled_gold["spans_length"][spans_key].values()]
     max_lengths = [max(l) for l in compiled_gold["spans_length"][spans_key].values()]
 
@@ -1031,6 +1038,7 @@ def _get_span_characteristics(
     return {
         "sd": span_distinctiveness,
         "bd": sb_distinctiveness,
+        "spans_per_type": spans_per_type,
         "lengths": span_length,
         "min_length": min(min_lengths),
         "max_length": max(max_lengths),
@@ -1045,12 +1053,15 @@ def _get_span_characteristics(
 
 def _print_span_characteristics(span_characteristics: Dict[str, Any]):
     """Print all span characteristics into a table"""
-    headers = ("Span Type", "Length", "SD", "BD")
+    headers = ("Span Type", "Length", "SD", "BD", "N")
+    # Wasabi has this at 30 by default, but we might have some long labels
+    max_col = max(30, max(len(label) for label in span_characteristics["labels"]))
     # Prepare table data with all span characteristics
     table_data = [
         span_characteristics["lengths"],
         span_characteristics["sd"],
         span_characteristics["bd"],
+        span_characteristics["spans_per_type"],
     ]
     table = _format_span_row(
         span_data=table_data, labels=span_characteristics["labels"]
@@ -1061,8 +1072,18 @@ def _print_span_characteristics(span_characteristics: Dict[str, Any]):
         span_characteristics["avg_sd"],
         span_characteristics["avg_bd"],
     ]
-    footer = ["Wgt. Average"] + [str(round(f, 2)) for f in footer_data]
+
-    msg.table(table, footer=footer, header=headers, divider=True)
+    footer = (
+        ["Wgt. Average"] + ["{:.2f}".format(round(f, 2)) for f in footer_data] + ["-"]
+    )
+    msg.table(
+        table,
+        footer=footer,
+        header=headers,
+        divider=True,
+        aligns=["l"] + ["r"] * (len(footer_data) + 1),
+        max_col=max_col,
+    )
 
 
 def _get_spans_length_freq_dist(

spacy/cli/download.py

@@ -8,7 +8,6 @@ from ._util import app, Arg, Opt, WHEEL_SUFFIX, SDIST_SUFFIX
 from .. import about
 from ..util import is_package, get_minor_version, run_command
 from ..util import is_prerelease_version
-from ..errors import OLD_MODEL_SHORTCUTS
 
 
 @app.command(
@@ -61,12 +60,6 @@ def download(
         version = components[-1]
     else:
         model_name = model
-        if model in OLD_MODEL_SHORTCUTS:
-            msg.warn(
-                f"As of spaCy v3.0, shortcuts like '{model}' are deprecated. Please "
-                f"use the full pipeline package name '{OLD_MODEL_SHORTCUTS[model]}' instead."
-            )
-            model_name = OLD_MODEL_SHORTCUTS[model]
         compatibility = get_compatibility()
         version = get_version(model_name, compatibility)
 

spacy/cli/find_threshold.py

@@ -0,0 +1,233 @@
+import functools
+import operator
+from pathlib import Path
+import logging
+from typing import Optional, Tuple, Any, Dict, List
+
+import numpy
+import wasabi.tables
+
+from ..pipeline import TextCategorizer, MultiLabel_TextCategorizer
+from ..errors import Errors
+from ..training import Corpus
+from ._util import app, Arg, Opt, import_code, setup_gpu
+from .. import util
+
+_DEFAULTS = {
+    "n_trials": 11,
+    "use_gpu": -1,
+    "gold_preproc": False,
+}
+
+
+@app.command(
+    "find-threshold",
+    context_settings={"allow_extra_args": False, "ignore_unknown_options": True},
+)
+def find_threshold_cli(
+    # fmt: off
+    model: str = Arg(..., help="Model name or path"),
+    data_path: Path = Arg(..., help="Location of binary evaluation data in .spacy format", exists=True),
+    pipe_name: str = Arg(..., help="Name of pipe to examine thresholds for"),
+    threshold_key: str = Arg(..., help="Key of threshold attribute in component's configuration"),
+    scores_key: str = Arg(..., help="Metric to optimize"),
+    n_trials: int = Opt(_DEFAULTS["n_trials"], "--n_trials", "-n", help="Number of trials to determine optimal thresholds"),
+    code_path: Optional[Path] = Opt(None, "--code", "-c", help="Path to Python file with additional code (registered functions) to be imported"),
+    use_gpu: int = Opt(_DEFAULTS["use_gpu"], "--gpu-id", "-g", help="GPU ID or -1 for CPU"),
+    gold_preproc: bool = Opt(_DEFAULTS["gold_preproc"], "--gold-preproc", "-G", help="Use gold preprocessing"),
+    verbose: bool = Opt(False, "--silent", "-V", "-VV", help="Display more information for debugging purposes"),
+    # fmt: on
+):
+    """
+    Runs prediction trials for a trained model with varying tresholds to maximize
+    the specified metric. The search space for the threshold is traversed linearly
+    from 0 to 1 in `n_trials` steps. Results are displayed in a table on `stdout`
+    (the corresponding API call to `spacy.cli.find_threshold.find_threshold()`
+    returns all results).
+
+    This is applicable only for components whose predictions are influenced by
+    thresholds - e.g. `textcat_multilabel` and `spancat`, but not `textcat`. Note
+    that the full path to the corresponding threshold attribute in the config has to
+    be provided.
+
+    DOCS: https://spacy.io/api/cli#find-threshold
+    """
+
+    util.logger.setLevel(logging.DEBUG if verbose else logging.INFO)
+    import_code(code_path)
+    find_threshold(
+        model=model,
+        data_path=data_path,
+        pipe_name=pipe_name,
+        threshold_key=threshold_key,
+        scores_key=scores_key,
+        n_trials=n_trials,
+        use_gpu=use_gpu,
+        gold_preproc=gold_preproc,
+        silent=False,
+    )
+
+
+def find_threshold(
+    model: str,
+    data_path: Path,
+    pipe_name: str,
+    threshold_key: str,
+    scores_key: str,
+    *,
+    n_trials: int = _DEFAULTS["n_trials"],  # type: ignore
+    use_gpu: int = _DEFAULTS["use_gpu"],  # type: ignore
+    gold_preproc: bool = _DEFAULTS["gold_preproc"],  # type: ignore
+    silent: bool = True,
+) -> Tuple[float, float, Dict[float, float]]:
+    """
+    Runs prediction trials for models with varying tresholds to maximize the specified metric.
+    model (Union[str, Path]): Pipeline to evaluate. Can be a package or a path to a data directory.
+    data_path (Path): Path to file with DocBin with docs to use for threshold search.
+    pipe_name (str): Name of pipe to examine thresholds for.
+    threshold_key (str): Key of threshold attribute in component's configuration.
+    scores_key (str): Name of score to metric to optimize.
+    n_trials (int): Number of trials to determine optimal thresholds.
+    use_gpu (int): GPU ID or -1 for CPU.
+    gold_preproc (bool): Whether to use gold preprocessing. Gold preprocessing helps the annotations align to the
+        tokenization, and may result in sequences of more consistent length. However, it may reduce runtime accuracy due
+        to train/test skew.
+    silent (bool): Whether to print non-error-related output to stdout.
+    RETURNS (Tuple[float, float, Dict[float, float]]): Best found threshold, the corresponding score, scores for all
+        evaluated thresholds.
+    """
+
+    setup_gpu(use_gpu, silent=silent)
+    data_path = util.ensure_path(data_path)
+    if not data_path.exists():
+        wasabi.msg.fail("Evaluation data not found", data_path, exits=1)
+    nlp = util.load_model(model)
+
+    if pipe_name not in nlp.component_names:
+        raise AttributeError(
+            Errors.E001.format(name=pipe_name, opts=nlp.component_names)
+        )
+    pipe = nlp.get_pipe(pipe_name)
+    if not hasattr(pipe, "scorer"):
+        raise AttributeError(Errors.E1045)
+
+    if type(pipe) == TextCategorizer:
+        wasabi.msg.warn(
+            "The `textcat` component doesn't use a threshold as it's not applicable to the concept of "
+            "exclusive classes. All thresholds will yield the same results."
+        )
+
+    if not silent:
+        wasabi.msg.info(
+            title=f"Optimizing for {scores_key} for component '{pipe_name}' with {n_trials} "
+            f"trials."
+        )
+
+    # Load evaluation corpus.
+    corpus = Corpus(data_path, gold_preproc=gold_preproc)
+    dev_dataset = list(corpus(nlp))
+    config_keys = threshold_key.split(".")
+
+    def set_nested_item(
+        config: Dict[str, Any], keys: List[str], value: float
+    ) -> Dict[str, Any]:
+        """Set item in nested dictionary. Adapted from https://stackoverflow.com/a/54138200.
+        config (Dict[str, Any]): Configuration dictionary.
+        keys (List[Any]): Path to value to set.
+        value (float): Value to set.
+        RETURNS (Dict[str, Any]): Updated dictionary.
+        """
+        functools.reduce(operator.getitem, keys[:-1], config)[keys[-1]] = value
+        return config
+
+    def filter_config(
+        config: Dict[str, Any], keys: List[str], full_key: str
+    ) -> Dict[str, Any]:
+        """Filters provided config dictionary so that only the specified keys path remains.
+        config (Dict[str, Any]): Configuration dictionary.
+        keys (List[Any]): Path to value to set.
+        full_key (str): Full user-specified key.
+        RETURNS (Dict[str, Any]): Filtered dictionary.
+        """
+        if keys[0] not in config:
+            wasabi.msg.fail(
+                title=f"Failed to look up `{full_key}` in config: sub-key {[keys[0]]} not found.",
+                text=f"Make sure you specified {[keys[0]]} correctly. The following sub-keys are available instead: "
+                f"{list(config.keys())}",
+                exits=1,
+            )
+        return {
+            keys[0]: filter_config(config[keys[0]], keys[1:], full_key)
+            if len(keys) > 1
+            else config[keys[0]]
+        }
+
+    # Evaluate with varying threshold values.
+    scores: Dict[float, float] = {}
+    config_keys_full = ["components", pipe_name, *config_keys]
+    table_col_widths = (10, 10)
+    thresholds = numpy.linspace(0, 1, n_trials)
+    print(wasabi.tables.row(["Threshold", f"{scores_key}"], widths=table_col_widths))
+    for threshold in thresholds:
+        # Reload pipeline with overrides specifying the new threshold.
+        nlp = util.load_model(
+            model,
+            config=set_nested_item(
+                filter_config(
+                    nlp.config, config_keys_full, ".".join(config_keys_full)
+                ).copy(),
+                config_keys_full,
+                threshold,
+            ),
+        )
+        if hasattr(pipe, "cfg"):
+            setattr(
+                nlp.get_pipe(pipe_name),
+                "cfg",
+                set_nested_item(getattr(pipe, "cfg"), config_keys, threshold),
+            )
+
+        eval_scores = nlp.evaluate(dev_dataset)
+        if scores_key not in eval_scores:
+            wasabi.msg.fail(
+                title=f"Failed to look up score `{scores_key}` in evaluation results.",
+                text=f"Make sure you specified the correct value for `scores_key`. The following scores are "
+                f"available: {list(eval_scores.keys())}",
+                exits=1,
+            )
+        scores[threshold] = eval_scores[scores_key]
+
+        if not isinstance(scores[threshold], (float, int)):
+            wasabi.msg.fail(
+                f"Returned score for key '{scores_key}' is not numeric. Threshold optimization only works for numeric "
+                f"scores.",
+                exits=1,
+            )
+        print(
+            wasabi.row(
+                [round(threshold, 3), round(scores[threshold], 3)],
+                widths=table_col_widths,
+            )
+        )
+
+    best_threshold = max(scores.keys(), key=(lambda key: scores[key]))
+
+    # If all scores are identical, emit warning.
+    if len(set(scores.values())) == 1:
+        wasabi.msg.warn(
+            title="All scores are identical. Verify that all settings are correct.",
+            text=""
+            if (
+                not isinstance(pipe, MultiLabel_TextCategorizer)
+                or scores_key in ("cats_macro_f", "cats_micro_f")
+            )
+            else "Use `cats_macro_f` or `cats_micro_f` when optimizing the threshold for `textcat_multilabel`.",
+        )
+
+    else:
+        if not silent:
+            print(
+                f"\nBest threshold: {round(best_threshold, ndigits=4)} with {scores_key} value of {scores[best_threshold]}."
+            )
+
+    return best_threshold, scores[best_threshold], scores

spacy/cli/info.py

@@ -147,6 +147,7 @@ def info_installed_model_url(model: str) -> Optional[str]:
         # something else, like no file or invalid JSON
         return None
 
+
 def info_model_url(model: str) -> Dict[str, Any]:
     """Return the download URL for the latest version of a pipeline."""
     version = get_latest_version(model)

spacy/cli/package.py

@@ -299,8 +299,8 @@ def get_meta(
     }
     nlp = util.load_model_from_path(Path(model_path))
     meta.update(nlp.meta)
-    meta.update(existing_meta)
     meta["spacy_version"] = util.get_minor_version_range(about.__version__)
+    meta.update(existing_meta)
     meta["vectors"] = {
         "width": nlp.vocab.vectors_length,
         "vectors": len(nlp.vocab.vectors),

spacy/cli/project/assets.py

@@ -189,7 +189,11 @@ def convert_asset_url(url: str) -> str:
     RETURNS (str): The converted URL.
     """
     # If the asset URL is a regular GitHub URL it's likely a mistake
-    if re.match(r"(http(s?)):\/\/github.com", url) and "releases/download" not in url:
+    if (
+        re.match(r"(http(s?)):\/\/github.com", url)
+        and "releases/download" not in url
+        and "/raw/" not in url
+    ):
         converted = url.replace("github.com", "raw.githubusercontent.com")
         converted = re.sub(r"/(tree|blob)/", "/", converted)
         msg.warn(

spacy/cli/project/dvc.py

@@ -25,6 +25,7 @@ def project_update_dvc_cli(
     project_dir: Path = Arg(Path.cwd(), help="Location of project directory. Defaults to current working directory.", exists=True, file_okay=False),
     workflow: Optional[str] = Arg(None, help=f"Name of workflow defined in {PROJECT_FILE}. Defaults to first workflow if not set."),
     verbose: bool = Opt(False, "--verbose", "-V", help="Print more info"),
+    quiet: bool = Opt(False, "--quiet", "-q", help="Print less info"),
     force: bool = Opt(False, "--force", "-F", help="Force update DVC config"),
     # fmt: on
 ):
@@ -36,7 +37,7 @@ def project_update_dvc_cli(
 
     DOCS: https://spacy.io/api/cli#project-dvc
     """
-    project_update_dvc(project_dir, workflow, verbose=verbose, force=force)
+    project_update_dvc(project_dir, workflow, verbose=verbose, quiet=quiet, force=force)
 
 
 def project_update_dvc(
@@ -44,6 +45,7 @@ def project_update_dvc(
     workflow: Optional[str] = None,
     *,
     verbose: bool = False,
+    quiet: bool = False,
     force: bool = False,
 ) -> None:
     """Update the auto-generated Data Version Control (DVC) config file. A DVC
@@ -54,11 +56,12 @@ def project_update_dvc(
     workflow (Optional[str]): Optional name of workflow defined in project.yml.
         If not set, the first workflow will be used.
     verbose (bool): Print more info.
+    quiet (bool): Print less info.
     force (bool): Force update DVC config.
     """
     config = load_project_config(project_dir)
     updated = update_dvc_config(
-        project_dir, config, workflow, verbose=verbose, force=force
+        project_dir, config, workflow, verbose=verbose, quiet=quiet, force=force
     )
     help_msg = "To execute the workflow with DVC, run: dvc repro"
     if updated:
@@ -72,7 +75,7 @@ def update_dvc_config(
     config: Dict[str, Any],
     workflow: Optional[str] = None,
     verbose: bool = False,
-    silent: bool = False,
+    quiet: bool = False,
     force: bool = False,
 ) -> bool:
     """Re-run the DVC commands in dry mode and update dvc.yaml file in the
@@ -83,7 +86,7 @@ def update_dvc_config(
     path (Path): The path to the project directory.
     config (Dict[str, Any]): The loaded project.yml.
     verbose (bool): Whether to print additional info (via DVC).
-    silent (bool): Don't output anything (via DVC).
+    quiet (bool): Don't output anything (via DVC).
     force (bool): Force update, even if hashes match.
     RETURNS (bool): Whether the DVC config file was updated.
     """
@@ -105,6 +108,14 @@ def update_dvc_config(
         dvc_config_path.unlink()
     dvc_commands = []
     config_commands = {cmd["name"]: cmd for cmd in config.get("commands", [])}
+
+    # some flags that apply to every command
+    flags = []
+    if verbose:
+        flags.append("--verbose")
+    if quiet:
+        flags.append("--quiet")
+
     for name in workflows[workflow]:
         command = config_commands[name]
         deps = command.get("deps", [])
@@ -118,14 +129,26 @@ def update_dvc_config(
         deps_cmd = [c for cl in [["-d", p] for p in deps] for c in cl]
         outputs_cmd = [c for cl in [["-o", p] for p in outputs] for c in cl]
         outputs_nc_cmd = [c for cl in [["-O", p] for p in outputs_no_cache] for c in cl]
-        dvc_cmd = ["run", "-n", name, "-w", str(path), "--no-exec"]
+
+        dvc_cmd = ["run", *flags, "-n", name, "-w", str(path), "--no-exec"]
         if command.get("no_skip"):
             dvc_cmd.append("--always-changed")
         full_cmd = [*dvc_cmd, *deps_cmd, *outputs_cmd, *outputs_nc_cmd, *project_cmd]
         dvc_commands.append(join_command(full_cmd))
+
+    if not dvc_commands:
+        # If we don't check for this, then there will be an error when reading the
+        # config, since DVC wouldn't create it.
+        msg.fail(
+            "No usable commands for DVC found. This can happen if none of your "
+            "commands have dependencies or outputs.",
+            exits=1,
+        )
+
     with working_dir(path):
-        dvc_flags = {"--verbose": verbose, "--quiet": silent}
+        for c in dvc_commands:
-        run_dvc_commands(dvc_commands, flags=dvc_flags)
+            dvc_command = "dvc " + c
+            run_command(dvc_command)
     with dvc_config_path.open("r+", encoding="utf8") as f:
         content = f.read()
         f.seek(0, 0)
@@ -133,26 +156,6 @@ def update_dvc_config(
     return True
 
 
-def run_dvc_commands(
-    commands: Iterable[str] = SimpleFrozenList(), flags: Dict[str, bool] = {}
-) -> None:
-    """Run a sequence of DVC commands in a subprocess, in order.
-
-    commands (List[str]): The string commands without the leading "dvc".
-    flags (Dict[str, bool]): Conditional flags to be added to command. Makes it
-        easier to pass flags like --quiet that depend on a variable or
-        command-line setting while avoiding lots of nested conditionals.
-    """
-    for c in commands:
-        command = split_command(c)
-        dvc_command = ["dvc", *command]
-        # Add the flags if they are set to True
-        for flag, is_active in flags.items():
-            if is_active:
-                dvc_command.append(flag)
-        run_command(dvc_command)
-
-
 def check_workflows(workflows: List[str], workflow: Optional[str] = None) -> None:
     """Validate workflows provided in project.yml and check that a given
     workflow can be used to generate a DVC config.

spacy/cli/project/remote_storage.py

@@ -5,14 +5,17 @@ import hashlib
 import urllib.parse
 import tarfile
 from pathlib import Path
+from wasabi import msg
 
-from .._util import get_hash, get_checksum, download_file, ensure_pathy
+from .._util import get_hash, get_checksum, upload_file, download_file
-from ...util import make_tempdir, get_minor_version, ENV_VARS, check_bool_env_var
+from .._util import ensure_pathy, make_tempdir
+from ...util import get_minor_version, ENV_VARS, check_bool_env_var
 from ...git_info import GIT_VERSION
 from ... import about
+from ...errors import Errors
 
 if TYPE_CHECKING:
-    from pathy import Pathy  # noqa: F401
+    from pathy import FluidPath  # noqa: F401
 
 
 class RemoteStorage:
@@ -27,7 +30,7 @@ class RemoteStorage:
         self.url = ensure_pathy(url)
         self.compression = compression
 
-    def push(self, path: Path, command_hash: str, content_hash: str) -> "Pathy":
+    def push(self, path: Path, command_hash: str, content_hash: str) -> "FluidPath":
         """Compress a file or directory within a project and upload it to a remote
         storage. If an object exists at the full URL, nothing is done.
 
@@ -48,9 +51,7 @@ class RemoteStorage:
             mode_string = f"w:{self.compression}" if self.compression else "w"
             with tarfile.open(tar_loc, mode=mode_string) as tar_file:
                 tar_file.add(str(loc), arcname=str(path))
-            with tar_loc.open(mode="rb") as input_file:
+            upload_file(tar_loc, url)
-                with url.open(mode="wb") as output_file:
-                    output_file.write(input_file.read())
         return url
 
     def pull(
@@ -59,7 +60,7 @@ class RemoteStorage:
         *,
         command_hash: Optional[str] = None,
         content_hash: Optional[str] = None,
-    ) -> Optional["Pathy"]:
+    ) -> Optional["FluidPath"]:
         """Retrieve a file from the remote cache. If the file already exists,
         nothing is done.
 
@@ -84,7 +85,23 @@ class RemoteStorage:
                 with tarfile.open(tar_loc, mode=mode_string) as tar_file:
                     # This requires that the path is added correctly, relative
                     # to root. This is how we set things up in push()
-                    tar_file.extractall(self.root)
+
+                    # Disallow paths outside the current directory for the tar
+                    # file (CVE-2007-4559, directory traversal vulnerability)
+                    def is_within_directory(directory, target):
+                        abs_directory = os.path.abspath(directory)
+                        abs_target = os.path.abspath(target)
+                        prefix = os.path.commonprefix([abs_directory, abs_target])
+                        return prefix == abs_directory
+
+                    def safe_extract(tar, path):
+                        for member in tar.getmembers():
+                            member_path = os.path.join(path, member.name)
+                            if not is_within_directory(path, member_path):
+                                raise ValueError(Errors.E852)
+                        tar.extractall(path)
+
+                    safe_extract(tar_file, self.root)
         return url
 
     def find(
@@ -93,25 +110,37 @@ class RemoteStorage:
         *,
         command_hash: Optional[str] = None,
         content_hash: Optional[str] = None,
-    ) -> Optional["Pathy"]:
+    ) -> Optional["FluidPath"]:
         """Find the best matching version of a file within the storage,
         or `None` if no match can be found. If both the creation and content hash
         are specified, only exact matches will be returned. Otherwise, the most
         recent matching file is preferred.
         """
         name = self.encode_name(str(path))
+        urls = []
         if command_hash is not None and content_hash is not None:
-            url = self.make_url(path, command_hash, content_hash)
+            url = self.url / name / command_hash / content_hash
             urls = [url] if url.exists() else []
         elif command_hash is not None:
-            urls = list((self.url / name / command_hash).iterdir())
+            if (self.url / name / command_hash).exists():
+                urls = list((self.url / name / command_hash).iterdir())
         else:
-            urls = list((self.url / name).iterdir())
+            if (self.url / name).exists():
-            if content_hash is not None:
+                for sub_dir in (self.url / name).iterdir():
-                urls = [url for url in urls if url.parts[-1] == content_hash]
+                    urls.extend(sub_dir.iterdir())
+                if content_hash is not None:
+                    urls = [url for url in urls if url.parts[-1] == content_hash]
+        if len(urls) >= 2:
+            try:
+                urls.sort(key=lambda x: x.stat().last_modified)  # type: ignore
+            except Exception:
+                msg.warn(
+                    "Unable to sort remote files by last modified. The file(s) "
+                    "pulled from the cache may not be the most recent."
+                )
         return urls[-1] if urls else None
 
-    def make_url(self, path: Path, command_hash: str, content_hash: str) -> "Pathy":
+    def make_url(self, path: Path, command_hash: str, content_hash: str) -> "FluidPath":
         """Construct a URL from a subpath, a creation hash and a content hash."""
         return self.url / self.encode_name(str(path)) / command_hash / content_hash
 

spacy/cli/project/run.py

@@ -1,5 +1,8 @@
-from typing import Optional, List, Dict, Sequence, Any, Iterable
+from typing import Optional, List, Dict, Sequence, Any, Iterable, Tuple
+import os.path
 from pathlib import Path
+
+import pkg_resources
 from wasabi import msg
 from wasabi.util import locale_escape
 import sys
@@ -50,6 +53,7 @@ def project_run(
     force: bool = False,
     dry: bool = False,
     capture: bool = False,
+    skip_requirements_check: bool = False,
 ) -> None:
     """Run a named script defined in the project.yml. If the script is part
     of the default pipeline (defined in the "run" section), DVC is used to
@@ -66,11 +70,19 @@ def project_run(
         sys.exit will be called with the return code. You should use capture=False
         when you want to turn over execution to the command, and capture=True
         when you want to run the command more like a function.
+    skip_requirements_check (bool): Whether to skip the requirements check.
     """
     config = load_project_config(project_dir, overrides=overrides)
     commands = {cmd["name"]: cmd for cmd in config.get("commands", [])}
     workflows = config.get("workflows", {})
     validate_subcommand(list(commands.keys()), list(workflows.keys()), subcommand)
+
+    req_path = project_dir / "requirements.txt"
+    if not skip_requirements_check:
+        if config.get("check_requirements", True) and os.path.exists(req_path):
+            with req_path.open() as requirements_file:
+                _check_requirements([req.strip() for req in requirements_file])
+
     if subcommand in workflows:
         msg.info(f"Running workflow '{subcommand}'")
         for cmd in workflows[subcommand]:
@@ -81,6 +93,7 @@ def project_run(
                 force=force,
                 dry=dry,
                 capture=capture,
+                skip_requirements_check=True,
             )
     else:
         cmd = commands[subcommand]
@@ -88,8 +101,8 @@ def project_run(
             if not (project_dir / dep).exists():
                 err = f"Missing dependency specified by command '{subcommand}': {dep}"
                 err_help = "Maybe you forgot to run the 'project assets' command or a previous step?"
-                err_kwargs = {"exits": 1} if not dry else {}
+                err_exits = 1 if not dry else None
-                msg.fail(err, err_help, **err_kwargs)
+                msg.fail(err, err_help, exits=err_exits)
         check_spacy_commit = check_bool_env_var(ENV_VARS.PROJECT_USE_GIT_VERSION)
         with working_dir(project_dir) as current_dir:
             msg.divider(subcommand)
@@ -195,6 +208,8 @@ def validate_subcommand(
         msg.fail(f"No commands or workflows defined in {PROJECT_FILE}", exits=1)
     if subcommand not in commands and subcommand not in workflows:
         help_msg = []
+        if subcommand in ["assets", "asset"]:
+            help_msg.append("Did you mean to run: python -m spacy project assets?")
         if commands:
             help_msg.append(f"Available commands: {', '.join(commands)}")
         if workflows:
@@ -308,3 +323,38 @@ def get_fileinfo(project_dir: Path, paths: List[str]) -> List[Dict[str, Optional
         md5 = get_checksum(file_path) if file_path.exists() else None
         data.append({"path": path, "md5": md5})
     return data
+
+
+def _check_requirements(requirements: List[str]) -> Tuple[bool, bool]:
+    """Checks whether requirements are installed and free of version conflicts.
+    requirements (List[str]): List of requirements.
+    RETURNS (Tuple[bool, bool]): Whether (1) any packages couldn't be imported, (2) any packages with version conflicts
+        exist.
+    """
+
+    failed_pkgs_msgs: List[str] = []
+    conflicting_pkgs_msgs: List[str] = []
+
+    for req in requirements:
+        try:
+            pkg_resources.require(req)
+        except pkg_resources.DistributionNotFound as dnf:
+            failed_pkgs_msgs.append(dnf.report())
+        except pkg_resources.VersionConflict as vc:
+            conflicting_pkgs_msgs.append(vc.report())
+        except Exception:
+            msg.warn(
+                f"Unable to check requirement: {req} "
+                "Checks are currently limited to requirement specifiers "
+                "(PEP 508)"
+            )
+
+    if len(failed_pkgs_msgs) or len(conflicting_pkgs_msgs):
+        msg.warn(
+            title="Missing requirements or requirement conflicts detected. Make sure your Python environment is set up "
+            "correctly and you installed all requirements specified in your project's requirements.txt: "
+        )
+        for pgk_msg in failed_pkgs_msgs + conflicting_pkgs_msgs:
+            msg.text(pgk_msg)
+
+    return len(failed_pkgs_msgs) > 0, len(conflicting_pkgs_msgs) > 0

spacy/cli/templates/quickstart_training.jinja

@@ -1,7 +1,7 @@
 {# This is a template for training configs used for the quickstart widget in
 the docs and the init config command. It encodes various best practices and
 can help generate the best possible configuration, given a user's requirements. #}
-{%- set use_transformer = hardware != "cpu" -%}
+{%- set use_transformer = hardware != "cpu" and transformer_data -%}
 {%- set transformer = transformer_data[optimize] if use_transformer else {} -%}
 {%- set listener_components = ["tagger", "morphologizer", "parser", "ner", "textcat", "textcat_multilabel", "entity_linker", "spancat", "trainable_lemmatizer"] -%}
 [paths]
@@ -269,13 +269,8 @@ factory = "tok2vec"
 [components.tok2vec.model.embed]
 @architectures = "spacy.MultiHashEmbed.v2"
 width = ${components.tok2vec.model.encode.width}
-{% if has_letters -%}
 attrs = ["NORM", "PREFIX", "SUFFIX", "SHAPE"]
-rows = [5000, 2500, 2500, 2500]
+rows = [5000, 1000, 2500, 2500]
-{% else -%}
-attrs = ["ORTH", "SHAPE"]
-rows = [5000, 2500]
-{% endif -%}
 include_static_vectors = {{ "true" if optimize == "accuracy" else "false" }}
 
 [components.tok2vec.model.encode]

spacy/cli/templates/quickstart_training_recommendations.yml

@@ -37,6 +37,15 @@ bn:
     accuracy:
       name: sagorsarker/bangla-bert-base
       size_factor: 3
+ca:
+  word_vectors: null
+  transformer:
+    efficiency:
+      name: projecte-aina/roberta-base-ca-v2
+      size_factor: 3
+    accuracy:
+      name: projecte-aina/roberta-base-ca-v2
+      size_factor: 3
 da:
   word_vectors: da_core_news_lg
   transformer:
@@ -271,4 +280,3 @@ zh:
     accuracy:
       name: bert-base-chinese
       size_factor: 3
-  has_letters: false

spacy/default_config.cfg

@@ -90,6 +90,8 @@ dev_corpus = "corpora.dev"
 train_corpus = "corpora.train"
 # Optional callback before nlp object is saved to disk after training
 before_to_disk = null
+# Optional callback that is invoked at the start of each training step
+before_update = null
 
 [training.logger]
 @loggers = "spacy.ConsoleLogger.v1"

spacy/displacy/__init__.py

@@ -228,12 +228,13 @@ def parse_spans(doc: Doc, options: Dict[str, Any] = {}) -> Dict[str, Any]:
             "kb_id": span.kb_id_ if span.kb_id_ else "",
             "kb_url": kb_url_template.format(span.kb_id_) if kb_url_template else "#",
         }
-        for span in doc.spans[spans_key]
+        for span in doc.spans.get(spans_key, [])
     ]
     tokens = [token.text for token in doc]
 
     if not spans:
-        warnings.warn(Warnings.W117.format(spans_key=spans_key))
+        keys = list(doc.spans.keys())
+        warnings.warn(Warnings.W117.format(spans_key=spans_key, keys=keys))
     title = doc.user_data.get("title", None) if hasattr(doc, "user_data") else None
     settings = get_doc_settings(doc)
     return {

spacy/errors.py

@@ -131,13 +131,6 @@ class Warnings(metaclass=ErrorsWithCodes):
             "and make it independent. For example, `replace_listeners = "
             "[\"model.tok2vec\"]` See the documentation for details: "
             "https://spacy.io/usage/training#config-components-listeners")
-    W088 = ("The pipeline component {name} implements a `begin_training` "
-            "method, which won't be called by spaCy. As of v3.0, `begin_training` "
-            "has been renamed to `initialize`, so you likely want to rename the "
-            "component method. See the documentation for details: "
-            "https://spacy.io/api/language#initialize")
-    W089 = ("As of spaCy v3.0, the `nlp.begin_training` method has been renamed "
-            "to `nlp.initialize`.")
     W090 = ("Could not locate any {format} files in path '{path}'.")
     W091 = ("Could not clean/remove the temp directory at {dir}: {msg}.")
     W092 = ("Ignoring annotations for sentence starts, as dependency heads are set.")
@@ -199,7 +192,7 @@ class Warnings(metaclass=ErrorsWithCodes):
     W117 = ("No spans to visualize found in Doc object with spans_key: '{spans_key}'. If this is "
             "surprising to you, make sure the Doc was processed using a model "
             "that supports span categorization, and check the `doc.spans[spans_key]` "
-            "property manually if necessary.")
+            "property manually if necessary.\n\nAvailable keys: {keys}")
     W118 = ("Term '{term}' not found in glossary. It may however be explained in documentation "
             "for the corpora used to train the language. Please check "
             "`nlp.meta[\"sources\"]` for any relevant links.")
@@ -212,6 +205,8 @@ class Warnings(metaclass=ErrorsWithCodes):
     W121 = ("Attempting to trace non-existent method '{method}' in pipe '{pipe}'")
     W122 = ("Couldn't trace method '{method}' in pipe '{pipe}'. This can happen if the pipe class "
             "is a Cython extension type.")
+    W123 = ("Argument `enable` with value {enable} does not contain all values specified in the config option "
+            "`enabled` ({enabled}). Be aware that this might affect other components in your pipeline.")
 
     W400 = ("`use_upper=False` is ignored, the upper layer is always enabled")
 
@@ -250,9 +245,7 @@ class Errors(metaclass=ErrorsWithCodes):
             "https://spacy.io/usage/models")
     E011 = ("Unknown operator: '{op}'. Options: {opts}")
     E012 = ("Cannot add pattern for zero tokens to matcher.\nKey: {key}")
-    E016 = ("MultitaskObjective target should be function or one of: dep, "
+    E017 = ("Can only add 'str' inputs to StringStore. Got type: {value_type}")
-            "tag, ent, dep_tag_offset, ent_tag.")
-    E017 = ("Can only add unicode or bytes. Got type: {value_type}")
     E018 = ("Can't retrieve string for hash '{hash_value}'. This usually "
             "refers to an issue with the `Vocab` or `StringStore`.")
     E019 = ("Can't create transition with unknown action ID: {action}. Action "
@@ -345,6 +338,11 @@ class Errors(metaclass=ErrorsWithCodes):
             "clear the existing vectors and resize the table.")
     E074 = ("Error interpreting compiled match pattern: patterns are expected "
             "to end with the attribute {attr}. Got: {bad_attr}.")
+    E079 = ("Error computing states in beam: number of predicted beams "
+            "({pbeams}) does not equal number of gold beams ({gbeams}).")
+    E080 = ("Duplicate state found in beam: {key}.")
+    E081 = ("Error getting gradient in beam: number of histories ({n_hist}) "
+            "does not equal number of losses ({losses}).")
     E082 = ("Error deprojectivizing parse: number of heads ({n_heads}), "
             "projective heads ({n_proj_heads}) and labels ({n_labels}) do not "
             "match.")
@@ -460,13 +458,13 @@ class Errors(metaclass=ErrorsWithCodes):
             "same, but found '{nlp}' and '{vocab}' respectively.")
     E152 = ("The attribute {attr} is not supported for token patterns. "
             "Please use the option `validate=True` with the Matcher, PhraseMatcher, "
-            "EntityRuler or AttributeRuler for more details.")
+            "SpanRuler or AttributeRuler for more details.")
     E153 = ("The value type {vtype} is not supported for token patterns. "
             "Please use the option validate=True with Matcher, PhraseMatcher, "
-            "EntityRuler or AttributeRuler for more details.")
+            "SpanRuler or AttributeRuler for more details.")
     E154 = ("One of the attributes or values is not supported for token "
             "patterns. Please use the option `validate=True` with the Matcher, "
-            "PhraseMatcher, or EntityRuler for more details.")
+            "PhraseMatcher, or SpanRuler for more details.")
     E155 = ("The pipeline needs to include a {pipe} in order to use "
             "Matcher or PhraseMatcher with the attribute {attr}. "
             "Try using `nlp()` instead of `nlp.make_doc()` or `list(nlp.pipe())` "
@@ -540,8 +538,14 @@ class Errors(metaclass=ErrorsWithCodes):
     E199 = ("Unable to merge 0-length span at `doc[{start}:{end}]`.")
     E200 = ("Can't set {attr} from Span.")
     E202 = ("Unsupported {name} mode '{mode}'. Supported modes: {modes}.")
+    E203 = ("If the {name} embedding layer is not updated "
+            "during training, make sure to include it in 'annotating components'")
 
     # New errors added in v3.x
+    E851 = ("The 'textcat' component labels should only have values of 0 or 1, "
+            "but found value of '{val}'.")
+    E852 = ("The tar file pulled from the remote attempted an unsafe path "
+            "traversal.")
     E853 = ("Unsupported component factory name '{name}'. The character '.' is "
             "not permitted in factory names.")
     E854 = ("Unable to set doc.ents. Check that the 'ents_filter' does not "
@@ -709,11 +713,11 @@ class Errors(metaclass=ErrorsWithCodes):
             "need to modify the pipeline, use the built-in methods like "
             "`nlp.add_pipe`, `nlp.remove_pipe`, `nlp.disable_pipe` or "
             "`nlp.enable_pipe` instead.")
-    E927 = ("Can't write to frozen list Maybe you're trying to modify a computed "
+    E927 = ("Can't write to frozen list. Maybe you're trying to modify a computed "
             "property or default function argument?")
-    E928 = ("A KnowledgeBase can only be serialized to/from from a directory, "
+    E928 = ("An InMemoryLookupKB can only be serialized to/from from a directory, "
             "but the provided argument {loc} points to a file.")
-    E929 = ("Couldn't read KnowledgeBase from {loc}. The path does not seem to exist.")
+    E929 = ("Couldn't read InMemoryLookupKB from {loc}. The path does not seem to exist.")
     E930 = ("Received invalid get_examples callback in `{method}`. "
             "Expected function that returns an iterable of Example objects but "
             "got: {obj}")
@@ -721,13 +725,6 @@ class Errors(metaclass=ErrorsWithCodes):
             "method in component '{name}'. If you want to use this "
             "method, make sure it's overwritten on the subclass.")
     E940 = ("Found NaN values in scores.")
-    E941 = ("Can't find model '{name}'. It looks like you're trying to load a "
-            "model from a shortcut, which is obsolete as of spaCy v3.0. To "
-            "load the model, use its full name instead:\n\n"
-            "nlp = spacy.load(\"{full}\")\n\nFor more details on the available "
-            "models, see the models directory: https://spacy.io/models. If you "
-            "want to create a blank model, use spacy.blank: "
-            "nlp = spacy.blank(\"{name}\")")
     E942 = ("Executing `after_{name}` callback failed. Expected the function to "
             "return an initialized nlp object but got: {value}. Maybe "
             "you forgot to return the modified object in your function?")
@@ -915,8 +912,6 @@ class Errors(metaclass=ErrorsWithCodes):
     E1021 = ("`pos` value \"{pp}\" is not a valid Universal Dependencies tag. "
              "Non-UD tags should use the `tag` property.")
     E1022 = ("Words must be of type str or int, but input is of type '{wtype}'")
-    E1023 = ("Couldn't read EntityRuler from the {path}. This file doesn't "
-             "exist.")
     E1024 = ("A pattern with {attr_type} '{label}' is not present in "
              "'{component}' patterns.")
     E1025 = ("Cannot intify the value '{value}' as an IOB string. The only "
@@ -939,23 +934,25 @@ class Errors(metaclass=ErrorsWithCodes):
     E1040 = ("Doc.from_json requires all tokens to have the same attributes. "
              "Some tokens do not contain annotation for: {partial_attrs}")
     E1041 = ("Expected a string, Doc, or bytes as input, but got: {type}")
-    E1042 = ("Function was called with `{arg1}`={arg1_values} and "
+    E1042 = ("`enable={enable}` and `disable={disable}` are inconsistent with each other.\nIf you only passed "
-             "`{arg2}`={arg2_values} but these arguments are conflicting.")
+             "one of `enable` or `disable`, the other argument is specified in your pipeline's configuration.\nIn that "
+             "case pass an empty list for the previously not specified argument to avoid this error.")
     E1043 = ("Expected None or a value in range [{range_start}, {range_end}] for entity linker threshold, but got "
              "{value}.")
+    E1044 = ("Expected `candidates_batch_size` to be >= 1, but got: {value}")
+    E1045 = ("Encountered {parent} subclass without `{parent}.{method}` "
+             "method in '{name}'. If you want to use this method, make "
+             "sure it's overwritten on the subclass.")
+    E1046 = ("{cls_name} is an abstract class and cannot be instantiated. If you are looking for spaCy's default "
+             "knowledge base, use `InMemoryLookupKB`.")
+    E1047 = ("`find_threshold()` only supports components with a `scorer` attribute.")
+    E1048 = ("Got '{unexpected}' as console progress bar type, but expected one of the following: {expected}")
 
     # v4 error strings
     E4000 = ("Expected a Doc as input, but got: '{type}'")
-    E4001 = ("Backprop is not supported when is_train is not set.")
+    E4001 = ("Expected input to be one of the following types: ({expected_types}), "
-
+             "but got '{received_type}'")
-
+    E4002 = ("Backprop is not supported when is_train is not set.")
-# Deprecated model shortcuts, only used in errors and warnings
-OLD_MODEL_SHORTCUTS = {
-    "en": "en_core_web_sm", "de": "de_core_news_sm", "es": "es_core_news_sm",
-    "pt": "pt_core_news_sm", "fr": "fr_core_news_sm", "it": "it_core_news_sm",
-    "nl": "nl_core_news_sm", "el": "el_core_news_sm", "nb": "nb_core_news_sm",
-    "lt": "lt_core_news_sm", "xx": "xx_ent_wiki_sm"
-}
 
 
 # fmt: on

spacy/kb/__init__.py

@@ -0,0 +1,3 @@
+from .kb import KnowledgeBase
+from .kb_in_memory import InMemoryLookupKB
+from .candidate import Candidate, get_candidates, get_candidates_batch

spacy/kb/candidate.pxd

@@ -0,0 +1,12 @@
+from .kb cimport KnowledgeBase
+from libcpp.vector cimport vector
+from ..typedefs cimport hash_t
+
+# Object used by the Entity Linker that summarizes one entity-alias candidate combination.
+cdef class Candidate:
+    cdef readonly KnowledgeBase kb
+    cdef hash_t entity_hash
+    cdef float entity_freq
+    cdef vector[float] entity_vector
+    cdef hash_t alias_hash
+    cdef float prior_prob

spacy/kb/candidate.pyx

@@ -0,0 +1,74 @@
+# cython: infer_types=True, profile=True
+
+from typing import Iterable
+from .kb cimport KnowledgeBase
+from ..tokens import Span
+
+cdef class Candidate:
+    """A `Candidate` object refers to a textual mention (`alias`) that may or may not be resolved
+    to a specific `entity` from a Knowledge Base. This will be used as input for the entity linking
+    algorithm which will disambiguate the various candidates to the correct one.
+    Each candidate (alias, entity) pair is assigned a certain prior probability.
+
+    DOCS: https://spacy.io/api/kb/#candidate-init
+    """
+
+    def __init__(self, KnowledgeBase kb, entity_hash, entity_freq, entity_vector, alias_hash, prior_prob):
+        self.kb = kb
+        self.entity_hash = entity_hash
+        self.entity_freq = entity_freq
+        self.entity_vector = entity_vector
+        self.alias_hash = alias_hash
+        self.prior_prob = prior_prob
+
+    @property
+    def entity(self) -> int:
+        """RETURNS (uint64): hash of the entity's KB ID/name"""
+        return self.entity_hash
+
+    @property
+    def entity_(self) -> str:
+        """RETURNS (str): ID/name of this entity in the KB"""
+        return self.kb.vocab.strings[self.entity_hash]
+
+    @property
+    def alias(self) -> int:
+        """RETURNS (uint64): hash of the alias"""
+        return self.alias_hash
+
+    @property
+    def alias_(self) -> str:
+        """RETURNS (str): ID of the original alias"""
+        return self.kb.vocab.strings[self.alias_hash]
+
+    @property
+    def entity_freq(self) -> float:
+        return self.entity_freq
+
+    @property
+    def entity_vector(self) -> Iterable[float]:
+        return self.entity_vector
+
+    @property
+    def prior_prob(self) -> float:
+        return self.prior_prob
+
+
+def get_candidates(kb: KnowledgeBase, mention: Span) -> Iterable[Candidate]:
+    """
+    Return candidate entities for a given mention and fetching appropriate entries from the index.
+    kb (KnowledgeBase): Knowledge base to query.
+    mention (Span): Entity mention for which to identify candidates.
+    RETURNS (Iterable[Candidate]): Identified candidates.
+    """
+    return kb.get_candidates(mention)
+
+
+def get_candidates_batch(kb: KnowledgeBase, mentions: Iterable[Span]) -> Iterable[Iterable[Candidate]]:
+    """
+    Return candidate entities for the given mentions and fetching appropriate entries from the index.
+    kb (KnowledgeBase): Knowledge base to query.
+    mention (Iterable[Span]): Entity mentions for which to identify candidates.
+    RETURNS (Iterable[Iterable[Candidate]]): Identified candidates.
+    """
+    return kb.get_candidates_batch(mentions)

spacy/kb/kb.pxd

@@ -0,0 +1,10 @@
+"""Knowledge-base for entity or concept linking."""
+
+from cymem.cymem cimport Pool
+from libc.stdint cimport int64_t
+from ..vocab cimport Vocab
+
+cdef class KnowledgeBase:
+    cdef Pool mem
+    cdef readonly Vocab vocab
+    cdef readonly int64_t entity_vector_length

spacy/kb/kb.pyx

@@ -0,0 +1,108 @@
+# cython: infer_types=True, profile=True
+
+from pathlib import Path
+from typing import Iterable, Tuple, Union
+from cymem.cymem cimport Pool
+
+from .candidate import Candidate
+from ..tokens import Span
+from ..util import SimpleFrozenList
+from ..errors import Errors
+
+
+cdef class KnowledgeBase:
+    """A `KnowledgeBase` instance stores unique identifiers for entities and their textual aliases,
+    to support entity linking of named entities to real-world concepts.
+    This is an abstract class and requires its operations to be implemented.
+
+    DOCS: https://spacy.io/api/kb
+    """
+
+    def __init__(self, vocab: Vocab, entity_vector_length: int):
+        """Create a KnowledgeBase."""
+        # Make sure abstract KB is not instantiated.
+        if self.__class__ == KnowledgeBase:
+            raise TypeError(
+                Errors.E1046.format(cls_name=self.__class__.__name__)
+            )
+
+        self.vocab = vocab
+        self.entity_vector_length = entity_vector_length
+        self.mem = Pool()
+
+    def get_candidates_batch(self, mentions: Iterable[Span]) -> Iterable[Iterable[Candidate]]:
+        """
+        Return candidate entities for specified texts. Each candidate defines the entity, the original alias,
+        and the prior probability of that alias resolving to that entity.
+        If no candidate is found for a given text, an empty list is returned.
+        mentions (Iterable[Span]): Mentions for which to get candidates.
+        RETURNS (Iterable[Iterable[Candidate]]): Identified candidates.
+        """
+        return [self.get_candidates(span) for span in mentions]
+
+    def get_candidates(self, mention: Span) -> Iterable[Candidate]:
+        """
+        Return candidate entities for specified text. Each candidate defines the entity, the original alias,
+        and the prior probability of that alias resolving to that entity.
+        If the no candidate is found for a given text, an empty list is returned.
+        mention (Span): Mention for which to get candidates.
+        RETURNS (Iterable[Candidate]): Identified candidates.
+        """
+        raise NotImplementedError(
+            Errors.E1045.format(parent="KnowledgeBase", method="get_candidates", name=self.__name__)
+        )
+
+    def get_vectors(self, entities: Iterable[str]) -> Iterable[Iterable[float]]:
+        """
+        Return vectors for entities.
+        entity (str): Entity name/ID.
+        RETURNS (Iterable[Iterable[float]]): Vectors for specified entities.
+        """
+        return [self.get_vector(entity) for entity in entities]
+
+    def get_vector(self, str entity) -> Iterable[float]:
+        """
+        Return vector for entity.
+        entity (str): Entity name/ID.
+        RETURNS (Iterable[float]): Vector for specified entity.
+        """
+        raise NotImplementedError(
+            Errors.E1045.format(parent="KnowledgeBase", method="get_vector", name=self.__name__)
+        )
+
+    def to_bytes(self, **kwargs) -> bytes:
+        """Serialize the current state to a binary string.
+        RETURNS (bytes): Current state as binary string.
+        """
+        raise NotImplementedError(
+            Errors.E1045.format(parent="KnowledgeBase", method="to_bytes", name=self.__name__)
+        )
+
+    def from_bytes(self, bytes_data: bytes, *, exclude: Tuple[str] = tuple()):
+        """Load state from a binary string.
+        bytes_data (bytes): KB state.
+        exclude (Tuple[str]): Properties to exclude when restoring KB.
+        """
+        raise NotImplementedError(
+            Errors.E1045.format(parent="KnowledgeBase", method="from_bytes", name=self.__name__)
+        )
+
+    def to_disk(self, path: Union[str, Path], exclude: Iterable[str] = SimpleFrozenList()) -> None:
+        """
+        Write KnowledgeBase content to disk.
+        path (Union[str, Path]): Target file path.
+        exclude (Iterable[str]): List of components to exclude.
+        """
+        raise NotImplementedError(
+            Errors.E1045.format(parent="KnowledgeBase", method="to_disk", name=self.__name__)
+        )
+
+    def from_disk(self, path: Union[str, Path], exclude: Iterable[str] = SimpleFrozenList()) -> None:
+        """
+        Load KnowledgeBase content from disk.
+        path (Union[str, Path]): Target file path.
+        exclude (Iterable[str]): List of components to exclude.
+        """
+        raise NotImplementedError(
+            Errors.E1045.format(parent="KnowledgeBase", method="from_disk", name=self.__name__)
+        )

spacy/kb/kb_in_memory.pxd

@@ -1,14 +1,12 @@
 """Knowledge-base for entity or concept linking."""
-from cymem.cymem cimport Pool
 from preshed.maps cimport PreshMap
 from libcpp.vector cimport vector
 from libc.stdint cimport int32_t, int64_t
 from libc.stdio cimport FILE
 
-from .vocab cimport Vocab
+from ..typedefs cimport hash_t
-from .typedefs cimport hash_t
+from ..structs cimport KBEntryC, AliasC
-from .structs cimport KBEntryC, AliasC
+from .kb cimport KnowledgeBase
-
 
 ctypedef vector[KBEntryC] entry_vec
 ctypedef vector[AliasC] alias_vec
@@ -16,21 +14,7 @@ ctypedef vector[float] float_vec
 ctypedef vector[float_vec] float_matrix
 
 
-# Object used by the Entity Linker that summarizes one entity-alias candidate combination.
+cdef class InMemoryLookupKB(KnowledgeBase):
-cdef class Candidate:
-    cdef readonly KnowledgeBase kb
-    cdef hash_t entity_hash
-    cdef float entity_freq
-    cdef vector[float] entity_vector
-    cdef hash_t alias_hash
-    cdef float prior_prob
-
-
-cdef class KnowledgeBase:
-    cdef Pool mem
-    cdef readonly Vocab vocab
-    cdef int64_t entity_vector_length
-
     # This maps 64bit keys (hash of unique entity string)
     # to 64bit values (position of the _KBEntryC struct in the _entries vector).
     # The PreshMap is pretty space efficient, as it uses open addressing. So

spacy/kb/kb_in_memory.pyx

@@ -1,8 +1,7 @@
 # cython: infer_types=True, profile=True
-from typing import Iterator, Iterable, Callable, Dict, Any
+from typing import Iterable, Callable, Dict, Any, Union
 
 import srsly
-from cymem.cymem cimport Pool
 from preshed.maps cimport PreshMap
 from cpython.exc cimport PyErr_SetFromErrno
 from libc.stdio cimport fopen, fclose, fread, fwrite, feof, fseek
@@ -12,85 +11,28 @@ from libcpp.vector cimport vector
 from pathlib import Path
 import warnings
 
-from .typedefs cimport hash_t
+from ..tokens import Span
-from .errors import Errors, Warnings
+from ..typedefs cimport hash_t
-from . import util
+from ..errors import Errors, Warnings
-from .util import SimpleFrozenList, ensure_path
+from .. import util
-
+from ..util import SimpleFrozenList, ensure_path
-cdef class Candidate:
+from ..vocab cimport Vocab
-    """A `Candidate` object refers to a textual mention (`alias`) that may or may not be resolved
+from .kb cimport KnowledgeBase
-    to a specific `entity` from a Knowledge Base. This will be used as input for the entity linking
+from .candidate import Candidate as Candidate
-    algorithm which will disambiguate the various candidates to the correct one.
-    Each candidate (alias, entity) pair is assigned to a certain prior probability.
-
-    DOCS: https://spacy.io/api/kb/#candidate_init
-    """
-
-    def __init__(self, KnowledgeBase kb, entity_hash, entity_freq, entity_vector, alias_hash, prior_prob):
-        self.kb = kb
-        self.entity_hash = entity_hash
-        self.entity_freq = entity_freq
-        self.entity_vector = entity_vector
-        self.alias_hash = alias_hash
-        self.prior_prob = prior_prob
-
-    @property
-    def entity(self):
-        """RETURNS (uint64): hash of the entity's KB ID/name"""
-        return self.entity_hash
-
-    @property
-    def entity_(self):
-        """RETURNS (str): ID/name of this entity in the KB"""
-        return self.kb.vocab.strings[self.entity_hash]
-
-    @property
-    def alias(self):
-        """RETURNS (uint64): hash of the alias"""
-        return self.alias_hash
-
-    @property
-    def alias_(self):
-        """RETURNS (str): ID of the original alias"""
-        return self.kb.vocab.strings[self.alias_hash]
-
-    @property
-    def entity_freq(self):
-        return self.entity_freq
-
-    @property
-    def entity_vector(self):
-        return self.entity_vector
-
-    @property
-    def prior_prob(self):
-        return self.prior_prob
 
 
-def get_candidates(KnowledgeBase kb, span) -> Iterator[Candidate]:
+cdef class InMemoryLookupKB(KnowledgeBase):
-    """
+    """An `InMemoryLookupKB` instance stores unique identifiers for entities and their textual aliases,
-    Return candidate entities for a given span by using the text of the span as the alias
-    and fetching appropriate entries from the index.
-    This particular function is optimized to work with the built-in KB functionality,
-    but any other custom candidate generation method can be used in combination with the KB as well.
-    """
-    return kb.get_alias_candidates(span.text)
-
-
-cdef class KnowledgeBase:
-    """A `KnowledgeBase` instance stores unique identifiers for entities and their textual aliases,
     to support entity linking of named entities to real-world concepts.
 
-    DOCS: https://spacy.io/api/kb
+    DOCS: https://spacy.io/api/kb_in_memory
     """
 
     def __init__(self, Vocab vocab, entity_vector_length):
-        """Create a KnowledgeBase."""
+        """Create an InMemoryLookupKB."""
-        self.mem = Pool()
+        super().__init__(vocab, entity_vector_length)
-        self.entity_vector_length = entity_vector_length
         self._entry_index = PreshMap()
         self._alias_index = PreshMap()
-        self.vocab = vocab
         self._create_empty_vectors(dummy_hash=self.vocab.strings[""])
 
     def _initialize_entities(self, int64_t nr_entities):
@@ -104,11 +46,6 @@ cdef class KnowledgeBase:
         self._alias_index = PreshMap(nr_aliases + 1)
         self._aliases_table = alias_vec(nr_aliases + 1)
 
-    @property
-    def entity_vector_length(self):
-        """RETURNS (uint64): length of the entity vectors"""
-        return self.entity_vector_length
-
     def __len__(self):
         return self.get_size_entities()
 
@@ -286,7 +223,10 @@ cdef class KnowledgeBase:
             alias_entry.probs = probs
             self._aliases_table[alias_index] = alias_entry
 
-    def get_alias_candidates(self, str alias) -> Iterator[Candidate]:
+    def get_candidates(self, mention: Span) -> Iterable[Candidate]:
+        return self.get_alias_candidates(mention.text)  # type: ignore
+
+    def get_alias_candidates(self, str alias) -> Iterable[Candidate]:
         """
         Return candidate entities for an alias. Each candidate defines the entity, the original alias,
         and the prior probability of that alias resolving to that entity.

spacy/lang/char_classes.py

@@ -280,7 +280,7 @@ _currency = (
 _punct = (
     r"… …… , : ; \! \? ¿ ؟ ¡ \( \) \[ \] \{ \} < > _ # \* & 。 ？ ！ ， 、 ； ： ～ · । ، ۔ ؛ ٪"
 )
-_quotes = r'\' " ” “ ` ‘ ´ ’ ‚ , „ » « 「 」 『 』 （ ） 〔 〕 【 】 《 》 〈 〉'
+_quotes = r'\' " ” “ ` ‘ ´ ’ ‚ , „ » « 「 」 『 』 （ ） 〔 〕 【 】 《 》 〈 〉 〈 〉  ⟦ ⟧'
 _hyphens = "- – — -- --- —— ~"
 
 # Various symbols like dingbats, but also emoji

spacy/lang/grc/__init__.py

@@ -1,11 +1,15 @@
 from .tokenizer_exceptions import TOKENIZER_EXCEPTIONS
 from .stop_words import STOP_WORDS
 from .lex_attrs import LEX_ATTRS
+from .punctuation import TOKENIZER_PREFIXES, TOKENIZER_SUFFIXES, TOKENIZER_INFIXES
 from ...language import Language, BaseDefaults
 
 
 class AncientGreekDefaults(BaseDefaults):
     tokenizer_exceptions = TOKENIZER_EXCEPTIONS
+    prefixes = TOKENIZER_PREFIXES
+    suffixes = TOKENIZER_SUFFIXES
+    infixes = TOKENIZER_INFIXES
     lex_attr_getters = LEX_ATTRS
     stop_words = STOP_WORDS
 

spacy/lang/grc/punctuation.py

@@ -0,0 +1,46 @@
+from ..char_classes import LIST_PUNCT, LIST_ELLIPSES, LIST_QUOTES, LIST_CURRENCY
+from ..char_classes import LIST_ICONS, ALPHA_LOWER, ALPHA_UPPER, ALPHA, HYPHENS
+from ..char_classes import CONCAT_QUOTES
+
+_prefixes = (
+    [
+        "†",
+        "⸏",
+    ]
+    + LIST_PUNCT
+    + LIST_ELLIPSES
+    + LIST_QUOTES
+    + LIST_CURRENCY
+    + LIST_ICONS
+)
+
+_suffixes = (
+    LIST_PUNCT
+    + LIST_ELLIPSES
+    + LIST_QUOTES
+    + LIST_ICONS
+    + [
+        "†",
+        "⸎",
+        r"(?<=[\u1F00-\u1FFF\u0370-\u03FF])[\-\.⸏]",
+    ]
+)
+
+_infixes = (
+    LIST_ELLIPSES
+    + LIST_ICONS
+    + [
+        r"(?<=[0-9])[+\-\*^](?=[0-9-])",
+        r"(?<=[{al}{q}])\.(?=[{au}{q}])".format(
+            al=ALPHA_LOWER, au=ALPHA_UPPER, q=CONCAT_QUOTES
+        ),
+        r"(?<=[{a}]),(?=[{a}])".format(a=ALPHA),
+        r"(?<=[{a}0-9])(?:{h})(?=[{a}])".format(a=ALPHA, h=HYPHENS),
+        r"(?<=[{a}0-9])[:<>=/](?=[{a}])".format(a=ALPHA),
+        r"(?<=[\u1F00-\u1FFF\u0370-\u03FF])—",
+    ]
+)
+
+TOKENIZER_PREFIXES = _prefixes
+TOKENIZER_SUFFIXES = _suffixes
+TOKENIZER_INFIXES = _infixes

spacy/lang/nl/stop_words.py

@@ -15,7 +15,7 @@
 
 STOP_WORDS = set(
     """
-aan af al alle alles allebei alleen allen als altijd ander anders andere anderen aangaangde aangezien achter achterna
+aan af al alle alles allebei alleen allen als altijd ander anders andere anderen aangaande aangezien achter achterna
 afgelopen aldus alhoewel anderzijds
 
 ben bij bijna bijvoorbeeld behalve beide beiden beneden bent bepaald beter betere betreffende binnen binnenin boven

spacy/lang/ru/lemmatizer.py

@@ -23,39 +23,44 @@ class RussianLemmatizer(Lemmatizer):
         overwrite: bool = False,
         scorer: Optional[Callable] = lemmatizer_score,
     ) -> None:
-        if mode == "pymorphy2":
+        if mode in {"pymorphy2", "pymorphy2_lookup"}:
             try:
                 from pymorphy2 import MorphAnalyzer
             except ImportError:
                 raise ImportError(
-                    "The Russian lemmatizer mode 'pymorphy2' requires the "
+                    "The lemmatizer mode 'pymorphy2' requires the "
-                    "pymorphy2 library. Install it with: pip install pymorphy2"
+                    "pymorphy2 library and dictionaries. Install them with: "
+                    "pip install pymorphy2"
+                    "# for Ukrainian dictionaries:"
+                    "pip install pymorphy2-dicts-uk"
                 ) from None
             if getattr(self, "_morph", None) is None:
-                self._morph = MorphAnalyzer()
+                self._morph = MorphAnalyzer(lang="ru")
-        elif mode == "pymorphy3":
+        elif mode in {"pymorphy3", "pymorphy3_lookup"}:
             try:
                 from pymorphy3 import MorphAnalyzer
             except ImportError:
                 raise ImportError(
-                    "The Russian lemmatizer mode 'pymorphy3' requires the "
+                    "The lemmatizer mode 'pymorphy3' requires the "
-                    "pymorphy3 library. Install it with: pip install pymorphy3"
+                    "pymorphy3 library and dictionaries. Install them with: "
+                    "pip install pymorphy3"
+                    "# for Ukrainian dictionaries:"
+                    "pip install pymorphy3-dicts-uk"
                 ) from None
             if getattr(self, "_morph", None) is None:
-                self._morph = MorphAnalyzer()
+                self._morph = MorphAnalyzer(lang="ru")
         super().__init__(
             vocab, model, name, mode=mode, overwrite=overwrite, scorer=scorer
         )
 
-    def pymorphy2_lemmatize(self, token: Token) -> List[str]:
+    def _pymorphy_lemmatize(self, token: Token) -> List[str]:
         string = token.text
         univ_pos = token.pos_
         morphology = token.morph.to_dict()
         if univ_pos == "PUNCT":
             return [PUNCT_RULES.get(string, string)]
         if univ_pos not in ("ADJ", "DET", "NOUN", "NUM", "PRON", "PROPN", "VERB"):
-            # Skip unchangeable pos
+            return self._pymorphy_lookup_lemmatize(token)
-            return [string.lower()]
         analyses = self._morph.parse(string)
         filtered_analyses = []
         for analysis in analyses:
@@ -63,8 +68,10 @@ class RussianLemmatizer(Lemmatizer):
                 # Skip suggested parse variant for unknown word for pymorphy
                 continue
             analysis_pos, _ = oc2ud(str(analysis.tag))
-            if analysis_pos == univ_pos or (
+            if (
-                analysis_pos in ("NOUN", "PROPN") and univ_pos in ("NOUN", "PROPN")
+                analysis_pos == univ_pos
+                or (analysis_pos in ("NOUN", "PROPN") and univ_pos in ("NOUN", "PROPN"))
+                or ((analysis_pos == "PRON") and (univ_pos == "DET"))
             ):
                 filtered_analyses.append(analysis)
         if not len(filtered_analyses):
@@ -107,15 +114,27 @@ class RussianLemmatizer(Lemmatizer):
             dict.fromkeys([analysis.normal_form for analysis in filtered_analyses])
         )
 
-    def pymorphy2_lookup_lemmatize(self, token: Token) -> List[str]:
+    def _pymorphy_lookup_lemmatize(self, token: Token) -> List[str]:
         string = token.text
         analyses = self._morph.parse(string)
-        if len(analyses) == 1:
+        # often multiple forms would derive from the same normal form
-            return [analyses[0].normal_form]
+        # thus check _unique_ normal forms
+        normal_forms = set([an.normal_form for an in analyses])
+        if len(normal_forms) == 1:
+            return [next(iter(normal_forms))]
         return [string]
 
+    def pymorphy2_lemmatize(self, token: Token) -> List[str]:
+        return self._pymorphy_lemmatize(token)
+
+    def pymorphy2_lookup_lemmatize(self, token: Token) -> List[str]:
+        return self._pymorphy_lookup_lemmatize(token)
+
     def pymorphy3_lemmatize(self, token: Token) -> List[str]:
-        return self.pymorphy2_lemmatize(token)
+        return self._pymorphy_lemmatize(token)
+
+    def pymorphy3_lookup_lemmatize(self, token: Token) -> List[str]:
+        return self._pymorphy_lookup_lemmatize(token)
 
 
 def oc2ud(oc_tag: str) -> Tuple[str, Dict[str, str]]:

spacy/lang/ru/tokenizer_exceptions.py

@@ -61,6 +61,11 @@ for abbr in [
     {ORTH: "2к23", NORM: "2023"},
     {ORTH: "2к24", NORM: "2024"},
     {ORTH: "2к25", NORM: "2025"},
+    {ORTH: "2к26", NORM: "2026"},
+    {ORTH: "2к27", NORM: "2027"},
+    {ORTH: "2к28", NORM: "2028"},
+    {ORTH: "2к29", NORM: "2029"},
+    {ORTH: "2к30", NORM: "2030"},
 ]:
     _exc[abbr[ORTH]] = [abbr]
 
@@ -268,8 +273,8 @@ for abbr in [
     {ORTH: "з-ка", NORM: "заимка"},
     {ORTH: "п-к", NORM: "починок"},
     {ORTH: "киш.", NORM: "кишлак"},
-    {ORTH: "п. ст. ", NORM: "поселок станция"},
+    {ORTH: "п. ст.", NORM: "поселок станция"},
-    {ORTH: "п. ж/д ст. ", NORM: "поселок при железнодорожной станции"},
+    {ORTH: "п. ж/д ст.", NORM: "поселок при железнодорожной станции"},
     {ORTH: "ж/д бл-ст", NORM: "железнодорожный блокпост"},
     {ORTH: "ж/д б-ка", NORM: "железнодорожная будка"},
     {ORTH: "ж/д в-ка", NORM: "железнодорожная ветка"},
@@ -280,12 +285,12 @@ for abbr in [
     {ORTH: "ж/д п.п.", NORM: "железнодорожный путевой пост"},
     {ORTH: "ж/д о.п.", NORM: "железнодорожный остановочный пункт"},
     {ORTH: "ж/д рзд.", NORM: "железнодорожный разъезд"},
-    {ORTH: "ж/д ст. ", NORM: "железнодорожная станция"},
+    {ORTH: "ж/д ст.", NORM: "железнодорожная станция"},
     {ORTH: "м-ко", NORM: "местечко"},
     {ORTH: "д.", NORM: "деревня"},
     {ORTH: "с.", NORM: "село"},
     {ORTH: "сл.", NORM: "слобода"},
-    {ORTH: "ст. ", NORM: "станция"},
+    {ORTH: "ст.", NORM: "станция"},
     {ORTH: "ст-ца", NORM: "станица"},
     {ORTH: "у.", NORM: "улус"},
     {ORTH: "х.", NORM: "хутор"},
@@ -388,8 +393,9 @@ for abbr in [
     {ORTH: "прим.", NORM: "примечание"},
     {ORTH: "прим.ред.", NORM: "примечание редакции"},
     {ORTH: "см. также", NORM: "смотри также"},
-    {ORTH: "кв.м.", NORM: "квадрантный метр"},
+    {ORTH: "см.", NORM: "смотри"},
-    {ORTH: "м2", NORM: "квадрантный метр"},
+    {ORTH: "кв.м.", NORM: "квадратный метр"},
+    {ORTH: "м2", NORM: "квадратный метр"},
     {ORTH: "б/у", NORM: "бывший в употреблении"},
     {ORTH: "сокр.", NORM: "сокращение"},
     {ORTH: "чел.", NORM: "человек"},

spacy/lang/uk/lemmatizer.py

@@ -18,7 +18,7 @@ class UkrainianLemmatizer(RussianLemmatizer):
         overwrite: bool = False,
         scorer: Optional[Callable] = lemmatizer_score,
     ) -> None:
-        if mode == "pymorphy2":
+        if mode in {"pymorphy2", "pymorphy2_lookup"}:
             try:
                 from pymorphy2 import MorphAnalyzer
             except ImportError:
@@ -29,7 +29,7 @@ class UkrainianLemmatizer(RussianLemmatizer):
                 ) from None
             if getattr(self, "_morph", None) is None:
                 self._morph = MorphAnalyzer(lang="uk")
-        elif mode == "pymorphy3":
+        elif mode in {"pymorphy3", "pymorphy3_lookup"}:
             try:
                 from pymorphy3 import MorphAnalyzer
             except ImportError:

spacy/language.py

@@ -1,4 +1,4 @@
-from typing import Iterator, Optional, Any, Dict, Callable, Iterable, Collection
+from typing import Iterator, Optional, Any, Dict, Callable, Iterable
 from typing import Union, Tuple, List, Set, Pattern, Sequence
 from typing import NoReturn, TYPE_CHECKING, TypeVar, cast, overload
 
@@ -10,6 +10,7 @@ from contextlib import contextmanager
 from copy import deepcopy
 from pathlib import Path
 import warnings
+
 from thinc.api import get_current_ops, Config, CupyOps, Optimizer
 import srsly
 import multiprocessing as mp
@@ -24,7 +25,7 @@ from .pipe_analysis import validate_attrs, analyze_pipes, print_pipe_analysis
 from .training import Example, validate_examples
 from .training.initialize import init_vocab, init_tok2vec
 from .scorer import Scorer
-from .util import registry, SimpleFrozenList, _pipe, raise_error
+from .util import registry, SimpleFrozenList, _pipe, raise_error, _DEFAULT_EMPTY_PIPES
 from .util import SimpleFrozenDict, combine_score_weights, CONFIG_SECTION_ORDER
 from .util import warn_if_jupyter_cupy
 from .lang.tokenizer_exceptions import URL_MATCH, BASE_EXCEPTIONS
@@ -42,8 +43,7 @@ from .lookups import load_lookups
 from .compat import Literal
 
 
-if TYPE_CHECKING:
+PipeCallable = Callable[[Doc], Doc]
-    from .pipeline import Pipe  # noqa: F401
 
 
 # This is the base config will all settings (training etc.)
@@ -180,7 +180,7 @@ class Language:
         self.vocab: Vocab = vocab
         if self.lang is None:
             self.lang = self.vocab.lang
-        self._components: List[Tuple[str, "Pipe"]] = []
+        self._components: List[Tuple[str, PipeCallable]] = []
         self._disabled: Set[str] = set()
         self.max_length = max_length
         # Create the default tokenizer from the default config
@@ -302,7 +302,7 @@ class Language:
         return SimpleFrozenList(names)
 
     @property
-    def components(self) -> List[Tuple[str, "Pipe"]]:
+    def components(self) -> List[Tuple[str, PipeCallable]]:
         """Get all (name, component) tuples in the pipeline, including the
         currently disabled components.
         """
@@ -321,12 +321,12 @@ class Language:
         return SimpleFrozenList(names, error=Errors.E926.format(attr="component_names"))
 
     @property
-    def pipeline(self) -> List[Tuple[str, "Pipe"]]:
+    def pipeline(self) -> List[Tuple[str, PipeCallable]]:
         """The processing pipeline consisting of (name, component) tuples. The
         components are called on the Doc in order as it passes through the
         pipeline.
 
-        RETURNS (List[Tuple[str, Pipe]]): The pipeline.
+        RETURNS (List[Tuple[str, Callable[[Doc], Doc]]]): The pipeline.
         """
         pipes = [(n, p) for n, p in self._components if n not in self._disabled]
         return SimpleFrozenList(pipes, error=Errors.E926.format(attr="pipeline"))
@@ -526,7 +526,7 @@ class Language:
         assigns: Iterable[str] = SimpleFrozenList(),
         requires: Iterable[str] = SimpleFrozenList(),
         retokenizes: bool = False,
-        func: Optional["Pipe"] = None,
+        func: Optional[PipeCallable] = None,
     ) -> Callable[..., Any]:
         """Register a new pipeline component. Can be used for stateless function
         components that don't require a separate factory. Can be used as a
@@ -541,7 +541,7 @@ class Language:
             e.g. "token.ent_id". Used for pipeline analysis.
         retokenizes (bool): Whether the component changes the tokenization.
             Used for pipeline analysis.
-        func (Optional[Callable]): Factory function if not used as a decorator.
+        func (Optional[Callable[[Doc], Doc]): Factory function if not used as a decorator.
 
         DOCS: https://spacy.io/api/language#component
         """
@@ -552,11 +552,11 @@ class Language:
                 raise ValueError(Errors.E853.format(name=name))
         component_name = name if name is not None else util.get_object_name(func)
 
-        def add_component(component_func: "Pipe") -> Callable:
+        def add_component(component_func: PipeCallable) -> Callable:
             if isinstance(func, type):  # function is a class
                 raise ValueError(Errors.E965.format(name=component_name))
 
-            def factory_func(nlp, name: str) -> "Pipe":
+            def factory_func(nlp, name: str) -> PipeCallable:
                 return component_func
 
             internal_name = cls.get_factory_name(name)
@@ -606,7 +606,7 @@ class Language:
             print_pipe_analysis(analysis, keys=keys)
         return analysis
 
-    def get_pipe(self, name: str) -> "Pipe":
+    def get_pipe(self, name: str) -> PipeCallable:
         """Get a pipeline component for a given component name.
 
         name (str): Name of pipeline component to get.
@@ -627,7 +627,7 @@ class Language:
         config: Dict[str, Any] = SimpleFrozenDict(),
         raw_config: Optional[Config] = None,
         validate: bool = True,
-    ) -> "Pipe":
+    ) -> PipeCallable:
         """Create a pipeline component. Mostly used internally. To create and
         add a component to the pipeline, you can use nlp.add_pipe.
 
@@ -639,7 +639,7 @@ class Language:
         raw_config (Optional[Config]): Internals: the non-interpolated config.
         validate (bool): Whether to validate the component config against the
             arguments and types expected by the factory.
-        RETURNS (Pipe): The pipeline component.
+        RETURNS (Callable[[Doc], Doc]): The pipeline component.
 
         DOCS: https://spacy.io/api/language#create_pipe
         """
@@ -694,24 +694,18 @@ class Language:
 
     def create_pipe_from_source(
         self, source_name: str, source: "Language", *, name: str
-    ) -> Tuple["Pipe", str]:
+    ) -> Tuple[PipeCallable, str]:
         """Create a pipeline component by copying it from an existing model.
 
         source_name (str): Name of the component in the source pipeline.
         source (Language): The source nlp object to copy from.
         name (str): Optional alternative name to use in current pipeline.
-        RETURNS (Tuple[Callable, str]): The component and its factory name.
+        RETURNS (Tuple[Callable[[Doc], Doc], str]): The component and its factory name.
         """
         # Check source type
         if not isinstance(source, Language):
             raise ValueError(Errors.E945.format(name=source_name, source=type(source)))
-        # Check vectors, with faster checks first
+        if self.vocab.vectors != source.vocab.vectors:
-        if (
-            self.vocab.vectors.shape != source.vocab.vectors.shape
-            or self.vocab.vectors.key2row != source.vocab.vectors.key2row
-            or self.vocab.vectors.to_bytes(exclude=["strings"])
-            != source.vocab.vectors.to_bytes(exclude=["strings"])
-        ):
             warnings.warn(Warnings.W113.format(name=source_name))
         if source_name not in source.component_names:
             raise KeyError(
@@ -745,7 +739,7 @@ class Language:
         config: Dict[str, Any] = SimpleFrozenDict(),
         raw_config: Optional[Config] = None,
         validate: bool = True,
-    ) -> "Pipe":
+    ) -> PipeCallable:
         """Add a component to the processing pipeline. Valid components are
         callables that take a `Doc` object, modify it and return it. Only one
         of before/after/first/last can be set. Default behaviour is "last".
@@ -768,7 +762,7 @@ class Language:
         raw_config (Optional[Config]): Internals: the non-interpolated config.
         validate (bool): Whether to validate the component config against the
             arguments and types expected by the factory.
-        RETURNS (Pipe): The pipeline component.
+        RETURNS (Callable[[Doc], Doc]): The pipeline component.
 
         DOCS: https://spacy.io/api/language#add_pipe
         """
@@ -789,14 +783,6 @@ class Language:
                 factory_name, source, name=name
             )
         else:
-            if not self.has_factory(factory_name):
-                err = Errors.E002.format(
-                    name=factory_name,
-                    opts=", ".join(self.factory_names),
-                    method="add_pipe",
-                    lang=util.get_object_name(self),
-                    lang_code=self.lang,
-                )
             pipe_component = self.create_pipe(
                 factory_name,
                 name=name,
@@ -882,7 +868,7 @@ class Language:
         *,
         config: Dict[str, Any] = SimpleFrozenDict(),
         validate: bool = True,
-    ) -> "Pipe":
+    ) -> PipeCallable:
         """Replace a component in the pipeline.
 
         name (str): Name of the component to replace.
@@ -891,7 +877,7 @@ class Language:
             component. Will be merged with default config, if available.
         validate (bool): Whether to validate the component config against the
             arguments and types expected by the factory.
-        RETURNS (Pipe): The new pipeline component.
+        RETURNS (Callable[[Doc], Doc]): The new pipeline component.
 
         DOCS: https://spacy.io/api/language#replace_pipe
         """
@@ -943,11 +929,11 @@ class Language:
             init_cfg = self._config["initialize"]["components"].pop(old_name)
             self._config["initialize"]["components"][new_name] = init_cfg
 
-    def remove_pipe(self, name: str) -> Tuple[str, "Pipe"]:
+    def remove_pipe(self, name: str) -> Tuple[str, PipeCallable]:
         """Remove a component from the pipeline.
 
         name (str): Name of the component to remove.
-        RETURNS (tuple): A `(name, component)` tuple of the removed component.
+        RETURNS (Tuple[str, Callable[[Doc], Doc]]): A `(name, component)` tuple of the removed component.
 
         DOCS: https://spacy.io/api/language#remove_pipe
         """
@@ -1253,15 +1239,6 @@ class Language:
             sgd(key, W, dW)  # type: ignore[call-arg, misc]
         return losses
 
-    def begin_training(
-        self,
-        get_examples: Optional[Callable[[], Iterable[Example]]] = None,
-        *,
-        sgd: Optional[Optimizer] = None,
-    ) -> Optimizer:
-        warnings.warn(Warnings.W089, DeprecationWarning)
-        return self.initialize(get_examples, sgd=sgd)
-
     def initialize(
         self,
         get_examples: Optional[Callable[[], Iterable[Example]]] = None,
@@ -1362,15 +1339,15 @@ class Language:
 
     def set_error_handler(
         self,
-        error_handler: Callable[[str, "Pipe", List[Doc], Exception], NoReturn],
+        error_handler: Callable[[str, PipeCallable, List[Doc], Exception], NoReturn],
     ):
-        """Set an error handler object for all the components in the pipeline that implement
+        """Set an error handler object for all the components in the pipeline
-        a set_error_handler function.
+        that implement a set_error_handler function.
 
-        error_handler (Callable[[str, Pipe, List[Doc], Exception], NoReturn]):
+        error_handler (Callable[[str, Callable[[Doc], Doc], List[Doc], Exception], NoReturn]):
-            Function that deals with a failing batch of documents. This callable function should take in
+            Function that deals with a failing batch of documents. This callable
-            the component's name, the component itself, the offending batch of documents, and the exception
+            function should take in the component's name, the component itself,
-            that was thrown.
+            the offending batch of documents, and the exception that was thrown.
         DOCS: https://spacy.io/api/language#set_error_handler
         """
         self.default_error_handler = error_handler
@@ -1698,9 +1675,9 @@ class Language:
         config: Union[Dict[str, Any], Config] = {},
         *,
         vocab: Union[Vocab, bool] = True,
-        disable: Union[str, Iterable[str]] = SimpleFrozenList(),
+        disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
-        enable: Union[str, Iterable[str]] = SimpleFrozenList(),
+        enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
-        exclude: Union[str, Iterable[str]] = SimpleFrozenList(),
+        exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
         meta: Dict[str, Any] = SimpleFrozenDict(),
         auto_fill: bool = True,
         validate: bool = True,
@@ -1727,12 +1704,6 @@ class Language:
 
         DOCS: https://spacy.io/api/language#from_config
         """
-        if isinstance(disable, str):
-            disable = [disable]
-        if isinstance(enable, str):
-            enable = [enable]
-        if isinstance(exclude, str):
-            exclude = [exclude]
         if auto_fill:
             config = Config(
                 cls.default_config, section_order=CONFIG_SECTION_ORDER
@@ -1877,9 +1848,29 @@ class Language:
             nlp.vocab.from_bytes(vocab_b)
 
         # Resolve disabled/enabled settings.
+        if isinstance(disable, str):
+            disable = [disable]
+        if isinstance(enable, str):
+            enable = [enable]
+        if isinstance(exclude, str):
+            exclude = [exclude]
+
+        # `enable` should not be merged with `enabled` (the opposite is true for `disable`/`disabled`). If the config
+        # specifies values for `enabled` not included in `enable`, emit warning.
+        if id(enable) != id(_DEFAULT_EMPTY_PIPES):
+            enabled = config["nlp"].get("enabled", [])
+            if len(enabled) and not set(enabled).issubset(enable):
+                warnings.warn(
+                    Warnings.W123.format(
+                        enable=enable,
+                        enabled=enabled,
+                    )
+                )
+
+        # Ensure sets of disabled/enabled pipe names are not contradictory.
         disabled_pipes = cls._resolve_component_status(
-            [*config["nlp"]["disabled"], *disable],
+            list({*disable, *config["nlp"].get("disabled", [])}),
-            [*config["nlp"].get("enabled", []), *enable],
+            enable,
             config["nlp"]["pipeline"],
         )
         nlp._disabled = set(p for p in disabled_pipes if p not in exclude)
@@ -2060,18 +2051,13 @@ class Language:
         if enable:
             if isinstance(enable, str):
                 enable = [enable]
-            to_disable = [
+            to_disable = {
-                pipe_name for pipe_name in pipe_names if pipe_name not in enable
+                *[pipe_name for pipe_name in pipe_names if pipe_name not in enable],
-            ]
+                *disable,
-            if disable and disable != to_disable:
+            }
-                raise ValueError(
+            # If any pipe to be enabled is in to_disable, the specification is inconsistent.
-                    Errors.E1042.format(
+            if len(set(enable) & to_disable):
-                        arg1="enable",
+                raise ValueError(Errors.E1042.format(enable=enable, disable=disable))
-                        arg2="disable",
-                        arg1_values=enable,
-                        arg2_values=disable,
-                    )
-                )
 
         return tuple(to_disable)
 

spacy/lexeme.pxd

@@ -5,7 +5,6 @@ from .attrs cimport attr_id_t
 from .attrs cimport ID, ORTH, LOWER, NORM, SHAPE, PREFIX, SUFFIX, LENGTH, LANG
 
 from .structs cimport LexemeC
-from .strings cimport StringStore
 from .vocab cimport Vocab
 
 

spacy/lexeme.pyi

@@ -20,7 +20,6 @@ class Lexeme:
     def vector_norm(self) -> float: ...
     vector: Floats1d
     rank: int
-    sentiment: float
     @property
     def orth_(self) -> str: ...
     @property

spacy/lexeme.pyx

@@ -173,19 +173,6 @@ cdef class Lexeme:
         def __set__(self, value):
             self.c.id = value
 
-    property sentiment:
-        """RETURNS (float): A scalar value indicating the positivity or
-            negativity of the lexeme."""
-        def __get__(self):
-            sentiment_table = self.vocab.lookups.get_table("lexeme_sentiment", {})
-            return sentiment_table.get(self.c.orth, 0.0)
-
-        def __set__(self, float x):
-            if "lexeme_sentiment" not in self.vocab.lookups:
-                self.vocab.lookups.add_table("lexeme_sentiment")
-            sentiment_table = self.vocab.lookups.get_table("lexeme_sentiment")
-            sentiment_table[self.c.orth] = x
-
     @property
     def orth_(self):
         """RETURNS (str): The original verbatim text of the lexeme

spacy/matcher/__init__.py

@@ -1,5 +1,6 @@
 from .matcher import Matcher
 from .phrasematcher import PhraseMatcher
 from .dependencymatcher import DependencyMatcher
+from .levenshtein import levenshtein
 
-__all__ = ["Matcher", "PhraseMatcher", "DependencyMatcher"]
+__all__ = ["Matcher", "PhraseMatcher", "DependencyMatcher", "levenshtein"]

spacy/matcher/levenshtein.pyx

@@ -0,0 +1,15 @@
+# cython: profile=True, binding=True, infer_types=True
+from cpython.object cimport PyObject
+from libc.stdint cimport int64_t
+
+from typing import Optional
+
+
+cdef extern from "polyleven.c":
+    int64_t polyleven(PyObject *o1, PyObject *o2, int64_t k)
+
+
+cpdef int64_t levenshtein(a: str, b: str, k: Optional[int] = None):
+    if k is None:
+        k = -1
+    return polyleven(<PyObject*>a, <PyObject*>b, k)

spacy/matcher/matcher.pyx

@@ -1,4 +1,4 @@
-# cython: infer_types=True, cython: profile=True
+# cython: infer_types=True, profile=True
 from typing import List, Iterable
 
 from libcpp.vector cimport vector
@@ -22,7 +22,7 @@ from ..attrs cimport ID, attr_id_t, NULL_ATTR, ORTH, POS, TAG, DEP, LEMMA, MORPH
 
 from ..schemas import validate_token_pattern
 from ..errors import Errors, MatchPatternError, Warnings
-from ..strings import get_string_id
+from ..strings cimport get_string_id
 from ..attrs import IDS
 
 

spacy/matcher/polyleven.c

@@ -0,0 +1,384 @@
+/*
+ * Adapted from Polyleven (https://ceptord.net/)
+ *
+ * Source: https://github.com/fujimotos/polyleven/blob/c3f95a080626c5652f0151a2e449963288ccae84/polyleven.c
+ *
+ * Copyright (c) 2021 Fujimoto Seiji <fujimoto@ceptord.net>
+ * Copyright (c) 2021 Max Bachmann <kontakt@maxbachmann.de>
+ * Copyright (c) 2022 Nick Mazuk
+ * Copyright (c) 2022 Michael Weiss <code@mweiss.ch>
+ *
+ * Permission is hereby granted, free of charge, to any person obtaining a copy
+ * of this software and associated documentation files (the "Software"), to deal
+ * in the Software without restriction, including without limitation the rights
+ * to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
+ * copies of the Software, and to permit persons to whom the Software is
+ * furnished to do so, subject to the following conditions:
+ *
+ * The above copyright notice and this permission notice shall be included in all
+ * copies or substantial portions of the Software.
+ *
+ * THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
+ * IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
+ * FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
+ * AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
+ * LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
+ * OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
+ * SOFTWARE.
+ */
+
+#include <Python.h>
+#include <stdint.h>
+
+#define MIN(a,b) ((a) < (b) ? (a) : (b))
+#define MAX(a,b) ((a) > (b) ? (a) : (b))
+#define CDIV(a,b) ((a) / (b) + ((a) % (b) > 0))
+#define BIT(i,n) (((i) >> (n)) & 1)
+#define FLIP(i,n) ((i) ^ ((uint64_t) 1 << (n)))
+#define ISASCII(kd) ((kd) == PyUnicode_1BYTE_KIND)
+
+/*
+ * Bare bone of PyUnicode
+ */
+struct strbuf {
+    void *ptr;
+    int kind;
+    int64_t len;
+};
+
+static void strbuf_init(struct strbuf *s, PyObject *o)
+{
+    s->ptr = PyUnicode_DATA(o);
+    s->kind = PyUnicode_KIND(o);
+    s->len = PyUnicode_GET_LENGTH(o);
+}
+
+#define strbuf_read(s, i) PyUnicode_READ((s)->kind, (s)->ptr, (i))
+
+/*
+ * An encoded mbleven model table.
+ *
+ * Each 8-bit integer represents an edit sequence, with using two
+ * bits for a single operation.
+ *
+ *   01 = DELETE, 10 = INSERT, 11 = REPLACE
+ *
+ * For example, 13 is '1101' in binary notation, so it means
+ * DELETE + REPLACE.
+ */
+static const uint8_t MBLEVEN_MATRIX[] = {
+     3,   0,  0,  0,  0,  0,  0,  0,
+     1,   0,  0,  0,  0,  0,  0,  0,
+     15,  9,  6,  0,  0,  0,  0,  0,
+     13,  7,  0,  0,  0,  0,  0,  0,
+     5,   0,  0,  0,  0,  0,  0,  0,
+     63, 39, 45, 57, 54, 30, 27,  0,
+     61, 55, 31, 37, 25, 22,  0,  0,
+     53, 29, 23,  0,  0,  0,  0,  0,
+     21,  0,  0,  0,  0,  0,  0,  0,
+};
+
+#define MBLEVEN_MATRIX_GET(k, d) ((((k) + (k) * (k)) / 2 - 1) + (d)) * 8
+
+static int64_t mbleven_ascii(char *s1, int64_t len1,
+                             char *s2, int64_t len2, int k)
+{
+    int pos;
+    uint8_t m;
+    int64_t i, j, c, r;
+
+    pos = MBLEVEN_MATRIX_GET(k, len1 - len2);
+    r = k + 1;
+
+    while (MBLEVEN_MATRIX[pos]) {
+        m = MBLEVEN_MATRIX[pos++];
+        i = j = c = 0;
+        while (i < len1 && j < len2) {
+            if (s1[i] != s2[j]) {
+                c++;
+                if (!m) break;
+                if (m & 1) i++;
+                if (m & 2) j++;
+                m >>= 2;
+            } else {
+                i++;
+                j++;
+            }
+        }
+        c += (len1 - i) + (len2 - j);
+        r = MIN(r, c);
+        if (r < 2) {
+            return r;
+        }
+    }
+    return r;
+}
+
+static int64_t mbleven(PyObject *o1, PyObject *o2, int64_t k)
+{
+    int pos;
+    uint8_t m;
+    int64_t i, j, c, r;
+    struct strbuf s1, s2;
+
+    strbuf_init(&s1, o1);
+    strbuf_init(&s2, o2);
+
+    if (s1.len < s2.len)
+        return mbleven(o2, o1, k);
+
+    if (k > 3)
+        return -1;
+
+    if (k < s1.len - s2.len)
+        return k + 1;
+
+    if (ISASCII(s1.kind) && ISASCII(s2.kind))
+        return mbleven_ascii(s1.ptr, s1.len, s2.ptr, s2.len, k);
+
+    pos = MBLEVEN_MATRIX_GET(k, s1.len - s2.len);
+    r = k + 1;
+
+    while (MBLEVEN_MATRIX[pos]) {
+        m = MBLEVEN_MATRIX[pos++];
+        i = j = c = 0;
+        while (i < s1.len && j < s2.len) {
+            if (strbuf_read(&s1, i) != strbuf_read(&s2, j)) {
+                c++;
+                if (!m) break;
+                if (m & 1) i++;
+                if (m & 2) j++;
+                m >>= 2;
+            } else {
+                i++;
+                j++;
+            }
+        }
+        c += (s1.len - i) + (s2.len - j);
+        r = MIN(r, c);
+        if (r < 2) {
+            return r;
+        }
+    }
+    return r;
+}
+
+/*
+ * Data structure to store Peq (equality bit-vector).
+ */
+struct blockmap_entry {
+    uint32_t key[128];
+    uint64_t val[128];
+};
+
+struct blockmap {
+    int64_t nr;
+    struct blockmap_entry *list;
+};
+
+#define blockmap_key(c) ((c) | 0x80000000U)
+#define blockmap_hash(c) ((c) % 128)
+
+static int blockmap_init(struct blockmap *map, struct strbuf *s)
+{
+    int64_t i;
+    struct blockmap_entry *be;
+    uint32_t c, k;
+    uint8_t h;
+
+    map->nr = CDIV(s->len, 64);
+    map->list = calloc(1,  map->nr * sizeof(struct blockmap_entry));
+    if (map->list == NULL) {
+        PyErr_NoMemory();
+        return -1;
+    }
+
+    for (i = 0; i < s->len; i++) {
+        be = &(map->list[i / 64]);
+        c = strbuf_read(s, i);
+        h = blockmap_hash(c);
+        k = blockmap_key(c);
+
+        while (be->key[h] && be->key[h] != k)
+            h = blockmap_hash(h + 1);
+        be->key[h] = k;
+        be->val[h] |= (uint64_t) 1 << (i % 64);
+    }
+    return 0;
+}
+
+static void blockmap_clear(struct blockmap *map)
+{
+    if (map->list)
+        free(map->list);
+    map->list = NULL;
+    map->nr = 0;
+}
+
+static uint64_t blockmap_get(struct blockmap *map, int block, uint32_t c)
+{
+    struct blockmap_entry *be;
+    uint8_t h;
+    uint32_t k;
+
+    h = blockmap_hash(c);
+    k = blockmap_key(c);
+
+    be = &(map->list[block]);
+    while (be->key[h] && be->key[h] != k)
+        h = blockmap_hash(h + 1);
+    return be->key[h] == k ? be->val[h] : 0;
+}
+
+/*
+ * Myers' bit-parallel algorithm
+ *
+ * See: G. Myers. "A fast bit-vector algorithm for approximate string
+ *      matching based on dynamic programming." Journal of the ACM, 1999.
+ */
+static int64_t myers1999_block(struct strbuf *s1, struct strbuf *s2,
+                               struct blockmap *map)
+{
+    uint64_t Eq, Xv, Xh, Ph, Mh, Pv, Mv, Last;
+    uint64_t *Mhc, *Phc;
+    int64_t i, b, hsize, vsize, Score;
+    uint8_t Pb, Mb;
+
+    hsize = CDIV(s1->len, 64);
+    vsize = CDIV(s2->len, 64);
+    Score = s2->len;
+
+    Phc = malloc(hsize * 2 * sizeof(uint64_t));
+    if (Phc == NULL) {
+        PyErr_NoMemory();
+        return -1;
+    }
+    Mhc = Phc + hsize;
+    memset(Phc, -1, hsize * sizeof(uint64_t));
+    memset(Mhc, 0, hsize * sizeof(uint64_t));
+    Last = (uint64_t)1 << ((s2->len - 1) % 64);
+
+    for (b = 0; b < vsize; b++) {
+        Mv = 0;
+        Pv = (uint64_t) -1;
+        Score = s2->len;
+
+        for (i = 0; i < s1->len; i++) {
+            Eq = blockmap_get(map, b, strbuf_read(s1, i));
+
+            Pb = BIT(Phc[i / 64], i % 64);
+            Mb = BIT(Mhc[i / 64], i % 64);
+
+            Xv = Eq | Mv;
+            Xh = ((((Eq | Mb) & Pv) + Pv) ^ Pv) | Eq | Mb;
+
+            Ph = Mv | ~ (Xh | Pv);
+            Mh = Pv & Xh;
+
+            if (Ph & Last) Score++;
+            if (Mh & Last) Score--;
+
+            if ((Ph >> 63) ^ Pb)
+                Phc[i / 64] = FLIP(Phc[i / 64], i % 64);
+
+            if ((Mh >> 63) ^ Mb)
+                Mhc[i / 64] = FLIP(Mhc[i / 64], i % 64);
+
+            Ph = (Ph << 1) | Pb;
+            Mh = (Mh << 1) | Mb;
+
+            Pv = Mh | ~ (Xv | Ph);
+            Mv = Ph & Xv;
+        }
+    }
+    free(Phc);
+    return Score;
+}
+
+static int64_t myers1999_simple(uint8_t *s1, int64_t len1, uint8_t *s2, int64_t len2)
+{
+    uint64_t Peq[256];
+    uint64_t Eq, Xv, Xh, Ph, Mh, Pv, Mv, Last;
+    int64_t i;
+    int64_t Score = len2;
+
+    memset(Peq, 0, sizeof(Peq));
+
+    for (i = 0; i < len2; i++)
+        Peq[s2[i]] |= (uint64_t) 1 << i;
+
+    Mv = 0;
+    Pv = (uint64_t) -1;
+    Last = (uint64_t) 1 << (len2 - 1);
+
+    for (i = 0; i < len1; i++) {
+        Eq = Peq[s1[i]];
+
+        Xv = Eq | Mv;
+        Xh = (((Eq & Pv) + Pv) ^ Pv) | Eq;
+
+        Ph = Mv | ~ (Xh | Pv);
+        Mh = Pv & Xh;
+
+        if (Ph & Last) Score++;
+        if (Mh & Last) Score--;
+
+        Ph = (Ph << 1) | 1;
+        Mh = (Mh << 1);
+
+        Pv = Mh | ~ (Xv | Ph);
+        Mv = Ph & Xv;
+    }
+    return Score;
+}
+
+static int64_t myers1999(PyObject *o1, PyObject *o2)
+{
+    struct strbuf s1, s2;
+    struct blockmap map;
+    int64_t ret;
+
+    strbuf_init(&s1, o1);
+    strbuf_init(&s2, o2);
+
+    if (s1.len < s2.len)
+        return myers1999(o2, o1);
+
+    if (ISASCII(s1.kind) && ISASCII(s2.kind) && s2.len < 65)
+        return myers1999_simple(s1.ptr, s1.len, s2.ptr, s2.len);
+
+    if (blockmap_init(&map, &s2))
+        return -1;
+
+    ret = myers1999_block(&s1, &s2, &map);
+    blockmap_clear(&map);
+    return ret;
+}
+
+/*
+ * Interface functions
+ */
+static int64_t polyleven(PyObject *o1, PyObject *o2, int64_t k)
+{
+    int64_t len1, len2;
+
+    len1 = PyUnicode_GET_LENGTH(o1);
+    len2 = PyUnicode_GET_LENGTH(o2);
+
+    if (len1 < len2)
+        return polyleven(o2, o1, k);
+
+    if (k == 0)
+        return PyUnicode_Compare(o1, o2) ? 1 : 0;
+
+    if (0 < k && k < len1 - len2)
+        return k + 1;
+
+    if (len2 == 0)
+        return len1;
+
+    if (0 < k && k < 4)
+        return mbleven(o1, o2, k);
+
+    return myers1999(o1, o2);
+}

spacy/ml/callbacks.py

@@ -89,11 +89,14 @@ def pipes_with_nvtx_range(
                 types.MethodType(nvtx_range_wrapper_for_pipe_method, pipe), func
             )
 
-            # Try to preserve the original function signature.
+            # We need to preserve the original function signature so that
+            # the original parameters are passed to pydantic for validation downstream.
             try:
                 wrapped_func.__signature__ = inspect.signature(func)  # type: ignore
             except:
-                pass
+                # Can fail for Cython methods that do not have bindings.
+                warnings.warn(Warnings.W122.format(method=name, pipe=pipe.name))
+                continue
 
             try:
                 setattr(

spacy/ml/models/entity_linker.py

@@ -1,11 +1,12 @@
 from pathlib import Path
 from typing import Optional, Callable, Iterable, List, Tuple
 from thinc.types import Floats2d
-from thinc.api import chain, clone, list2ragged, reduce_mean, residual
+from thinc.api import chain, list2ragged, reduce_mean, residual
-from thinc.api import Model, Maxout, Linear, noop, tuplify, Ragged
+from thinc.api import Model, Maxout, Linear, tuplify, Ragged
 
 from ...util import registry
-from ...kb import KnowledgeBase, Candidate, get_candidates
+from ...kb import KnowledgeBase, InMemoryLookupKB
+from ...kb import Candidate, get_candidates, get_candidates_batch
 from ...vocab import Vocab
 from ...tokens import Span, Doc
 from ..extract_spans import extract_spans
@@ -70,17 +71,18 @@ def span_maker_forward(model, docs: List[Doc], is_train) -> Tuple[Ragged, Callab
             cands.append((start_token, end_token))
 
         candidates.append(ops.asarray2i(cands))
-    candlens = ops.asarray1i([len(cands) for cands in candidates])
+    lengths = model.ops.asarray1i([len(cands) for cands in candidates])
-    candidates = ops.xp.concatenate(candidates)
+    out = Ragged(model.ops.flatten(candidates), lengths)
-    outputs = Ragged(candidates, candlens)
     # because this is just rearranging docs, the backprop does nothing
-    return outputs, lambda x: []
+    return out, lambda x: []
 
 
 @registry.misc("spacy.KBFromFile.v1")
-def load_kb(kb_path: Path) -> Callable[[Vocab], KnowledgeBase]:
+def load_kb(
-    def kb_from_file(vocab):
+    kb_path: Path,
-        kb = KnowledgeBase(vocab, entity_vector_length=1)
+) -> Callable[[Vocab], KnowledgeBase]:
+    def kb_from_file(vocab: Vocab):
+        kb = InMemoryLookupKB(vocab, entity_vector_length=1)
         kb.from_disk(kb_path)
         return kb
 
@@ -88,9 +90,11 @@ def load_kb(kb_path: Path) -> Callable[[Vocab], KnowledgeBase]:
 
 
 @registry.misc("spacy.EmptyKB.v1")
-def empty_kb(entity_vector_length: int) -> Callable[[Vocab], KnowledgeBase]:
+def empty_kb(
-    def empty_kb_factory(vocab):
+    entity_vector_length: int,
-        return KnowledgeBase(vocab=vocab, entity_vector_length=entity_vector_length)
+) -> Callable[[Vocab], KnowledgeBase]:
+    def empty_kb_factory(vocab: Vocab):
+        return InMemoryLookupKB(vocab=vocab, entity_vector_length=entity_vector_length)
 
     return empty_kb_factory
 
@@ -98,3 +102,10 @@ def empty_kb(entity_vector_length: int) -> Callable[[Vocab], KnowledgeBase]:
 @registry.misc("spacy.CandidateGenerator.v1")
 def create_candidates() -> Callable[[KnowledgeBase, Span], Iterable[Candidate]]:
     return get_candidates
+
+
+@registry.misc("spacy.CandidateBatchGenerator.v1")
+def create_candidates_batch() -> Callable[
+    [KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]
+]:
+    return get_candidates_batch

spacy/ml/tb_framework.pyx

@@ -191,7 +191,7 @@ def _forward_greedy_cpu(model: Model, TransitionSystem moves, states: List[State
     scores = _parse_batch(cblas, moves, &c_states[0], weights, sizes, actions=actions)
 
     def backprop(dY):
-        raise ValueError(Errors.E4001)
+        raise ValueError(Errors.E4002)
 
     return (states, scores), backprop
 

spacy/pipeline/__init__.py

@@ -3,7 +3,6 @@ from .dep_parser import DependencyParser
 from .edit_tree_lemmatizer import EditTreeLemmatizer
 from .entity_linker import EntityLinker
 from .ner import EntityRecognizer
-from .entity_ruler import EntityRuler
 from .lemmatizer import Lemmatizer
 from .morphologizer import Morphologizer
 from .pipe import Pipe
@@ -23,7 +22,6 @@ __all__ = [
     "DependencyParser",
     "EntityLinker",
     "EntityRecognizer",
-    "EntityRuler",
     "Morphologizer",
     "Lemmatizer",
     "MultiLabel_TextCategorizer",

spacy/pipeline/edit_tree_lemmatizer.py

@@ -1,13 +1,13 @@
-from typing import cast, Any, Callable, Dict, Iterable, List, Optional
+from typing import cast, Any, Callable, Dict, Iterable, List, Optional, Union
-from typing import Sequence, Tuple, Union
+from typing import Tuple
 from collections import Counter
-from copy import deepcopy
 from itertools import islice
 import numpy as np
 
 import srsly
-from thinc.api import Config, Model, SequenceCategoricalCrossentropy
+from thinc.api import Config, Model
 from thinc.types import ArrayXd, Floats2d, Ints1d
+from thinc.legacy import LegacySequenceCategoricalCrossentropy
 
 from ._edit_tree_internals.edit_trees import EditTrees
 from ._edit_tree_internals.schemas import validate_edit_tree
@@ -130,7 +130,9 @@ class EditTreeLemmatizer(TrainablePipe):
         self, examples: Iterable[Example], scores: List[Floats2d]
     ) -> Tuple[float, List[Floats2d]]:
         validate_examples(examples, "EditTreeLemmatizer.get_loss")
-        loss_func = SequenceCategoricalCrossentropy(normalize=False, missing_value=-1)
+        loss_func = LegacySequenceCategoricalCrossentropy(
+            normalize=False, missing_value=-1
+        )
 
         truths = []
         for eg in examples:
@@ -348,9 +350,9 @@ class EditTreeLemmatizer(TrainablePipe):
 
             tree = dict(tree)
             if "orig" in tree:
-                tree["orig"] = self.vocab.strings[tree["orig"]]
+                tree["orig"] = self.vocab.strings.add(tree["orig"])
             if "orig" in tree:
-                tree["subst"] = self.vocab.strings[tree["subst"]]
+                tree["subst"] = self.vocab.strings.add(tree["subst"])
 
             trees.append(tree)
 

spacy/pipeline/entity_linker.py

@@ -60,9 +60,11 @@ DEFAULT_NEL_MODEL = Config().from_str(default_model_config)["model"]
         "incl_context": True,
         "entity_vector_length": 64,
         "get_candidates": {"@misc": "spacy.CandidateGenerator.v1"},
+        "get_candidates_batch": {"@misc": "spacy.CandidateBatchGenerator.v1"},
         "overwrite": True,
         "scorer": {"@scorers": "spacy.entity_linker_scorer.v1"},
         "use_gold_ents": True,
+        "candidates_batch_size": 1,
         "threshold": None,
         "save_activations": False,
     },
@@ -83,9 +85,13 @@ def make_entity_linker(
     incl_context: bool,
     entity_vector_length: int,
     get_candidates: Callable[[KnowledgeBase, Span], Iterable[Candidate]],
+    get_candidates_batch: Callable[
+        [KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]
+    ],
     overwrite: bool,
     scorer: Optional[Callable],
     use_gold_ents: bool,
+    candidates_batch_size: int,
     threshold: Optional[float] = None,
     save_activations: bool,
 ):
@@ -99,18 +105,22 @@ def make_entity_linker(
     incl_prior (bool): Whether or not to include prior probabilities from the KB in the model.
     incl_context (bool): Whether or not to include the local context in the model.
     entity_vector_length (int): Size of encoding vectors in the KB.
-    get_candidates (Callable[[KnowledgeBase, "Span"], Iterable[Candidate]]): Function that
+    get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that
         produces a list of candidates, given a certain knowledge base and a textual mention.
+    get_candidates_batch (
+        Callable[[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]], Iterable[Candidate]]
+        ): Function that produces a list of candidates, given a certain knowledge base and several textual mentions.
     scorer (Optional[Callable]): The scoring method.
     use_gold_ents (bool): Whether to copy entities from gold docs or not. If false, another
         component must provide entity annotations.
+    candidates_batch_size (int): Size of batches for entity candidate generation.
     threshold (Optional[float]): Confidence threshold for entity predictions. If confidence is below the threshold,
         prediction is discarded. If None, predictions are not filtered by any threshold.
     save_activations (bool): save model activations in Doc when annotating.
     """
 
     if not model.attrs.get("include_span_maker", False):
-        # The only difference in arguments here is that use_gold_ents is not available
+        # The only difference in arguments here is that use_gold_ents and threshold aren't available.
         return EntityLinker_v1(
             nlp.vocab,
             model,
@@ -134,9 +144,11 @@ def make_entity_linker(
         incl_context=incl_context,
         entity_vector_length=entity_vector_length,
         get_candidates=get_candidates,
+        get_candidates_batch=get_candidates_batch,
         overwrite=overwrite,
         scorer=scorer,
         use_gold_ents=use_gold_ents,
+        candidates_batch_size=candidates_batch_size,
         threshold=threshold,
         save_activations=save_activations,
     )
@@ -171,9 +183,13 @@ class EntityLinker(TrainablePipe):
         incl_context: bool,
         entity_vector_length: int,
         get_candidates: Callable[[KnowledgeBase, Span], Iterable[Candidate]],
+        get_candidates_batch: Callable[
+            [KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]
+        ],
         overwrite: bool = BACKWARD_OVERWRITE,
         scorer: Optional[Callable] = entity_linker_score,
         use_gold_ents: bool,
+        candidates_batch_size: int,
         threshold: Optional[float] = None,
         save_activations: bool = False,
     ) -> None:
@@ -190,10 +206,14 @@ class EntityLinker(TrainablePipe):
         entity_vector_length (int): Size of encoding vectors in the KB.
         get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that
             produces a list of candidates, given a certain knowledge base and a textual mention.
-        scorer (Optional[Callable]): The scoring method. Defaults to
+        get_candidates_batch (
-            Scorer.score_links.
+            Callable[[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]],
+            Iterable[Candidate]]
+            ): Function that produces a list of candidates, given a certain knowledge base and several textual mentions.
+        scorer (Optional[Callable]): The scoring method. Defaults to Scorer.score_links.
         use_gold_ents (bool): Whether to copy entities from gold docs or not. If false, another
             component must provide entity annotations.
+        candidates_batch_size (int): Size of batches for entity candidate generation.
         threshold (Optional[float]): Confidence threshold for entity predictions. If confidence is below the
             threshold, prediction is discarded. If None, predictions are not filtered by any threshold.
         DOCS: https://spacy.io/api/entitylinker#init
@@ -216,23 +236,28 @@ class EntityLinker(TrainablePipe):
         self.incl_prior = incl_prior
         self.incl_context = incl_context
         self.get_candidates = get_candidates
+        self.get_candidates_batch = get_candidates_batch
         self.cfg: Dict[str, Any] = {"overwrite": overwrite}
         self.distance = CosineDistance(normalize=False)
         # how many neighbour sentences to take into account
-        # create an empty KB by default. If you want to load a predefined one, specify it in 'initialize'.
+        # create an empty KB by default
         self.kb = empty_kb(entity_vector_length)(self.vocab)
         self.scorer = scorer
         self.use_gold_ents = use_gold_ents
+        self.candidates_batch_size = candidates_batch_size
         self.threshold = threshold
         self.save_activations = save_activations
 
+        if candidates_batch_size < 1:
+            raise ValueError(Errors.E1044)
+
     def set_kb(self, kb_loader: Callable[[Vocab], KnowledgeBase]):
         """Define the KB of this pipe by providing a function that will
         create it using this object's vocab."""
         if not callable(kb_loader):
             raise ValueError(Errors.E885.format(arg_type=type(kb_loader)))
 
-        self.kb = kb_loader(self.vocab)
+        self.kb = kb_loader(self.vocab)  # type: ignore
 
     def validate_kb(self) -> None:
         # Raise an error if the knowledge base is not initialized.
@@ -254,8 +279,8 @@ class EntityLinker(TrainablePipe):
         get_examples (Callable[[], Iterable[Example]]): Function that
             returns a representative sample of gold-standard Example objects.
         nlp (Language): The current nlp object the component is part of.
-        kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates a KnowledgeBase from a Vocab instance.
+        kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates a KnowledgeBase from a Vocab
-            Note that providing this argument, will overwrite all data accumulated in the current KB.
+            instance. Note that providing this argument will overwrite all data accumulated in the current KB.
             Use this only when loading a KB as-such from file.
 
         DOCS: https://spacy.io/api/entitylinker#initialize
@@ -439,36 +464,50 @@ class EntityLinker(TrainablePipe):
                 docs_ents.append(Ragged(xp.zeros(0, dtype="uint64"), ops.alloc1i(0)))
                 continue
             sentences = [s for s in doc.sents]
-            # Looping through each entity (TODO: rewrite)
-            for ent in doc.ents:
-                sent_index = sentences.index(ent.sent)
-                assert sent_index >= 0
 
-                if self.incl_context:
+            # Loop over entities in batches.
-                    # get n_neighbour sentences, clipped to the length of the document
+            for ent_idx in range(0, len(doc.ents), self.candidates_batch_size):
-                    start_sentence = max(0, sent_index - self.n_sents)
+                ent_batch = doc.ents[ent_idx : ent_idx + self.candidates_batch_size]
-                    end_sentence = min(len(sentences) - 1, sent_index + self.n_sents)
+
-                    start_token = sentences[start_sentence].start
+                # Look up candidate entities.
-                    end_token = sentences[end_sentence].end
+                valid_ent_idx = [
-                    sent_doc = doc[start_token:end_token].as_doc()
+                    idx
-                    # currently, the context is the same for each entity in a sentence (should be refined)
+                    for idx in range(len(ent_batch))
-                    sentence_encoding = self.model.predict([sent_doc])[0]
+                    if ent_batch[idx].label_ not in self.labels_discard
-                    sentence_encoding_t = sentence_encoding.T
+                ]
-                    sentence_norm = xp.linalg.norm(sentence_encoding_t)
+
-                entity_count += 1
+                batch_candidates = list(
-                if ent.label_ in self.labels_discard:
+                    self.get_candidates_batch(
-                    # ignoring this entity - setting to NIL
+                        self.kb, [ent_batch[idx] for idx in valid_ent_idx]
-                    final_kb_ids.append(self.NIL)
-                    self._add_activations(
-                        doc_scores=doc_scores,
-                        doc_ents=doc_ents,
-                        scores=[0.0],
-                        ents=[0],
                     )
-                else:
+                    if self.candidates_batch_size > 1
-                    candidates = list(self.get_candidates(self.kb, ent))
+                    else [
-                    if not candidates:
+                        self.get_candidates(self.kb, ent_batch[idx])
-                        # no prediction possible for this entity - setting to NIL
+                        for idx in valid_ent_idx
+                    ]
+                )
+
+                # Looping through each entity in batch (TODO: rewrite)
+                for j, ent in enumerate(ent_batch):
+                    sent_index = sentences.index(ent.sent)
+                    assert sent_index >= 0
+
+                    if self.incl_context:
+                        # get n_neighbour sentences, clipped to the length of the document
+                        start_sentence = max(0, sent_index - self.n_sents)
+                        end_sentence = min(
+                            len(sentences) - 1, sent_index + self.n_sents
+                        )
+                        start_token = sentences[start_sentence].start
+                        end_token = sentences[end_sentence].end
+                        sent_doc = doc[start_token:end_token].as_doc()
+                        # currently, the context is the same for each entity in a sentence (should be refined)
+                        sentence_encoding = self.model.predict([sent_doc])[0]
+                        sentence_encoding_t = sentence_encoding.T
+                        sentence_norm = xp.linalg.norm(sentence_encoding_t)
+                    entity_count += 1
+                    if ent.label_ in self.labels_discard:
+                        # ignoring this entity - setting to NIL
                         final_kb_ids.append(self.NIL)
                         self._add_activations(
                             doc_scores=doc_scores,
@@ -476,53 +515,65 @@ class EntityLinker(TrainablePipe):
                             scores=[0.0],
                             ents=[0],
                         )
-                    elif len(candidates) == 1 and self.threshold is None:
-                        # shortcut for efficiency reasons: take the 1 candidate
-                        final_kb_ids.append(candidates[0].entity_)
-                        self._add_activations(
-                            doc_scores=doc_scores,
-                            doc_ents=doc_ents,
-                            scores=[1.0],
-                            ents=[candidates[0].entity_],
-                        )
                     else:
-                        random.shuffle(candidates)
+                        candidates = list(batch_candidates[j])
-                        # set all prior probabilities to 0 if incl_prior=False
+                        if not candidates:
-                        prior_probs = xp.asarray([c.prior_prob for c in candidates])
+                            # no prediction possible for this entity - setting to NIL
-                        if not self.incl_prior:
+                            final_kb_ids.append(self.NIL)
-                            prior_probs = xp.asarray([0.0 for _ in candidates])
+                            self._add_activations(
-                        scores = prior_probs
+                                doc_scores=doc_scores,
-                        # add in similarity from the context
+                                doc_ents=doc_ents,
-                        if self.incl_context:
+                                scores=[0.0],
-                            entity_encodings = xp.asarray(
+                                ents=[0],
-                                [c.entity_vector for c in candidates]
                             )
-                            entity_norm = xp.linalg.norm(entity_encodings, axis=1)
+                        elif len(candidates) == 1 and self.threshold is None:
-                            if len(entity_encodings) != len(prior_probs):
+                            # shortcut for efficiency reasons: take the 1 candidate
-                                raise RuntimeError(
+                            final_kb_ids.append(candidates[0].entity_)
-                                    Errors.E147.format(
+                            self._add_activations(
-                                        method="predict",
+                                doc_scores=doc_scores,
-                                        msg="vectors not of equal length",
+                                doc_ents=doc_ents,
-                                    )
+                                scores=[1.0],
+                                ents=[candidates[0].entity_],
+                            )
+                        else:
+                            random.shuffle(candidates)
+                            # set all prior probabilities to 0 if incl_prior=False
+                            prior_probs = xp.asarray([c.prior_prob for c in candidates])
+                            if not self.incl_prior:
+                                prior_probs = xp.asarray([0.0 for _ in candidates])
+                            scores = prior_probs
+                            # add in similarity from the context
+                            if self.incl_context:
+                                entity_encodings = xp.asarray(
+                                    [c.entity_vector for c in candidates]
                                 )
-                            # cosine similarity
+                                entity_norm = xp.linalg.norm(entity_encodings, axis=1)
-                            sims = xp.dot(entity_encodings, sentence_encoding_t) / (
+                                if len(entity_encodings) != len(prior_probs):
-                                sentence_norm * entity_norm
+                                    raise RuntimeError(
+                                        Errors.E147.format(
+                                            method="predict",
+                                            msg="vectors not of equal length",
+                                        )
+                                    )
+                                # cosine similarity
+                                sims = xp.dot(entity_encodings, sentence_encoding_t) / (
+                                    sentence_norm * entity_norm
+                                )
+                                if sims.shape != prior_probs.shape:
+                                    raise ValueError(Errors.E161)
+                                scores = prior_probs + sims - (prior_probs * sims)
+                            final_kb_ids.append(
+                                candidates[scores.argmax().item()].entity_
+                                if self.threshold is None
+                                or scores.max() >= self.threshold
+                                else EntityLinker.NIL
+                            )
+                            self._add_activations(
+                                doc_scores=doc_scores,
+                                doc_ents=doc_ents,
+                                scores=scores,
+                                ents=[c.entity for c in candidates],
                             )
-                            if sims.shape != prior_probs.shape:
-                                raise ValueError(Errors.E161)
-                            scores = prior_probs + sims - (prior_probs * sims)
-                        final_kb_ids.append(
-                            candidates[scores.argmax().item()].entity_
-                            if self.threshold is None or scores.max() >= self.threshold
-                            else EntityLinker.NIL
-                        )
-                        self._add_activations(
-                            doc_scores=doc_scores,
-                            doc_ents=doc_ents,
-                            scores=scores,
-                            ents=[c.entity for c in candidates],
-                        )
             self._add_doc_activations(
                 docs_scores=docs_scores,
                 docs_ents=docs_ents,

spacy/pipeline/entity_ruler.py

@@ -1,526 +0,0 @@
-import warnings
-from typing import Optional, Union, List, Dict, Tuple, Iterable, Any, Callable, Sequence
-from typing import cast
-from collections import defaultdict
-from pathlib import Path
-import srsly
-
-from .pipe import Pipe
-from ..training import Example
-from ..language import Language
-from ..errors import Errors, Warnings
-from ..util import ensure_path, to_disk, from_disk, SimpleFrozenList, registry
-from ..tokens import Doc, Span
-from ..matcher import Matcher, PhraseMatcher
-from ..scorer import get_ner_prf
-
-
-DEFAULT_ENT_ID_SEP = "||"
-PatternType = Dict[str, Union[str, List[Dict[str, Any]]]]
-
-
-@Language.factory(
-    "entity_ruler",
-    assigns=["doc.ents", "token.ent_type", "token.ent_iob"],
-    default_config={
-        "phrase_matcher_attr": None,
-        "validate": False,
-        "overwrite_ents": False,
-        "ent_id_sep": DEFAULT_ENT_ID_SEP,
-        "scorer": {"@scorers": "spacy.entity_ruler_scorer.v1"},
-    },
-    default_score_weights={
-        "ents_f": 1.0,
-        "ents_p": 0.0,
-        "ents_r": 0.0,
-        "ents_per_type": None,
-    },
-)
-def make_entity_ruler(
-    nlp: Language,
-    name: str,
-    phrase_matcher_attr: Optional[Union[int, str]],
-    validate: bool,
-    overwrite_ents: bool,
-    ent_id_sep: str,
-    scorer: Optional[Callable],
-):
-    return EntityRuler(
-        nlp,
-        name,
-        phrase_matcher_attr=phrase_matcher_attr,
-        validate=validate,
-        overwrite_ents=overwrite_ents,
-        ent_id_sep=ent_id_sep,
-        scorer=scorer,
-    )
-
-
-def entity_ruler_score(examples, **kwargs):
-    return get_ner_prf(examples)
-
-
-@registry.scorers("spacy.entity_ruler_scorer.v1")
-def make_entity_ruler_scorer():
-    return entity_ruler_score
-
-
-class EntityRuler(Pipe):
-    """The EntityRuler lets you add spans to the `Doc.ents` using token-based
-    rules or exact phrase matches. It can be combined with the statistical
-    `EntityRecognizer` to boost accuracy, or used on its own to implement a
-    purely rule-based entity recognition system. After initialization, the
-    component is typically added to the pipeline using `nlp.add_pipe`.
-
-    DOCS: https://spacy.io/api/entityruler
-    USAGE: https://spacy.io/usage/rule-based-matching#entityruler
-    """
-
-    def __init__(
-        self,
-        nlp: Language,
-        name: str = "entity_ruler",
-        *,
-        phrase_matcher_attr: Optional[Union[int, str]] = None,
-        validate: bool = False,
-        overwrite_ents: bool = False,
-        ent_id_sep: str = DEFAULT_ENT_ID_SEP,
-        patterns: Optional[List[PatternType]] = None,
-        scorer: Optional[Callable] = entity_ruler_score,
-    ) -> None:
-        """Initialize the entity ruler. If patterns are supplied here, they
-        need to be a list of dictionaries with a `"label"` and `"pattern"`
-        key. A pattern can either be a token pattern (list) or a phrase pattern
-        (string). For example: `{'label': 'ORG', 'pattern': 'Apple'}`.
-
-        nlp (Language): The shared nlp object to pass the vocab to the matchers
-            and process phrase patterns.
-        name (str): Instance name of the current pipeline component. Typically
-            passed in automatically from the factory when the component is
-            added. Used to disable the current entity ruler while creating
-            phrase patterns with the nlp object.
-        phrase_matcher_attr (int / str): Token attribute to match on, passed
-            to the internal PhraseMatcher as `attr`
-        validate (bool): Whether patterns should be validated, passed to
-            Matcher and PhraseMatcher as `validate`
-        patterns (iterable): Optional patterns to load in.
-        overwrite_ents (bool): If existing entities are present, e.g. entities
-            added by the model, overwrite them by matches if necessary.
-        ent_id_sep (str): Separator used internally for entity IDs.
-        scorer (Optional[Callable]): The scoring method. Defaults to
-            spacy.scorer.get_ner_prf.
-
-        DOCS: https://spacy.io/api/entityruler#init
-        """
-        self.nlp = nlp
-        self.name = name
-        self.overwrite = overwrite_ents
-        self.token_patterns = defaultdict(list)  # type: ignore
-        self.phrase_patterns = defaultdict(list)  # type: ignore
-        self._validate = validate
-        self.matcher = Matcher(nlp.vocab, validate=validate)
-        self.phrase_matcher_attr = phrase_matcher_attr
-        self.phrase_matcher = PhraseMatcher(
-            nlp.vocab, attr=self.phrase_matcher_attr, validate=validate
-        )
-        self.ent_id_sep = ent_id_sep
-        self._ent_ids = defaultdict(tuple)  # type: ignore
-        if patterns is not None:
-            self.add_patterns(patterns)
-        self.scorer = scorer
-
-    def __len__(self) -> int:
-        """The number of all patterns added to the entity ruler."""
-        n_token_patterns = sum(len(p) for p in self.token_patterns.values())
-        n_phrase_patterns = sum(len(p) for p in self.phrase_patterns.values())
-        return n_token_patterns + n_phrase_patterns
-
-    def __contains__(self, label: str) -> bool:
-        """Whether a label is present in the patterns."""
-        return label in self.token_patterns or label in self.phrase_patterns
-
-    def __call__(self, doc: Doc) -> Doc:
-        """Find matches in document and add them as entities.
-
-        doc (Doc): The Doc object in the pipeline.
-        RETURNS (Doc): The Doc with added entities, if available.
-
-        DOCS: https://spacy.io/api/entityruler#call
-        """
-        error_handler = self.get_error_handler()
-        try:
-            matches = self.match(doc)
-            self.set_annotations(doc, matches)
-            return doc
-        except Exception as e:
-            return error_handler(self.name, self, [doc], e)
-
-    def match(self, doc: Doc):
-        self._require_patterns()
-        with warnings.catch_warnings():
-            warnings.filterwarnings("ignore", message="\\[W036")
-            matches = list(self.matcher(doc)) + list(self.phrase_matcher(doc))
-
-        final_matches = set(
-            [(m_id, start, end) for m_id, start, end in matches if start != end]
-        )
-        get_sort_key = lambda m: (m[2] - m[1], -m[1])
-        final_matches = sorted(final_matches, key=get_sort_key, reverse=True)
-        return final_matches
-
-    def set_annotations(self, doc, matches):
-        """Modify the document in place"""
-        entities = list(doc.ents)
-        new_entities = []
-        seen_tokens = set()
-        for match_id, start, end in matches:
-            if any(t.ent_type for t in doc[start:end]) and not self.overwrite:
-                continue
-            # check for end - 1 here because boundaries are inclusive
-            if start not in seen_tokens and end - 1 not in seen_tokens:
-                if match_id in self._ent_ids:
-                    label, ent_id = self._ent_ids[match_id]
-                    span = Span(doc, start, end, label=label, span_id=ent_id)
-                else:
-                    span = Span(doc, start, end, label=match_id)
-                new_entities.append(span)
-                entities = [
-                    e for e in entities if not (e.start < end and e.end > start)
-                ]
-                seen_tokens.update(range(start, end))
-        doc.ents = entities + new_entities
-
-    @property
-    def labels(self) -> Tuple[str, ...]:
-        """All labels present in the match patterns.
-
-        RETURNS (set): The string labels.
-
-        DOCS: https://spacy.io/api/entityruler#labels
-        """
-        keys = set(self.token_patterns.keys())
-        keys.update(self.phrase_patterns.keys())
-        all_labels = set()
-
-        for l in keys:
-            if self.ent_id_sep in l:
-                label, _ = self._split_label(l)
-                all_labels.add(label)
-            else:
-                all_labels.add(l)
-        return tuple(sorted(all_labels))
-
-    def initialize(
-        self,
-        get_examples: Callable[[], Iterable[Example]],
-        *,
-        nlp: Optional[Language] = None,
-        patterns: Optional[Sequence[PatternType]] = None,
-    ):
-        """Initialize the pipe for training.
-
-        get_examples (Callable[[], Iterable[Example]]): Function that
-            returns a representative sample of gold-standard Example objects.
-        nlp (Language): The current nlp object the component is part of.
-        patterns Optional[Iterable[PatternType]]: The list of patterns.
-
-        DOCS: https://spacy.io/api/entityruler#initialize
-        """
-        self.clear()
-        if patterns:
-            self.add_patterns(patterns)  # type: ignore[arg-type]
-
-    @property
-    def ent_ids(self) -> Tuple[Optional[str], ...]:
-        """All entity ids present in the match patterns `id` properties
-
-        RETURNS (set): The string entity ids.
-
-        DOCS: https://spacy.io/api/entityruler#ent_ids
-        """
-        keys = set(self.token_patterns.keys())
-        keys.update(self.phrase_patterns.keys())
-        all_ent_ids = set()
-
-        for l in keys:
-            if self.ent_id_sep in l:
-                _, ent_id = self._split_label(l)
-                all_ent_ids.add(ent_id)
-        return tuple(all_ent_ids)
-
-    @property
-    def patterns(self) -> List[PatternType]:
-        """Get all patterns that were added to the entity ruler.
-
-        RETURNS (list): The original patterns, one dictionary per pattern.
-
-        DOCS: https://spacy.io/api/entityruler#patterns
-        """
-        all_patterns = []
-        for label, patterns in self.token_patterns.items():
-            for pattern in patterns:
-                ent_label, ent_id = self._split_label(label)
-                p = {"label": ent_label, "pattern": pattern}
-                if ent_id:
-                    p["id"] = ent_id
-                all_patterns.append(p)
-        for label, patterns in self.phrase_patterns.items():
-            for pattern in patterns:
-                ent_label, ent_id = self._split_label(label)
-                p = {"label": ent_label, "pattern": pattern.text}
-                if ent_id:
-                    p["id"] = ent_id
-                all_patterns.append(p)
-        return all_patterns
-
-    def add_patterns(self, patterns: List[PatternType]) -> None:
-        """Add patterns to the entity ruler. A pattern can either be a token
-        pattern (list of dicts) or a phrase pattern (string). For example:
-        {'label': 'ORG', 'pattern': 'Apple'}
-        {'label': 'GPE', 'pattern': [{'lower': 'san'}, {'lower': 'francisco'}]}
-
-        patterns (list): The patterns to add.
-
-        DOCS: https://spacy.io/api/entityruler#add_patterns
-        """
-
-        # disable the nlp components after this one in case they hadn't been initialized / deserialised yet
-        try:
-            current_index = -1
-            for i, (name, pipe) in enumerate(self.nlp.pipeline):
-                if self == pipe:
-                    current_index = i
-                    break
-            subsequent_pipes = [pipe for pipe in self.nlp.pipe_names[current_index:]]
-        except ValueError:
-            subsequent_pipes = []
-        with self.nlp.select_pipes(disable=subsequent_pipes):
-            token_patterns = []
-            phrase_pattern_labels = []
-            phrase_pattern_texts = []
-            phrase_pattern_ids = []
-            for entry in patterns:
-                if isinstance(entry["pattern"], str):
-                    phrase_pattern_labels.append(entry["label"])
-                    phrase_pattern_texts.append(entry["pattern"])
-                    phrase_pattern_ids.append(entry.get("id"))
-                elif isinstance(entry["pattern"], list):
-                    token_patterns.append(entry)
-            phrase_patterns = []
-            for label, pattern, ent_id in zip(
-                phrase_pattern_labels,
-                self.nlp.pipe(phrase_pattern_texts),
-                phrase_pattern_ids,
-            ):
-                phrase_pattern = {"label": label, "pattern": pattern}
-                if ent_id:
-                    phrase_pattern["id"] = ent_id
-                phrase_patterns.append(phrase_pattern)
-            for entry in token_patterns + phrase_patterns:  # type: ignore[operator]
-                label = entry["label"]
-                if "id" in entry:
-                    ent_label = label
-                    label = self._create_label(label, entry["id"])
-                    key = self.matcher._normalize_key(label)
-                    self._ent_ids[key] = (ent_label, entry["id"])
-                pattern = entry["pattern"]  # type: ignore
-                if isinstance(pattern, Doc):
-                    self.phrase_patterns[label].append(pattern)
-                    self.phrase_matcher.add(label, [pattern])  # type: ignore
-                elif isinstance(pattern, list):
-                    self.token_patterns[label].append(pattern)
-                    self.matcher.add(label, [pattern])
-                else:
-                    raise ValueError(Errors.E097.format(pattern=pattern))
-
-    def clear(self) -> None:
-        """Reset all patterns."""
-        self.token_patterns = defaultdict(list)
-        self.phrase_patterns = defaultdict(list)
-        self._ent_ids = defaultdict(tuple)
-        self.matcher = Matcher(self.nlp.vocab, validate=self._validate)
-        self.phrase_matcher = PhraseMatcher(
-            self.nlp.vocab, attr=self.phrase_matcher_attr, validate=self._validate
-        )
-
-    def remove(self, ent_id: str) -> None:
-        """Remove a pattern by its ent_id if a pattern with this ent_id was added before
-
-        ent_id (str): id of the pattern to be removed
-        RETURNS: None
-        DOCS: https://spacy.io/api/entityruler#remove
-        """
-        label_id_pairs = [
-            (label, eid) for (label, eid) in self._ent_ids.values() if eid == ent_id
-        ]
-        if not label_id_pairs:
-            raise ValueError(
-                Errors.E1024.format(attr_type="ID", label=ent_id, component=self.name)
-            )
-        created_labels = [
-            self._create_label(label, eid) for (label, eid) in label_id_pairs
-        ]
-        # remove the patterns from self.phrase_patterns
-        self.phrase_patterns = defaultdict(
-            list,
-            {
-                label: val
-                for (label, val) in self.phrase_patterns.items()
-                if label not in created_labels
-            },
-        )
-        # remove the patterns from self.token_pattern
-        self.token_patterns = defaultdict(
-            list,
-            {
-                label: val
-                for (label, val) in self.token_patterns.items()
-                if label not in created_labels
-            },
-        )
-        # remove the patterns from self.token_pattern
-        for label in created_labels:
-            if label in self.phrase_matcher:
-                self.phrase_matcher.remove(label)
-            else:
-                self.matcher.remove(label)
-
-    def _require_patterns(self) -> None:
-        """Raise a warning if this component has no patterns defined."""
-        if len(self) == 0:
-            warnings.warn(Warnings.W036.format(name=self.name))
-
-    def _split_label(self, label: str) -> Tuple[str, Optional[str]]:
-        """Split Entity label into ent_label and ent_id if it contains self.ent_id_sep
-
-        label (str): The value of label in a pattern entry
-        RETURNS (tuple): ent_label, ent_id
-        """
-        if self.ent_id_sep in label:
-            ent_label, ent_id = label.rsplit(self.ent_id_sep, 1)
-        else:
-            ent_label = label
-            ent_id = None  # type: ignore
-        return ent_label, ent_id
-
-    def _create_label(self, label: Any, ent_id: Any) -> str:
-        """Join Entity label with ent_id if the pattern has an `id` attribute
-        If ent_id is not a string, the label is returned as is.
-
-        label (str): The label to set for ent.label_
-        ent_id (str): The label
-        RETURNS (str): The ent_label joined with configured `ent_id_sep`
-        """
-        if isinstance(ent_id, str):
-            label = f"{label}{self.ent_id_sep}{ent_id}"
-        return label
-
-    def from_bytes(
-        self, patterns_bytes: bytes, *, exclude: Iterable[str] = SimpleFrozenList()
-    ) -> "EntityRuler":
-        """Load the entity ruler from a bytestring.
-
-        patterns_bytes (bytes): The bytestring to load.
-        RETURNS (EntityRuler): The loaded entity ruler.
-
-        DOCS: https://spacy.io/api/entityruler#from_bytes
-        """
-        cfg = srsly.msgpack_loads(patterns_bytes)
-        self.clear()
-        if isinstance(cfg, dict):
-            self.add_patterns(cfg.get("patterns", cfg))
-            self.overwrite = cfg.get("overwrite", False)
-            self.phrase_matcher_attr = cfg.get("phrase_matcher_attr", None)
-            self.phrase_matcher = PhraseMatcher(
-                self.nlp.vocab, attr=self.phrase_matcher_attr
-            )
-            self.ent_id_sep = cfg.get("ent_id_sep", DEFAULT_ENT_ID_SEP)
-        else:
-            self.add_patterns(cfg)
-        return self
-
-    def to_bytes(self, *, exclude: Iterable[str] = SimpleFrozenList()) -> bytes:
-        """Serialize the entity ruler patterns to a bytestring.
-
-        RETURNS (bytes): The serialized patterns.
-
-        DOCS: https://spacy.io/api/entityruler#to_bytes
-        """
-        serial = {
-            "overwrite": self.overwrite,
-            "ent_id_sep": self.ent_id_sep,
-            "phrase_matcher_attr": self.phrase_matcher_attr,
-            "patterns": self.patterns,
-        }
-        return srsly.msgpack_dumps(serial)
-
-    def from_disk(
-        self, path: Union[str, Path], *, exclude: Iterable[str] = SimpleFrozenList()
-    ) -> "EntityRuler":
-        """Load the entity ruler from a file. Expects a file containing
-        newline-delimited JSON (JSONL) with one entry per line.
-
-        path (str / Path): The JSONL file to load.
-        RETURNS (EntityRuler): The loaded entity ruler.
-
-        DOCS: https://spacy.io/api/entityruler#from_disk
-        """
-        path = ensure_path(path)
-        self.clear()
-        depr_patterns_path = path.with_suffix(".jsonl")
-        if path.suffix == ".jsonl":  # user provides a jsonl
-            if path.is_file:
-                patterns = srsly.read_jsonl(path)
-                self.add_patterns(patterns)
-            else:
-                raise ValueError(Errors.E1023.format(path=path))
-        elif depr_patterns_path.is_file():
-            patterns = srsly.read_jsonl(depr_patterns_path)
-            self.add_patterns(patterns)
-        elif path.is_dir():  # path is a valid directory
-            cfg = {}
-            deserializers_patterns = {
-                "patterns": lambda p: self.add_patterns(
-                    srsly.read_jsonl(p.with_suffix(".jsonl"))
-                )
-            }
-            deserializers_cfg = {"cfg": lambda p: cfg.update(srsly.read_json(p))}
-            from_disk(path, deserializers_cfg, {})
-            self.overwrite = cfg.get("overwrite", False)
-            self.phrase_matcher_attr = cfg.get("phrase_matcher_attr")
-            self.ent_id_sep = cfg.get("ent_id_sep", DEFAULT_ENT_ID_SEP)
-
-            self.phrase_matcher = PhraseMatcher(
-                self.nlp.vocab, attr=self.phrase_matcher_attr
-            )
-            from_disk(path, deserializers_patterns, {})
-        else:  # path is not a valid directory or file
-            raise ValueError(Errors.E146.format(path=path))
-        return self
-
-    def to_disk(
-        self, path: Union[str, Path], *, exclude: Iterable[str] = SimpleFrozenList()
-    ) -> None:
-        """Save the entity ruler patterns to a directory. The patterns will be
-        saved as newline-delimited JSON (JSONL).
-
-        path (str / Path): The JSONL file to save.
-
-        DOCS: https://spacy.io/api/entityruler#to_disk
-        """
-        path = ensure_path(path)
-        cfg = {
-            "overwrite": self.overwrite,
-            "phrase_matcher_attr": self.phrase_matcher_attr,
-            "ent_id_sep": self.ent_id_sep,
-        }
-        serializers = {
-            "patterns": lambda p: srsly.write_jsonl(
-                p.with_suffix(".jsonl"), self.patterns
-            ),
-            "cfg": lambda p: srsly.write_json(p, cfg),
-        }
-        if path.suffix == ".jsonl":  # user wants to save only JSONL
-            srsly.write_jsonl(path, self.patterns)
-        else:
-            to_disk(path, serializers, {})

spacy/pipeline/legacy/entity_linker.py

@@ -68,8 +68,7 @@ class EntityLinker_v1(TrainablePipe):
         entity_vector_length (int): Size of encoding vectors in the KB.
         get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that
             produces a list of candidates, given a certain knowledge base and a textual mention.
-        scorer (Optional[Callable]): The scoring method. Defaults to
+        scorer (Optional[Callable]): The scoring method. Defaults to Scorer.score_links.
-            Scorer.score_links.
         DOCS: https://spacy.io/api/entitylinker#init
         """
         self.vocab = vocab
@@ -115,7 +114,7 @@ class EntityLinker_v1(TrainablePipe):
         get_examples (Callable[[], Iterable[Example]]): Function that
             returns a representative sample of gold-standard Example objects.
         nlp (Language): The current nlp object the component is part of.
-        kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates a KnowledgeBase from a Vocab instance.
+        kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates an InMemoryLookupKB from a Vocab instance.
             Note that providing this argument, will overwrite all data accumulated in the current KB.
             Use this only when loading a KB as-such from file.
 

spacy/pipeline/morphologizer.pyx

@@ -1,7 +1,8 @@
 # cython: infer_types=True, profile=True, binding=True
 from typing import Callable, Dict, Iterable, List, Optional, Union
 import srsly
-from thinc.api import SequenceCategoricalCrossentropy, Model, Config
+from thinc.api import Model, Config
+from thinc.legacy import LegacySequenceCategoricalCrossentropy
 from thinc.types import Floats2d, Ints1d
 from itertools import islice
 
@@ -290,7 +291,7 @@ class Morphologizer(Tagger):
         DOCS: https://spacy.io/api/morphologizer#get_loss
         """
         validate_examples(examples, "Morphologizer.get_loss")
-        loss_func = SequenceCategoricalCrossentropy(names=tuple(self.labels), normalize=False)
+        loss_func = LegacySequenceCategoricalCrossentropy(names=tuple(self.labels), normalize=False)
         truths = []
         for eg in examples:
             eg_truths = []

spacy/pipeline/multitask.pyx

@@ -1,221 +0,0 @@
-# cython: infer_types=True, profile=True, binding=True
-from typing import Optional
-import numpy
-from thinc.api import CosineDistance, to_categorical, Model, Config
-from thinc.api import set_dropout_rate
-
-from ..tokens.doc cimport Doc
-
-from .trainable_pipe import TrainablePipe
-from .tagger import Tagger
-from ..training import validate_examples
-from ..language import Language
-from ._parser_internals import nonproj
-from ..attrs import POS, ID
-from ..errors import Errors
-
-
-default_model_config = """
-[model]
-@architectures = "spacy.MultiTask.v1"
-maxout_pieces = 3
-token_vector_width = 96
-
-[model.tok2vec]
-@architectures = "spacy.HashEmbedCNN.v2"
-pretrained_vectors = null
-width = 96
-depth = 4
-embed_size = 2000
-window_size = 1
-maxout_pieces = 2
-subword_features = true
-"""
-DEFAULT_MT_MODEL = Config().from_str(default_model_config)["model"]
-
-
-@Language.factory(
-    "nn_labeller",
-    default_config={"labels": None, "target": "dep_tag_offset", "model": DEFAULT_MT_MODEL}
-)
-def make_nn_labeller(nlp: Language, name: str, model: Model, labels: Optional[dict], target: str):
-    return MultitaskObjective(nlp.vocab, model, name)
-
-
-class MultitaskObjective(Tagger):
-    """Experimental: Assist training of a parser or tagger, by training a
-    side-objective.
-    """
-
-    def __init__(self, vocab, model, name="nn_labeller", *, target):
-        self.vocab = vocab
-        self.model = model
-        self.name = name
-        if target == "dep":
-            self.make_label = self.make_dep
-        elif target == "tag":
-            self.make_label = self.make_tag
-        elif target == "ent":
-            self.make_label = self.make_ent
-        elif target == "dep_tag_offset":
-            self.make_label = self.make_dep_tag_offset
-        elif target == "ent_tag":
-            self.make_label = self.make_ent_tag
-        elif target == "sent_start":
-            self.make_label = self.make_sent_start
-        elif hasattr(target, "__call__"):
-            self.make_label = target
-        else:
-            raise ValueError(Errors.E016)
-        cfg = {"labels": {}, "target": target}
-        self.cfg = dict(cfg)
-
-    @property
-    def labels(self):
-        return self.cfg.setdefault("labels", {})
-
-    @labels.setter
-    def labels(self, value):
-        self.cfg["labels"] = value
-
-    def set_annotations(self, docs, dep_ids):
-        pass
-
-    def initialize(self, get_examples, nlp=None, labels=None):
-        if not hasattr(get_examples, "__call__"):
-            err = Errors.E930.format(name="MultitaskObjective", obj=type(get_examples))
-            raise ValueError(err)
-        if labels is not None:
-            self.labels = labels
-        else:
-            for example in get_examples():
-                for token in example.y:
-                    label = self.make_label(token)
-                    if label is not None and label not in self.labels:
-                        self.labels[label] = len(self.labels)
-        self.model.initialize()   # TODO: fix initialization by defining X and Y
-
-    def predict(self, docs):
-        tokvecs = self.model.get_ref("tok2vec")(docs)
-        scores = self.model.get_ref("softmax")(tokvecs)
-        return tokvecs, scores
-
-    def get_loss(self, examples, scores):
-        cdef int idx = 0
-        correct = numpy.zeros((scores.shape[0],), dtype="i")
-        guesses = scores.argmax(axis=1)
-        docs = [eg.predicted for eg in examples]
-        for i, eg in enumerate(examples):
-            # Handles alignment for tokenization differences
-            doc_annots = eg.get_aligned()  # TODO
-            for j in range(len(eg.predicted)):
-                tok_annots = {key: values[j] for key, values in tok_annots.items()}
-                label = self.make_label(j, tok_annots)
-                if label is None or label not in self.labels:
-                    correct[idx] = guesses[idx]
-                else:
-                    correct[idx] = self.labels[label]
-                idx += 1
-        correct = self.model.ops.xp.array(correct, dtype="i")
-        d_scores = scores - to_categorical(correct, n_classes=scores.shape[1])
-        loss = (d_scores**2).sum()
-        return float(loss), d_scores
-
-    @staticmethod
-    def make_dep(token):
-        return token.dep_
-
-    @staticmethod
-    def make_tag(token):
-        return token.tag_
-
-    @staticmethod
-    def make_ent(token):
-        if token.ent_iob_ == "O":
-            return "O"
-        else:
-            return token.ent_iob_ + "-" + token.ent_type_
-
-    @staticmethod
-    def make_dep_tag_offset(token):
-        dep = token.dep_
-        tag = token.tag_
-        offset = token.head.i - token.i
-        offset = min(offset, 2)
-        offset = max(offset, -2)
-        return f"{dep}-{tag}:{offset}"
-
-    @staticmethod
-    def make_ent_tag(token):
-        if token.ent_iob_ == "O":
-            ent = "O"
-        else:
-            ent = token.ent_iob_ + "-" + token.ent_type_
-        tag = token.tag_
-        return f"{tag}-{ent}"
-
-    @staticmethod
-    def make_sent_start(token):
-        """A multi-task objective for representing sentence boundaries,
-        using BILU scheme. (O is impossible)
-        """
-        if token.is_sent_start and token.is_sent_end:
-            return "U-SENT"
-        elif token.is_sent_start:
-            return "B-SENT"
-        else:
-            return "I-SENT"
-
-
-class ClozeMultitask(TrainablePipe):
-    def __init__(self, vocab, model, **cfg):
-        self.vocab = vocab
-        self.model = model
-        self.cfg = cfg
-        self.distance = CosineDistance(ignore_zeros=True, normalize=False)  # TODO: in config
-
-    def set_annotations(self, docs, dep_ids):
-        pass
-
-    def initialize(self, get_examples, nlp=None):
-        self.model.initialize()  # TODO: fix initialization by defining X and Y
-        X = self.model.ops.alloc((5, self.model.get_ref("tok2vec").get_dim("nO")))
-        self.model.output_layer.initialize(X)
-
-    def predict(self, docs):
-        tokvecs = self.model.get_ref("tok2vec")(docs)
-        vectors = self.model.get_ref("output_layer")(tokvecs)
-        return tokvecs, vectors
-
-    def get_loss(self, examples, vectors, prediction):
-        validate_examples(examples, "ClozeMultitask.get_loss")
-        # The simplest way to implement this would be to vstack the
-        # token.vector values, but that's a bit inefficient, especially on GPU.
-        # Instead we fetch the index into the vectors table for each of our tokens,
-        # and look them up all at once. This prevents data copying.
-        ids = self.model.ops.flatten([eg.predicted.to_array(ID).ravel() for eg in examples])
-        target = vectors[ids]
-        gradient = self.distance.get_grad(prediction, target)
-        loss = self.distance.get_loss(prediction, target)
-        return float(loss), gradient
-
-    def update(self, examples, *, drop=0., sgd=None, losses=None):
-        pass
-
-    def rehearse(self, examples, drop=0., sgd=None, losses=None):
-        if losses is not None and self.name not in losses:
-            losses[self.name] = 0.
-        set_dropout_rate(self.model, drop)
-        validate_examples(examples, "ClozeMultitask.rehearse")
-        docs = [eg.predicted for eg in examples]
-        predictions, bp_predictions = self.model.begin_update()
-        loss, d_predictions = self.get_loss(examples, self.vocab.vectors.data, predictions)
-        bp_predictions(d_predictions)
-        if sgd is not None:
-            self.finish_update(sgd)
-        if losses is not None:
-            losses[self.name] += loss
-        return losses
-
-    def add_label(self, label):
-        raise NotImplementedError

spacy/pipeline/pipe.pyx

@@ -1,4 +1,4 @@
-# cython: infer_types=True, profile=True
+# cython: infer_types=True, profile=True, binding=True
 from typing import Optional, Tuple, Iterable, Iterator, Callable, Union, Dict
 import srsly
 import warnings
@@ -19,13 +19,6 @@ cdef class Pipe:
     DOCS: https://spacy.io/api/pipe
     """
 
-    @classmethod
-    def __init_subclass__(cls, **kwargs):
-        """Raise a warning if an inheriting class implements 'begin_training'
-         (from v2) instead of the new 'initialize' method (from v3)"""
-        if hasattr(cls, "begin_training"):
-            warnings.warn(Warnings.W088.format(name=cls.__name__))
-
     def __call__(self, Doc doc) -> Doc:
         """Apply the pipe to one document. The document is modified in place,
         and returned. This usually happens under the hood when the nlp object

spacy/pipeline/senter.pyx

@@ -3,7 +3,9 @@ from typing import Dict, Iterable, Optional, Callable, List, Union
 from itertools import islice
 
 import srsly
-from thinc.api import Model, SequenceCategoricalCrossentropy, Config
+from thinc.api import Model, Config
+from thinc.legacy import LegacySequenceCategoricalCrossentropy
+
 from thinc.types import Floats2d, Ints1d
 
 from ..tokens.doc cimport Doc
@@ -161,7 +163,7 @@ class SentenceRecognizer(Tagger):
         """
         validate_examples(examples, "SentenceRecognizer.get_loss")
         labels = self.labels
-        loss_func = SequenceCategoricalCrossentropy(names=labels, normalize=False)
+        loss_func = LegacySequenceCategoricalCrossentropy(names=labels, normalize=False)
         truths = []
         for eg in examples:
             eg_truth = []

spacy/pipeline/span_ruler.py

@@ -11,7 +11,7 @@ from ..language import Language
 from ..errors import Errors, Warnings
 from ..util import ensure_path, SimpleFrozenList, registry
 from ..tokens import Doc, Span
-from ..scorer import Scorer
+from ..scorer import Scorer, get_ner_prf
 from ..matcher import Matcher, PhraseMatcher
 from .. import util
 
@@ -20,7 +20,7 @@ DEFAULT_SPANS_KEY = "ruler"
 
 
 @Language.factory(
-    "future_entity_ruler",
+    "entity_ruler",
     assigns=["doc.ents"],
     default_config={
         "phrase_matcher_attr": None,
@@ -63,6 +63,15 @@ def make_entity_ruler(
     )
 
 
+def entity_ruler_score(examples, **kwargs):
+    return get_ner_prf(examples)
+
+
+@registry.scorers("spacy.entity_ruler_scorer.v1")
+def make_entity_ruler_scorer():
+    return entity_ruler_score
+
+
 @Language.factory(
     "span_ruler",
     assigns=["doc.spans"],
@@ -117,7 +126,7 @@ def prioritize_new_ents_filter(
 ) -> List[Span]:
     """Merge entities and spans into one list without overlaps by allowing
     spans to overwrite any entities that they overlap with. Intended to
-    replicate the overwrite_ents=True behavior from the EntityRuler.
+    replicate the overwrite_ents=True behavior from the v3 EntityRuler.
 
     entities (Iterable[Span]): The entities, already filtered for overlaps.
     spans (Iterable[Span]): The spans to merge, may contain overlaps.
@@ -148,7 +157,7 @@ def prioritize_existing_ents_filter(
 ) -> List[Span]:
     """Merge entities and spans into one list without overlaps by prioritizing
     existing entities. Intended to replicate the overwrite_ents=False behavior
-    from the EntityRuler.
+    from the v3 EntityRuler.
 
     entities (Iterable[Span]): The entities, already filtered for overlaps.
     spans (Iterable[Span]): The spans to merge, may contain overlaps.
@@ -170,7 +179,7 @@ def prioritize_existing_ents_filter(
 
 
 @registry.misc("spacy.prioritize_existing_ents_filter.v1")
-def make_preverse_existing_ents_filter():
+def make_preserve_existing_ents_filter():
     return prioritize_existing_ents_filter
 
 

spacy/pipeline/spancat.py

@@ -2,7 +2,7 @@ from typing import List, Dict, Callable, Tuple, Optional, Iterable, Any, cast
 from typing import Union
 from thinc.api import Config, Model, get_current_ops, set_dropout_rate, Ops
 from thinc.api import Optimizer
-from thinc.types import Ragged, Ints2d, Floats2d, Ints1d
+from thinc.types import Ragged, Ints2d, Floats2d
 
 import numpy
 
@@ -30,17 +30,17 @@ scorer = {"@layers": "spacy.LinearLogistic.v1"}
 hidden_size = 128
 
 [model.tok2vec]
-@architectures = "spacy.Tok2Vec.v1"
+@architectures = "spacy.Tok2Vec.v2"
 
 [model.tok2vec.embed]
-@architectures = "spacy.MultiHashEmbed.v1"
+@architectures = "spacy.MultiHashEmbed.v2"
 width = 96
 rows = [5000, 2000, 1000, 1000]
 attrs = ["ORTH", "PREFIX", "SUFFIX", "SHAPE"]
 include_static_vectors = false
 
 [model.tok2vec.encode]
-@architectures = "spacy.MaxoutWindowEncoder.v1"
+@architectures = "spacy.MaxoutWindowEncoder.v2"
 width = ${model.tok2vec.embed.width}
 window_size = 1
 maxout_pieces = 3
@@ -139,6 +139,9 @@ def make_spancat(
     spans_key (str): Key of the doc.spans dict to save the spans under. During
         initialization and training, the component will look for spans on the
         reference document under the same key.
+    scorer (Optional[Callable]): The scoring method. Defaults to
+        Scorer.score_spans for the Doc.spans[spans_key] with overlapping
+        spans allowed.
     threshold (float): Minimum probability to consider a prediction positive.
         Spans with a positive prediction will be saved on the Doc. Defaults to
         0.5.
@@ -279,7 +282,10 @@ class SpanCategorizer(TrainablePipe):
         DOCS: https://spacy.io/api/spancategorizer#predict
         """
         indices = self.suggester(docs, ops=self.model.ops)
-        scores = self.model.predict((docs, indices))  # type: ignore
+        if indices.lengths.sum() == 0:
+            scores = self.model.ops.alloc2f(0, 0)
+        else:
+            scores = self.model.predict((docs, indices))  # type: ignore
         return {"indices": indices, "scores": scores}
 
     def set_candidates(

spacy/pipeline/tagger.pyx

@@ -2,7 +2,8 @@
 from typing import Callable, Dict, Iterable, List, Optional, Union
 import numpy
 import srsly
-from thinc.api import Model, set_dropout_rate, SequenceCategoricalCrossentropy, Config
+from thinc.api import Model, set_dropout_rate, Config
+from thinc.legacy import LegacySequenceCategoricalCrossentropy
 from thinc.types import Floats2d, Ints1d
 import warnings
 from itertools import islice
@@ -244,7 +245,7 @@ class Tagger(TrainablePipe):
 
         DOCS: https://spacy.io/api/tagger#rehearse
         """
-        loss_func = SequenceCategoricalCrossentropy()
+        loss_func = LegacySequenceCategoricalCrossentropy()
         if losses is None:
             losses = {}
         losses.setdefault(self.name, 0.0)
@@ -275,7 +276,7 @@ class Tagger(TrainablePipe):
         DOCS: https://spacy.io/api/tagger#get_loss
         """
         validate_examples(examples, "Tagger.get_loss")
-        loss_func = SequenceCategoricalCrossentropy(names=self.labels, normalize=False, neg_prefix=self.cfg["neg_prefix"])
+        loss_func = LegacySequenceCategoricalCrossentropy(names=self.labels, normalize=False, neg_prefix=self.cfg["neg_prefix"])
         # Convert empty tag "" to missing value None so that both misaligned
         # tokens and tokens with missing annotation have the default missing
         # value None.

spacy/pipeline/textcat.py

@@ -27,8 +27,8 @@ single_label_default_config = """
 [model.tok2vec.embed]
 @architectures = "spacy.MultiHashEmbed.v2"
 width = 64
-rows = [2000, 2000, 1000, 1000, 1000, 1000]
+rows = [2000, 2000, 500, 1000, 500]
-attrs = ["ORTH", "LOWER", "PREFIX", "SUFFIX", "SHAPE", "ID"]
+attrs = ["NORM", "LOWER", "PREFIX", "SUFFIX", "SHAPE"]
 include_static_vectors = false
 
 [model.tok2vec.encode]
@@ -75,9 +75,9 @@ subword_features = true
     "textcat",
     assigns=["doc.cats"],
     default_config={
-        "threshold": 0.5,
+        "threshold": 0.0,
         "model": DEFAULT_SINGLE_TEXTCAT_MODEL,
-        "scorer": {"@scorers": "spacy.textcat_scorer.v1"},
+        "scorer": {"@scorers": "spacy.textcat_scorer.v2"},
         "save_activations": False,
     },
     default_score_weights={
@@ -91,7 +91,6 @@ subword_features = true
         "cats_macro_f": None,
         "cats_macro_auc": None,
         "cats_f_per_type": None,
-        "cats_macro_auc_per_type": None,
     },
 )
 def make_textcat(
@@ -131,7 +130,7 @@ def textcat_score(examples: Iterable[Example], **kwargs) -> Dict[str, Any]:
     )
 
 
-@registry.scorers("spacy.textcat_scorer.v1")
+@registry.scorers("spacy.textcat_scorer.v2")
 def make_textcat_scorer():
     return textcat_score
 
@@ -158,7 +157,8 @@ class TextCategorizer(TrainablePipe):
         model (thinc.api.Model): The Thinc Model powering the pipeline component.
         name (str): The component instance name, used to add entries to the
             losses during training.
-        threshold (float): Cutoff to consider a prediction "positive".
+        threshold (float): Unused, not needed for single-label (exclusive
+            classes) classification.
         scorer (Optional[Callable]): The scoring method. Defaults to
                 Scorer.score_cats for the attribute "cats".
 
@@ -168,7 +168,11 @@ class TextCategorizer(TrainablePipe):
         self.model = model
         self.name = name
         self._rehearsal_model = None
-        cfg = {"labels": [], "threshold": threshold, "positive_label": None}
+        cfg: Dict[str, Any] = {
+            "labels": [],
+            "threshold": threshold,
+            "positive_label": None,
+        }
         self.cfg = dict(cfg)
         self.scorer = scorer
         self.save_activations = save_activations
@@ -415,5 +419,9 @@ class TextCategorizer(TrainablePipe):
     def _validate_categories(self, examples: Iterable[Example]):
         """Check whether the provided examples all have single-label cats annotations."""
         for ex in examples:
-            if list(ex.reference.cats.values()).count(1.0) > 1:
+            vals = list(ex.reference.cats.values())
+            if vals.count(1.0) > 1:
                 raise ValueError(Errors.E895.format(value=ex.reference.cats))
+            for val in vals:
+                if not (val == 1.0 or val == 0.0):
+                    raise ValueError(Errors.E851.format(val=val))

spacy/pipeline/textcat_multilabel.py

@@ -19,17 +19,17 @@ multi_label_default_config = """
 @architectures = "spacy.TextCatEnsemble.v2"
 
 [model.tok2vec]
-@architectures = "spacy.Tok2Vec.v1"
+@architectures = "spacy.Tok2Vec.v2"
 
 [model.tok2vec.embed]
 @architectures = "spacy.MultiHashEmbed.v2"
 width = 64
-rows = [2000, 2000, 1000, 1000, 1000, 1000]
+rows = [2000, 2000, 500, 1000, 500]
-attrs = ["ORTH", "LOWER", "PREFIX", "SUFFIX", "SHAPE", "ID"]
+attrs = ["NORM", "LOWER", "PREFIX", "SUFFIX", "SHAPE"]
 include_static_vectors = false
 
 [model.tok2vec.encode]
-@architectures = "spacy.MaxoutWindowEncoder.v1"
+@architectures = "spacy.MaxoutWindowEncoder.v2"
 width = ${model.tok2vec.embed.width}
 window_size = 1
 maxout_pieces = 3
@@ -88,7 +88,6 @@ subword_features = true
         "cats_macro_f": None,
         "cats_macro_auc": None,
         "cats_f_per_type": None,
-        "cats_macro_auc_per_type": None,
     },
 )
 def make_multilabel_textcat(
@@ -98,7 +97,7 @@ def make_multilabel_textcat(
     threshold: float,
     scorer: Optional[Callable],
     save_activations: bool,
-) -> "TextCategorizer":
+) -> "MultiLabel_TextCategorizer":
     """Create a TextCategorizer component. The text categorizer predicts categories
     over a whole document. It can learn one or more labels, and the labels are considered
     to be non-mutually exclusive, which means that there can be zero or more labels
@@ -107,6 +106,7 @@ def make_multilabel_textcat(
     model (Model[List[Doc], List[Floats2d]]): A model instance that predicts
         scores for each category.
     threshold (float): Cutoff to consider a prediction "positive".
+    scorer (Optional[Callable]): The scoring method.
     """
     return MultiLabel_TextCategorizer(
         nlp.vocab,
@@ -155,6 +155,7 @@ class MultiLabel_TextCategorizer(TextCategorizer):
         name (str): The component instance name, used to add entries to the
             losses during training.
         threshold (float): Cutoff to consider a prediction "positive".
+        scorer (Optional[Callable]): The scoring method.
         save_activations (bool): save model activations in Doc when annotating.
 
         DOCS: https://spacy.io/api/textcategorizer#init
@@ -200,6 +201,8 @@ class MultiLabel_TextCategorizer(TextCategorizer):
             for label in labels:
                 self.add_label(label)
         subbatch = list(islice(get_examples(), 10))
+        self._validate_categories(subbatch)
+
         doc_sample = [eg.reference for eg in subbatch]
         label_sample, _ = self._examples_to_truth(subbatch)
         self._require_labels()
@@ -210,4 +213,8 @@ class MultiLabel_TextCategorizer(TextCategorizer):
     def _validate_categories(self, examples: Iterable[Example]):
         """This component allows any type of single- or multi-label annotations.
         This method overwrites the more strict one from 'textcat'."""
-        pass
+        # check that annotation values are valid
+        for ex in examples:
+            for val in ex.reference.cats.values():
+                if not (val == 1.0 or val == 0.0):
+                    raise ValueError(Errors.E851.format(val=val))

spacy/pipeline/tok2vec.py

@@ -123,9 +123,6 @@ class Tok2Vec(TrainablePipe):
             width = self.model.get_dim("nO")
             return [self.model.ops.alloc((0, width)) for doc in docs]
         tokvecs = self.model.predict(docs)
-        batch_id = Tok2VecListener.get_batch_id(docs)
-        for listener in self.listeners:
-            listener.receive(batch_id, tokvecs, _empty_backprop)
         return tokvecs
 
     def set_annotations(self, docs: Sequence[Doc], tokvecses) -> None:
@@ -286,8 +283,19 @@ class Tok2VecListener(Model):
 def forward(model: Tok2VecListener, inputs, is_train: bool):
     """Supply the outputs from the upstream Tok2Vec component."""
     if is_train:
-        model.verify_inputs(inputs)
+        # This might occur during training when the tok2vec layer is frozen / hasn't been updated.
-        return model._outputs, model._backprop
+        # In that case, it should be set to "annotating" so we can retrieve the embeddings from the doc.
+        if model._batch_id is None:
+            outputs = []
+            for doc in inputs:
+                if doc.tensor.size == 0:
+                    raise ValueError(Errors.E203.format(name="tok2vec"))
+                else:
+                    outputs.append(doc.tensor)
+            return outputs, _empty_backprop
+        else:
+            model.verify_inputs(inputs)
+            return model._outputs, model._backprop
     else:
         # This is pretty grim, but it's hard to do better :(.
         # It's hard to avoid relying on the doc.tensor attribute, because the
@@ -306,7 +314,7 @@ def forward(model: Tok2VecListener, inputs, is_train: bool):
                 outputs.append(model.ops.alloc2f(len(doc), width))
             else:
                 outputs.append(doc.tensor)
-        return outputs, lambda dX: []
+        return outputs, _empty_backprop
 
 
 def _empty_backprop(dX):  # for pickling

spacy/pipeline/trainable_pipe.pyx

@@ -1,4 +1,4 @@
-# cython: infer_types=True, profile=True
+# cython: infer_types=True, profile=True, binding=True
 from typing import Iterable, Iterator, Optional, Dict, Tuple, Callable
 import srsly
 from thinc.api import set_dropout_rate, Model, Optimizer

spacy/pipeline/transition_parser.pyx

@@ -13,7 +13,6 @@ import contextlib
 import srsly
 from thinc.api import get_ops, set_dropout_rate, CupyOps, NumpyOps
 from thinc.api import get_array_module
-from thinc.extra.search cimport Beam
 from thinc.types import Ints1d
 import numpy.random
 import numpy

spacy/schemas.py

@@ -181,12 +181,12 @@ class TokenPatternNumber(BaseModel):
     IS_SUBSET: Optional[List[StrictInt]] = Field(None, alias="is_subset")
     IS_SUPERSET: Optional[List[StrictInt]] = Field(None, alias="is_superset")
     INTERSECTS: Optional[List[StrictInt]] = Field(None, alias="intersects")
-    EQ: Union[StrictInt, StrictFloat] = Field(None, alias="==")
+    EQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="==")
-    NEQ: Union[StrictInt, StrictFloat] = Field(None, alias="!=")
+    NEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="!=")
-    GEQ: Union[StrictInt, StrictFloat] = Field(None, alias=">=")
+    GEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias=">=")
-    LEQ: Union[StrictInt, StrictFloat] = Field(None, alias="<=")
+    LEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="<=")
-    GT: Union[StrictInt, StrictFloat] = Field(None, alias=">")
+    GT: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias=">")
-    LT: Union[StrictInt, StrictFloat] = Field(None, alias="<")
+    LT: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="<")
 
     class Config:
         extra = "forbid"
@@ -329,6 +329,7 @@ class ConfigSchemaTraining(BaseModel):
     frozen_components: List[str] = Field(..., title="Pipeline components that shouldn't be updated during training")
     annotating_components: List[str] = Field(..., title="Pipeline components that should set annotations during training")
     before_to_disk: Optional[Callable[["Language"], "Language"]] = Field(..., title="Optional callback to modify nlp object after training, before it's saved to disk")
+    before_update: Optional[Callable[["Language", Dict[str, Any]], None]] = Field(..., title="Optional callback that is invoked at the start of each training step")
     # fmt: on
 
     class Config:
@@ -430,7 +431,7 @@ class ProjectConfigAssetURL(BaseModel):
     # fmt: off
     dest: StrictStr = Field(..., title="Destination of downloaded asset")
     url: Optional[StrictStr] = Field(None, title="URL of asset")
-    checksum: str = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
+    checksum: Optional[str] = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
     description: StrictStr = Field("", title="Description of asset")
     # fmt: on
 
@@ -438,7 +439,7 @@ class ProjectConfigAssetURL(BaseModel):
 class ProjectConfigAssetGit(BaseModel):
     # fmt: off
     git: ProjectConfigAssetGitItem = Field(..., title="Git repo information")
-    checksum: str = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
+    checksum: Optional[str] = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
     description: Optional[StrictStr] = Field(None, title="Description of asset")
     # fmt: on
 
@@ -508,9 +509,9 @@ class DocJSONSchema(BaseModel):
         None, title="Indices of sentences' start and end indices"
     )
     text: StrictStr = Field(..., title="Document text")
-    spans: Dict[StrictStr, List[Dict[StrictStr, Union[StrictStr, StrictInt]]]] = Field(
+    spans: Optional[
-        None, title="Span information - end/start indices, label, KB ID"
+        Dict[StrictStr, List[Dict[StrictStr, Union[StrictStr, StrictInt]]]]
-    )
+    ] = Field(None, title="Span information - end/start indices, label, KB ID")
     tokens: List[Dict[StrictStr, Union[StrictStr, StrictInt]]] = Field(
         ..., title="Token information - ID, start, annotations"
     )
@@ -519,9 +520,9 @@ class DocJSONSchema(BaseModel):
         title="Any custom data stored in the document's _ attribute",
         alias="_",
     )
-    underscore_token: Optional[Dict[StrictStr, Dict[StrictStr, Any]]] = Field(
+    underscore_token: Optional[Dict[StrictStr, List[Dict[StrictStr, Any]]]] = Field(
         None, title="Any custom data stored in the token's _ attribute"
     )
-    underscore_span: Optional[Dict[StrictStr, Dict[StrictStr, Any]]] = Field(
+    underscore_span: Optional[Dict[StrictStr, List[Dict[StrictStr, Any]]]] = Field(
         None, title="Any custom data stored in the span's _ attribute"
     )

spacy/scorer.py

@@ -446,7 +446,7 @@ class Scorer:
         labels (Iterable[str]): The set of possible labels. Defaults to [].
         multi_label (bool): Whether the attribute allows multiple labels.
             Defaults to True. When set to False (exclusive labels), missing
-            gold labels are interpreted as 0.0.
+            gold labels are interpreted as 0.0 and the threshold is set to 0.0.
         positive_label (str): The positive label for a binary task with
             exclusive classes. Defaults to None.
         threshold (float): Cutoff to consider a prediction "positive". Defaults
@@ -471,6 +471,8 @@ class Scorer:
         """
         if threshold is None:
             threshold = 0.5 if multi_label else 0.0
+        if not multi_label:
+            threshold = 0.0
         f_per_type = {label: PRFScore() for label in labels}
         auc_per_type = {label: ROCAUCScore() for label in labels}
         labels = set(labels)
@@ -505,20 +507,18 @@ class Scorer:
                 # Get the highest-scoring for each.
                 pred_label, pred_score = max(pred_cats.items(), key=lambda it: it[1])
                 gold_label, gold_score = max(gold_cats.items(), key=lambda it: it[1])
-                if pred_label == gold_label and pred_score >= threshold:
+                if pred_label == gold_label:
                     f_per_type[pred_label].tp += 1
                 else:
                     f_per_type[gold_label].fn += 1
-                    if pred_score >= threshold:
+                    f_per_type[pred_label].fp += 1
-                        f_per_type[pred_label].fp += 1
             elif gold_cats:
                 gold_label, gold_score = max(gold_cats, key=lambda it: it[1])
                 if gold_score > 0:
                     f_per_type[gold_label].fn += 1
             elif pred_cats:
                 pred_label, pred_score = max(pred_cats.items(), key=lambda it: it[1])
-                if pred_score >= threshold:
+                f_per_type[pred_label].fp += 1
-                    f_per_type[pred_label].fp += 1
         micro_prf = PRFScore()
         for label_prf in f_per_type.values():
             micro_prf.tp += label_prf.tp

spacy/strings.pxd

@@ -1,4 +1,4 @@
-from libc.stdint cimport int64_t
+from libc.stdint cimport int64_t, uint32_t
 from libcpp.vector cimport vector
 from libcpp.set cimport set
 from cymem.cymem cimport Pool
@@ -7,13 +7,6 @@ from murmurhash.mrmr cimport hash64
 
 from .typedefs cimport attr_t, hash_t
 
-
-cpdef hash_t hash_string(str string) except 0
-cdef hash_t hash_utf8(char* utf8_string, int length) nogil
-
-cdef str decode_Utf8Str(const Utf8Str* string)
-
-
 ctypedef union Utf8Str:
     unsigned char[8] s
     unsigned char* p
@@ -21,9 +14,13 @@ ctypedef union Utf8Str:
 
 cdef class StringStore:
     cdef Pool mem
+    cdef vector[hash_t] _keys
+    cdef PreshMap _map
 
-    cdef vector[hash_t] keys
+    cdef hash_t _intern_str(self, str string)
-    cdef public PreshMap _map
+    cdef Utf8Str* _allocate_str_repr(self, const unsigned char* chars, uint32_t length) except *
+    cdef str _decode_str_repr(self, const Utf8Str* string)
 
-    cdef const Utf8Str* intern_unicode(self, str py_string)
+
-    cdef const Utf8Str* _intern_utf8(self, char* utf8_string, int length, hash_t* precalculated_hash)
+cpdef hash_t hash_string(object string) except -1
+cpdef hash_t get_string_id(object string_or_hash) except -1

spacy/strings.pyi

@@ -1,21 +1,20 @@
-from typing import Optional, Iterable, Iterator, Union, Any, overload
+from typing import List, Optional, Iterable, Iterator, Union, Any, Tuple, overload
 from pathlib import Path
 
-def get_string_id(key: Union[str, int]) -> int: ...
-
 class StringStore:
-    def __init__(
+    def __init__(self, strings: Optional[Iterable[str]]) -> None: ...
-        self, strings: Optional[Iterable[str]] = ..., freeze: bool = ...
-    ) -> None: ...
     @overload
-    def __getitem__(self, string_or_id: Union[bytes, str]) -> int: ...
+    def __getitem__(self, string_or_hash: str) -> int: ...
     @overload
-    def __getitem__(self, string_or_id: int) -> str: ...
+    def __getitem__(self, string_or_hash: int) -> str: ...
-    def as_int(self, key: Union[bytes, str, int]) -> int: ...
+    def as_int(self, string_or_hash: Union[str, int]) -> int: ...
-    def as_string(self, key: Union[bytes, str, int]) -> str: ...
+    def as_string(self, string_or_hash: Union[str, int]) -> str: ...
     def add(self, string: str) -> int: ...
+    def items(self) -> List[Tuple[str, int]]: ...
+    def keys(self) -> List[str]: ...
+    def values(self) -> List[int]: ...
     def __len__(self) -> int: ...
-    def __contains__(self, string: str) -> bool: ...
+    def __contains__(self, string_or_hash: Union[str, int]) -> bool: ...
     def __iter__(self) -> Iterator[str]: ...
     def __reduce__(self) -> Any: ...
     def to_disk(self, path: Union[str, Path]) -> None: ...
@@ -23,3 +22,5 @@ class StringStore:
     def to_bytes(self, **kwargs: Any) -> bytes: ...
     def from_bytes(self, bytes_data: bytes, **kwargs: Any) -> StringStore: ...
     def _reset_and_load(self, strings: Iterable[str]) -> None: ...
+
+def get_string_id(string_or_hash: Union[str, int]) -> int: ...

spacy/strings.pyx

@@ -1,9 +1,10 @@
 # cython: infer_types=True
+from typing import Optional, Union, Iterable, Tuple, Callable, Any, List, Iterator
 cimport cython
 from libc.string cimport memcpy
 from libcpp.set cimport set
 from libc.stdint cimport uint32_t
-from murmurhash.mrmr cimport hash64, hash32
+from murmurhash.mrmr cimport hash64
 
 import srsly
 
@@ -14,105 +15,13 @@ from .symbols import NAMES as SYMBOLS_BY_INT
 from .errors import Errors
 from . import util
 
-# Not particularly elegant, but this is faster than `isinstance(key, numbers.Integral)`
-cdef inline bint _try_coerce_to_hash(object key, hash_t* out_hash):
-    try:
-        out_hash[0] = key
-        return True
-    except:
-        return False
-
-def get_string_id(key):
-    """Get a string ID, handling the reserved symbols correctly. If the key is
-    already an ID, return it.
-
-    This function optimises for convenience over performance, so shouldn't be
-    used in tight loops.
-    """
-    cdef hash_t str_hash    
-    if isinstance(key, str):
-        if len(key) == 0:
-            return 0
-
-        symbol = SYMBOLS_BY_STR.get(key, None)
-        if symbol is not None:
-            return symbol
-        else:
-            chars = key.encode("utf8")
-            return hash_utf8(chars, len(chars))
-    elif _try_coerce_to_hash(key, &str_hash):
-        # Coerce the integral key to the expected primitive hash type.
-        # This ensures that custom/overloaded "primitive" data types
-        # such as those implemented by numpy are not inadvertently used 
-        # downsteam (as these are internally implemented as custom PyObjects 
-        # whose comparison operators can incur a significant overhead).
-        return str_hash
-    else:
-        # TODO: Raise an error instead
-        return key
-
-
-cpdef hash_t hash_string(str string) except 0:
-    chars = string.encode("utf8")
-    return hash_utf8(chars, len(chars))
-
-
-cdef hash_t hash_utf8(char* utf8_string, int length) nogil:
-    return hash64(utf8_string, length, 1)
-
-
-cdef uint32_t hash32_utf8(char* utf8_string, int length) nogil:
-    return hash32(utf8_string, length, 1)
-
-
-cdef str decode_Utf8Str(const Utf8Str* string):
-    cdef int i, length
-    if string.s[0] < sizeof(string.s) and string.s[0] != 0:
-        return string.s[1:string.s[0]+1].decode("utf8")
-    elif string.p[0] < 255:
-        return string.p[1:string.p[0]+1].decode("utf8")
-    else:
-        i = 0
-        length = 0
-        while string.p[i] == 255:
-            i += 1
-            length += 255
-        length += string.p[i]
-        i += 1
-        return string.p[i:length + i].decode("utf8")
-
-
-cdef Utf8Str* _allocate(Pool mem, const unsigned char* chars, uint32_t length) except *:
-    cdef int n_length_bytes
-    cdef int i
-    cdef Utf8Str* string = <Utf8Str*>mem.alloc(1, sizeof(Utf8Str))
-    cdef uint32_t ulength = length
-    if length < sizeof(string.s):
-        string.s[0] = <unsigned char>length
-        memcpy(&string.s[1], chars, length)
-        return string
-    elif length < 255:
-        string.p = <unsigned char*>mem.alloc(length + 1, sizeof(unsigned char))
-        string.p[0] = length
-        memcpy(&string.p[1], chars, length)
-        return string
-    else:
-        i = 0
-        n_length_bytes = (length // 255) + 1
-        string.p = <unsigned char*>mem.alloc(length + n_length_bytes, sizeof(unsigned char))
-        for i in range(n_length_bytes-1):
-            string.p[i] = 255
-        string.p[n_length_bytes-1] = length % 255
-        memcpy(&string.p[n_length_bytes], chars, length)
-        return string
-
 
 cdef class StringStore:
-    """Look up strings by 64-bit hashes.
+    """Look up strings by 64-bit hashes. Implicitly handles reserved symbols.
 
     DOCS: https://spacy.io/api/stringstore
     """
-    def __init__(self, strings=None, freeze=False):
+    def __init__(self, strings: Optional[Iterable[str]] = None):
         """Create the StringStore.
 
         strings (iterable): A sequence of unicode strings to add to the store.
@@ -123,128 +32,127 @@ cdef class StringStore:
             for string in strings:
                 self.add(string)
 
-    def __getitem__(self, object string_or_id):
+    def __getitem__(self, string_or_hash: Union[str, int]) -> Union[str, int]:
-        """Retrieve a string from a given hash, or vice versa.
+        """Retrieve a string from a given hash. If a string
+        is passed as the input, add it to the store and return
+        its hash.
 
-        string_or_id (bytes, str or uint64): The value to encode.
+        string_or_hash (int / str): The hash value to lookup or the string to store.
-        Returns (str / uint64): The value to be retrieved.
+        RETURNS (str / int): The stored string or the hash of the newly added string.
         """
-        cdef hash_t str_hash
+        if isinstance(string_or_hash, str):
-        cdef Utf8Str* utf8str = NULL
+            return self.add(string_or_hash)
-
-        if isinstance(string_or_id, str):
-            if len(string_or_id) == 0:
-                return 0
-
-            # Return early if the string is found in the symbols LUT.
-            symbol = SYMBOLS_BY_STR.get(string_or_id, None)
-            if symbol is not None:
-                return symbol
-            else:
-                return hash_string(string_or_id)
-        elif isinstance(string_or_id, bytes):
-            return hash_utf8(string_or_id, len(string_or_id))
-        elif _try_coerce_to_hash(string_or_id, &str_hash):
-            if str_hash == 0:
-                return ""
-            elif str_hash in SYMBOLS_BY_INT:
-                return SYMBOLS_BY_INT[str_hash]
-            else:
-                utf8str = <Utf8Str*>self._map.get(str_hash)
         else:
-            # TODO: Raise an error instead
+            return self._get_interned_str(string_or_hash)
-            utf8str = <Utf8Str*>self._map.get(string_or_id)
 
-        if utf8str is NULL:
+    def __contains__(self, string_or_hash: Union[str, int]) -> bool:
-            raise KeyError(Errors.E018.format(hash_value=string_or_id))
+        """Check whether a string or a hash is in the store.
-        else:
-            return decode_Utf8Str(utf8str)
 
-    def as_int(self, key):
+        string (str / int): The string/hash to check.
-        """If key is an int, return it; otherwise, get the int value."""
-        if not isinstance(key, str):
-            return key
-        else:
-            return self[key]
-
-    def as_string(self, key):
-        """If key is a string, return it; otherwise, get the string value."""
-        if isinstance(key, str):
-            return key
-        else:
-            return self[key]
-
-    def add(self, string):
-        """Add a string to the StringStore.
-
-        string (str): The string to add.
-        RETURNS (uint64): The string's hash value.
-        """
-        cdef hash_t str_hash
-        if isinstance(string, str):
-            if string in SYMBOLS_BY_STR:
-                return SYMBOLS_BY_STR[string]
-
-            string = string.encode("utf8")
-            str_hash = hash_utf8(string, len(string))
-            self._intern_utf8(string, len(string), &str_hash)
-        elif isinstance(string, bytes):
-            if string in SYMBOLS_BY_STR:
-                return SYMBOLS_BY_STR[string]
-            str_hash = hash_utf8(string, len(string))
-            self._intern_utf8(string, len(string), &str_hash)
-        else:
-            raise TypeError(Errors.E017.format(value_type=type(string)))
-        return str_hash
-
-    def __len__(self):
-        """The number of strings in the store.
-
-        RETURNS (int): The number of strings in the store.
-        """
-        return self.keys.size()
-
-    def __contains__(self, string_or_id not None):
-        """Check whether a string or ID is in the store.
-
-        string_or_id (str or int): The string to check.
         RETURNS (bool): Whether the store contains the string.
         """
-        cdef hash_t str_hash
+        cdef hash_t str_hash = get_string_id(string_or_hash)
-        if isinstance(string_or_id, str):
-            if len(string_or_id) == 0:
-                return True
-            elif string_or_id in SYMBOLS_BY_STR:
-                return True
-            str_hash = hash_string(string_or_id)
-        elif _try_coerce_to_hash(string_or_id, &str_hash):
-            pass
-        else:
-            # TODO: Raise an error instead
-            return self._map.get(string_or_id) is not NULL
-
         if str_hash in SYMBOLS_BY_INT:
             return True
         else:
             return self._map.get(str_hash) is not NULL
 
-    def __iter__(self):
+    def __iter__(self) -> Iterator[str]:
-        """Iterate over the strings in the store, in order.
+        """Iterate over the strings in the store in insertion order.
 
-        YIELDS (str): A string in the store.
+        RETURNS: An iterable collection of strings.
         """
-        cdef int i
+        return iter(self.keys())
-        cdef hash_t key
-        for i in range(self.keys.size()):
-            key = self.keys[i]
-            utf8str = <Utf8Str*>self._map.get(key)
-            yield decode_Utf8Str(utf8str)
-        # TODO: Iterate OOV here?
 
     def __reduce__(self):
         strings = list(self)
         return (StringStore, (strings,), None, None, None)
 
+    def __len__(self) -> int:
+        """The number of strings in the store.
+
+        RETURNS (int): The number of strings in the store.
+        """
+        return self._keys.size()
+
+    def add(self, string: str) -> int:
+        """Add a string to the StringStore.
+
+        string (str): The string to add.
+        RETURNS (uint64): The string's hash value.
+        """
+        if not isinstance(string, str):
+            raise TypeError(Errors.E017.format(value_type=type(string)))
+
+        if string in SYMBOLS_BY_STR:
+            return SYMBOLS_BY_STR[string]
+        else:
+            return self._intern_str(string)
+
+    def as_int(self, string_or_hash: Union[str, int]) -> str:
+        """If a hash value is passed as the input, return it as-is. If the input
+        is a string, return its corresponding hash.
+
+        string_or_hash (str / int): The string to hash or a hash value.
+        RETURNS (int): The hash of the string or the input hash value.
+        """
+        if isinstance(string_or_hash, int):
+            return string_or_hash
+        else:
+            return get_string_id(string_or_hash)
+
+    def as_string(self, string_or_hash: Union[str, int]) -> str:
+        """If a string is passed as the input, return it as-is. If the input
+        is a hash value, return its corresponding string.
+
+        string_or_hash (str / int): The hash value to lookup or a string.
+        RETURNS (str): The stored string or the input string.
+        """
+        if isinstance(string_or_hash, str):
+            return string_or_hash
+        else:
+            return self._get_interned_str(string_or_hash)
+
+    def items(self) -> List[Tuple[str, int]]:
+        """Iterate over the stored strings and their hashes in insertion order.
+
+        RETURNS: A list of string-hash pairs.
+        """
+        # Even though we internally store the hashes as keys and the strings as
+        # values, we invert the order in the public API to keep it consistent with
+        # the implementation of the `__iter__` method (where we wish to iterate over
+        # the strings in the store).
+        cdef int i
+        pairs = [None] * self._keys.size()
+        for i in range(self._keys.size()):
+            str_hash = self._keys[i]
+            utf8str = <Utf8Str*>self._map.get(str_hash)
+            pairs[i] = (self._decode_str_repr(utf8str), str_hash)
+        return pairs
+
+    def keys(self) -> List[str]:
+        """Iterate over the stored strings in insertion order.
+
+        RETURNS: A list of strings.
+        """
+        cdef int i
+        strings = [None] * self._keys.size()
+        for i in range(self._keys.size()):
+            utf8str = <Utf8Str*>self._map.get(self._keys[i])
+            strings[i] = self._decode_str_repr(utf8str)
+        return strings
+
+    def values(self) -> List[int]:
+        """Iterate over the stored strings hashes in insertion order.
+
+        RETURNS: A list of string hashs.
+        """
+        cdef int i
+        hashes = [None] * self._keys.size()
+        for i in range(self._keys.size()):
+            hashes[i] = self._keys[i]
+        return hashes
+
     def to_disk(self, path):
         """Save the current state to a directory.
 
@@ -294,24 +202,122 @@ cdef class StringStore:
     def _reset_and_load(self, strings):
         self.mem = Pool()
         self._map = PreshMap()
-        self.keys.clear()
+        self._keys.clear()
         for string in strings:
             self.add(string)
 
-    cdef const Utf8Str* intern_unicode(self, str py_string):
+    def _get_interned_str(self, hash_value: int) -> str:
-        # 0 means missing, but we don't bother offsetting the index.
+        cdef hash_t str_hash
-        cdef bytes byte_string = py_string.encode("utf8")
+        if not _try_coerce_to_hash(hash_value, &str_hash):
-        return self._intern_utf8(byte_string, len(byte_string), NULL)
+            raise TypeError(Errors.E4001.format(expected_types="'int'", received_type=type(hash_value)))
 
-    @cython.final
+        # Handle reserved symbols and empty strings correctly.
-    cdef const Utf8Str* _intern_utf8(self, char* utf8_string, int length, hash_t* precalculated_hash):
+        if str_hash == 0:
+            return ""
+
+        symbol = SYMBOLS_BY_INT.get(str_hash)
+        if symbol is not None:
+            return symbol
+
+        utf8str = <Utf8Str*>self._map.get(str_hash)
+        if utf8str is NULL:
+            raise KeyError(Errors.E018.format(hash_value=str_hash))
+        else:
+            return self._decode_str_repr(utf8str)
+
+    cdef hash_t _intern_str(self, str string):
         # TODO: This function's API/behaviour is an unholy mess...
         # 0 means missing, but we don't bother offsetting the index.
-        cdef hash_t key = precalculated_hash[0] if precalculated_hash is not NULL else hash_utf8(utf8_string, length)
+        chars = string.encode('utf-8')
+        cdef hash_t key = hash64(<unsigned char*>chars, len(chars), 1)
         cdef Utf8Str* value = <Utf8Str*>self._map.get(key)
         if value is not NULL:
-            return value
+            return key
-        value = _allocate(self.mem, <unsigned char*>utf8_string, length)
+
+        value = self._allocate_str_repr(<unsigned char*>chars, len(chars))
         self._map.set(key, value)
-        self.keys.push_back(key)
+        self._keys.push_back(key)
-        return value
+        return key
+
+    cdef Utf8Str* _allocate_str_repr(self, const unsigned char* chars, uint32_t length) except *:
+        cdef int n_length_bytes
+        cdef int i
+        cdef Utf8Str* string = <Utf8Str*>self.mem.alloc(1, sizeof(Utf8Str))
+        cdef uint32_t ulength = length
+        if length < sizeof(string.s):
+            string.s[0] = <unsigned char>length
+            memcpy(&string.s[1], chars, length)
+            return string
+        elif length < 255:
+            string.p = <unsigned char*>self.mem.alloc(length + 1, sizeof(unsigned char))
+            string.p[0] = length
+            memcpy(&string.p[1], chars, length)
+            return string
+        else:
+            i = 0
+            n_length_bytes = (length // 255) + 1
+            string.p = <unsigned char*>self.mem.alloc(length + n_length_bytes, sizeof(unsigned char))
+            for i in range(n_length_bytes-1):
+                string.p[i] = 255
+            string.p[n_length_bytes-1] = length % 255
+            memcpy(&string.p[n_length_bytes], chars, length)
+            return string
+
+    cdef str _decode_str_repr(self, const Utf8Str* string):
+        cdef int i, length
+        if string.s[0] < sizeof(string.s) and string.s[0] != 0:
+            return string.s[1:string.s[0]+1].decode('utf-8')
+        elif string.p[0] < 255:
+            return string.p[1:string.p[0]+1].decode('utf-8')
+        else:
+            i = 0
+            length = 0
+            while string.p[i] == 255:
+                i += 1
+                length += 255
+            length += string.p[i]
+            i += 1
+            return string.p[i:length + i].decode('utf-8')
+
+
+cpdef hash_t hash_string(object string) except -1:
+    if not isinstance(string, str):
+        raise TypeError(Errors.E4001.format(expected_types="'str'", received_type=type(string)))
+
+    # Handle reserved symbols and empty strings correctly.
+    if len(string) == 0:
+        return 0
+
+    symbol = SYMBOLS_BY_STR.get(string)
+    if symbol is not None:
+        return symbol
+
+    chars = string.encode('utf-8')
+    return hash64(<unsigned char*>chars, len(chars), 1)
+
+
+cpdef hash_t get_string_id(object string_or_hash) except -1:
+    cdef hash_t str_hash
+
+    try:
+        return hash_string(string_or_hash)
+    except:
+        if _try_coerce_to_hash(string_or_hash, &str_hash):
+            # Coerce the integral key to the expected primitive hash type.
+            # This ensures that custom/overloaded "primitive" data types
+            # such as those implemented by numpy are not inadvertently used
+            # downsteam (as these are internally implemented as custom PyObjects
+            # whose comparison operators can incur a significant overhead).
+            return str_hash
+        else:
+            raise TypeError(Errors.E4001.format(expected_types="'str','int'", received_type=type(string_or_hash)))
+
+
+# Not particularly elegant, but this is faster than `isinstance(key, numbers.Integral)`
+cdef inline bint _try_coerce_to_hash(object key, hash_t* out_hash):
+    try:
+        out_hash[0] = key
+        return True
+    except:
+        return False
+

spacy/tests/README.md

@@ -40,7 +40,7 @@ py.test spacy/tests/tokenizer/test_exceptions.py::test_tokenizer_handles_emoji #
 
 To keep the behavior of the tests consistent and predictable, we try to follow a few basic conventions:
 
-- **Test names** should follow a pattern of `test_[module]_[tested behaviour]`. For example: `test_tokenizer_keeps_email` or `test_spans_override_sentiment`.
+- **Test names** should follow a pattern of `test_[module]_[tested behaviour]`. For example: `test_tokenizer_keeps_email`.
 - If you're testing for a bug reported in a specific issue, always create a **regression test**. Regression tests should be named `test_issue[ISSUE NUMBER]` and live in the [`regression`](regression) directory.
 - Only use `@pytest.mark.xfail` for tests that **should pass, but currently fail**. To test for desired negative behavior, use `assert not` in your test.
 - Very **extensive tests** that take a long time to run should be marked with `@pytest.mark.slow`. If your slow test is testing important behavior, consider adding an additional simpler version.

spacy/tests/conftest.py

@@ -1,10 +1,10 @@
 import pytest
 from spacy.util import get_lang_class
 import functools
+from hypothesis import settings
 import inspect
 import importlib
 import sys
-from hypothesis import settings
 
 # Functionally disable deadline settings for tests
 # to prevent spurious test failures in CI builds.
@@ -382,12 +382,20 @@ def ru_tokenizer():
     return get_lang_class("ru")().tokenizer
 
 
-@pytest.fixture
+@pytest.fixture(scope="session")
 def ru_lemmatizer():
     pytest.importorskip("pymorphy3")
     return get_lang_class("ru")().add_pipe("lemmatizer")
 
 
+@pytest.fixture(scope="session")
+def ru_lookup_lemmatizer():
+    pytest.importorskip("pymorphy3")
+    return get_lang_class("ru")().add_pipe(
+        "lemmatizer", config={"mode": "pymorphy3_lookup"}
+    )
+
+
 @pytest.fixture(scope="session")
 def sa_tokenizer():
     return get_lang_class("sa")().tokenizer
@@ -460,13 +468,22 @@ def uk_tokenizer():
     return get_lang_class("uk")().tokenizer
 
 
-@pytest.fixture
+@pytest.fixture(scope="session")
 def uk_lemmatizer():
     pytest.importorskip("pymorphy3")
     pytest.importorskip("pymorphy3_dicts_uk")
     return get_lang_class("uk")().add_pipe("lemmatizer")
 
 
+@pytest.fixture(scope="session")
+def uk_lookup_lemmatizer():
+    pytest.importorskip("pymorphy3")
+    pytest.importorskip("pymorphy3_dicts_uk")
+    return get_lang_class("uk")().add_pipe(
+        "lemmatizer", config={"mode": "pymorphy3_lookup"}
+    )
+
+
 @pytest.fixture(scope="session")
 def ur_tokenizer():
     return get_lang_class("ur")().tokenizer

spacy/tests/doc/test_array.py

@@ -123,14 +123,14 @@ def test_doc_from_array_heads_in_bounds(en_vocab):
 
     # head before start
     arr = doc.to_array(["HEAD"])
-    arr[0] = -1
+    arr[0] = numpy.int32(-1).astype(numpy.uint64)
     doc_from_array = Doc(en_vocab, words=words)
     with pytest.raises(ValueError):
         doc_from_array.from_array(["HEAD"], arr)
 
     # head after end
     arr = doc.to_array(["HEAD"])
-    arr[0] = 5
+    arr[0] = numpy.int32(5).astype(numpy.uint64)
     doc_from_array = Doc(en_vocab, words=words)
     with pytest.raises(ValueError):
         doc_from_array.from_array(["HEAD"], arr)

spacy/tests/doc/test_doc_api.py

@@ -82,6 +82,21 @@ def test_issue2396(en_vocab):
     assert (span.get_lca_matrix() == matrix).all()
 
 
+@pytest.mark.issue(11499)
+def test_init_args_unmodified(en_vocab):
+    words = ["A", "sentence"]
+    ents = ["B-TYPE1", ""]
+    sent_starts = [True, False]
+    Doc(
+        vocab=en_vocab,
+        words=words,
+        ents=ents,
+        sent_starts=sent_starts,
+    )
+    assert ents == ["B-TYPE1", ""]
+    assert sent_starts == [True, False]
+
+
 @pytest.mark.parametrize("text", ["-0.23", "+123,456", "±1"])
 @pytest.mark.parametrize("lang_cls", [English, MultiLanguage])
 @pytest.mark.issue(2782)
@@ -365,9 +380,7 @@ def test_doc_api_serialize(en_tokenizer, text):
     assert [t.text for t in tokens] == [t.text for t in new_tokens]
     assert [t.orth for t in tokens] == [t.orth for t in new_tokens]
 
-    new_tokens = Doc(tokens.vocab).from_bytes(
+    new_tokens = Doc(tokens.vocab).from_bytes(tokens.to_bytes())
-        tokens.to_bytes(exclude=["sentiment"]), exclude=["sentiment"]
-    )
     assert tokens.text == new_tokens.text
     assert [t.text for t in tokens] == [t.text for t in new_tokens]
     assert [t.orth for t in tokens] == [t.orth for t in new_tokens]
@@ -975,3 +988,12 @@ def test_doc_spans_setdefault(en_tokenizer):
     assert len(doc.spans["key2"]) == 1
     doc.spans.setdefault("key3", default=SpanGroup(doc, spans=[doc[0:1], doc[1:2]]))
     assert len(doc.spans["key3"]) == 2
+
+
+def test_doc_sentiment_from_bytes_v3_to_v4():
+    """Test if a doc with sentiment attribute created in v3.x works with '.from_bytes' in v4.x without throwing errors. The sentiment attribute was removed in v4"""
+    doc_bytes = b"\x89\xa4text\xa5happy\xaaarray_head\x9fGQACKOLMN\xcd\x01\xc4\xcd\x01\xc6I\xcd\x01\xc5JP\xaaarray_body\x85\xc4\x02nd\xc3\xc4\x04type\xa3<u8\xc4\x04kind\xc4\x00\xc4\x05shape\x92\x01\x0f\xc4\x04data\xc4x\x05\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\xa4\x9a\xd3\x17\xca\xf0b\x03\xa4\x9a\xd3\x17\xca\xf0b\x03\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\xa9sentiment\xcb?\xf0\x00\x00\x00\x00\x00\x00\xa6tensor\x85\xc4\x02nd\xc3\xc4\x04type\xa3<f4\xc4\x04kind\xc4\x00\xc4\x05shape\x91\x00\xc4\x04data\xc4\x00\xa4cats\x80\xa5spans\xc4\x01\x90\xa7strings\x92\xa0\xa5happy\xb2has_unknown_spaces\xc2"
+    doc = Doc(Vocab()).from_bytes(doc_bytes)
+    assert doc.text == "happy"
+    with pytest.raises(AttributeError):
+        doc.sentiment == 1.0

spacy/tests/doc/test_json_doc_conversion.py

@@ -128,7 +128,9 @@ def test_doc_to_json_with_token_span_attributes(doc):
     doc._.json_test1 = "hello world"
     doc._.json_test2 = [1, 2, 3]
     doc[0:1]._.span_test = "span_attribute"
+    doc[0:2]._.span_test = "span_attribute_2"
     doc[0]._.token_test = 117
+    doc[1]._.token_test = 118
     doc.spans["span_group"] = [doc[0:1]]
     json_doc = doc.to_json(
         underscore=["json_test1", "json_test2", "token_test", "span_test"]
@@ -139,8 +141,10 @@ def test_doc_to_json_with_token_span_attributes(doc):
     assert json_doc["_"]["json_test2"] == [1, 2, 3]
     assert "underscore_token" in json_doc
     assert "underscore_span" in json_doc
-    assert json_doc["underscore_token"]["token_test"]["value"] == 117
+    assert json_doc["underscore_token"]["token_test"][0]["value"] == 117
-    assert json_doc["underscore_span"]["span_test"]["value"] == "span_attribute"
+    assert json_doc["underscore_token"]["token_test"][1]["value"] == 118
+    assert json_doc["underscore_span"]["span_test"][0]["value"] == "span_attribute"
+    assert json_doc["underscore_span"]["span_test"][1]["value"] == "span_attribute_2"
     assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
     assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc
 
@@ -161,8 +165,8 @@ def test_doc_to_json_with_custom_user_data(doc):
     assert json_doc["_"]["json_test"] == "hello world"
     assert "underscore_token" in json_doc
     assert "underscore_span" in json_doc
-    assert json_doc["underscore_token"]["token_test"]["value"] == 117
+    assert json_doc["underscore_token"]["token_test"][0]["value"] == 117
-    assert json_doc["underscore_span"]["span_test"]["value"] == "span_attribute"
+    assert json_doc["underscore_span"]["span_test"][0]["value"] == "span_attribute"
     assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
     assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc
 
@@ -181,8 +185,8 @@ def test_doc_to_json_with_token_span_same_identifier(doc):
     assert json_doc["_"]["my_ext"] == "hello world"
     assert "underscore_token" in json_doc
     assert "underscore_span" in json_doc
-    assert json_doc["underscore_token"]["my_ext"]["value"] == 117
+    assert json_doc["underscore_token"]["my_ext"][0]["value"] == 117
-    assert json_doc["underscore_span"]["my_ext"]["value"] == "span_attribute"
+    assert json_doc["underscore_span"]["my_ext"][0]["value"] == "span_attribute"
     assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
     assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc
 
@@ -195,10 +199,9 @@ def test_doc_to_json_with_token_attributes_missing(doc):
     doc[0]._.token_test = 117
     json_doc = doc.to_json(underscore=["span_test"])
 
-    assert "underscore_token" in json_doc
     assert "underscore_span" in json_doc
-    assert json_doc["underscore_span"]["span_test"]["value"] == "span_attribute"
+    assert json_doc["underscore_span"]["span_test"][0]["value"] == "span_attribute"
-    assert "token_test" not in json_doc["underscore_token"]
+    assert "underscore_token" not in json_doc
     assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
 
 
@@ -283,7 +286,9 @@ def test_json_to_doc_with_token_span_attributes(doc):
     doc._.json_test1 = "hello world"
     doc._.json_test2 = [1, 2, 3]
     doc[0:1]._.span_test = "span_attribute"
+    doc[0:2]._.span_test = "span_attribute_2"
     doc[0]._.token_test = 117
+    doc[1]._.token_test = 118
 
     json_doc = doc.to_json(
         underscore=["json_test1", "json_test2", "token_test", "span_test"]
@@ -295,7 +300,9 @@ def test_json_to_doc_with_token_span_attributes(doc):
     assert new_doc._.json_test1 == "hello world"
     assert new_doc._.json_test2 == [1, 2, 3]
     assert new_doc[0]._.token_test == 117
+    assert new_doc[1]._.token_test == 118
     assert new_doc[0:1]._.span_test == "span_attribute"
+    assert new_doc[0:2]._.span_test == "span_attribute_2"
     assert new_doc.user_data == doc.user_data
     assert new_doc.to_bytes(exclude=["user_data"]) == doc.to_bytes(
         exclude=["user_data"]
@@ -363,3 +370,12 @@ def test_json_to_doc_validation_error(doc):
     doc_json.pop("tokens")
     with pytest.raises(ValueError):
         Doc(doc.vocab).from_json(doc_json, validate=True)
+
+
+def test_to_json_underscore_doc_getters(doc):
+    def get_text_length(doc):
+        return len(doc.text)
+
+    Doc.set_extension("text_length", getter=get_text_length)
+    doc_json = doc.to_json(underscore=["text_length"])
+    assert doc_json["_"]["text_length"] == get_text_length(doc)

spacy/tests/doc/test_span.py

@@ -305,31 +305,6 @@ def test_span_similarity_match():
         assert span1[:1].similarity(doc.vocab["a"]) == 1.0
 
 
-def test_spans_default_sentiment(en_tokenizer):
-    """Test span.sentiment property's default averaging behaviour"""
-    text = "good stuff bad stuff"
-    tokens = en_tokenizer(text)
-    tokens.vocab[tokens[0].text].sentiment = 3.0
-    tokens.vocab[tokens[2].text].sentiment = -2.0
-    doc = Doc(tokens.vocab, words=[t.text for t in tokens])
-    assert doc[:2].sentiment == 3.0 / 2
-    assert doc[-2:].sentiment == -2.0 / 2
-    assert doc[:-1].sentiment == (3.0 + -2) / 3.0
-
-
-def test_spans_override_sentiment(en_tokenizer):
-    """Test span.sentiment property's default averaging behaviour"""
-    text = "good stuff bad stuff"
-    tokens = en_tokenizer(text)
-    tokens.vocab[tokens[0].text].sentiment = 3.0
-    tokens.vocab[tokens[2].text].sentiment = -2.0
-    doc = Doc(tokens.vocab, words=[t.text for t in tokens])
-    doc.user_span_hooks["sentiment"] = lambda span: 10.0
-    assert doc[:2].sentiment == 10.0
-    assert doc[-2:].sentiment == 10.0
-    assert doc[:-1].sentiment == 10.0
-
-
 def test_spans_are_hashable(en_tokenizer):
     """Test spans can be hashed."""
     text = "good stuff bad stuff"

spacy/tests/doc/test_span_group.py

@@ -1,7 +1,10 @@
+from typing import List
+
 import pytest
 from random import Random
 from spacy.matcher import Matcher
-from spacy.tokens import Span, SpanGroup
+from spacy.tokens import Span, SpanGroup, Doc
+from spacy.util import filter_spans
 
 
 @pytest.fixture
@@ -242,3 +245,13 @@ def test_span_group_extend(doc):
 def test_span_group_dealloc(span_group):
     with pytest.raises(AttributeError):
         print(span_group.doc)
+
+
+@pytest.mark.issue(11975)
+def test_span_group_typing(doc: Doc):
+    """Tests whether typing of `SpanGroup` as `Iterable[Span]`-like object is accepted by mypy."""
+    span_group: SpanGroup = doc.spans["SPANS"]
+    spans: List[Span] = list(span_group)
+    for i, span in enumerate(span_group):
+        assert span == span_group[i] == spans[i]
+    filter_spans(span_group)

spacy/tests/doc/test_underscore.py

@@ -3,6 +3,10 @@ from mock import Mock
 from spacy.tokens import Doc, Span, Token
 from spacy.tokens.underscore import Underscore
 
+# Helper functions
+def _get_tuple(s: Span):
+    return "._.", "span_extension", s.start_char, s.end_char, s.label, s.kb_id, s.id
+
 
 @pytest.fixture(scope="function", autouse=True)
 def clean_underscore():
@@ -171,3 +175,118 @@ def test_underscore_docstring(en_vocab):
     doc = Doc(en_vocab, words=["hello", "world"])
     assert test_method.__doc__ == "I am a docstring"
     assert doc._.test_docstrings.__doc__.rsplit(". ")[-1] == "I am a docstring"
+
+
+def test_underscore_for_unique_span(en_tokenizer):
+    """Test that spans with the same boundaries but with different labels are uniquely identified (see #9706)."""
+    Doc.set_extension(name="doc_extension", default=None)
+    Span.set_extension(name="span_extension", default=None)
+    Token.set_extension(name="token_extension", default=None)
+
+    # Initialize doc
+    text = "Hello, world!"
+    doc = en_tokenizer(text)
+    span_1 = Span(doc, 0, 2, "SPAN_1")
+    span_2 = Span(doc, 0, 2, "SPAN_2")
+
+    # Set custom extensions
+    doc._.doc_extension = "doc extension"
+    doc[0]._.token_extension = "token extension"
+    span_1._.span_extension = "span_1 extension"
+    span_2._.span_extension = "span_2 extension"
+
+    # Assert extensions
+    assert doc.user_data[_get_tuple(span_1)] == "span_1 extension"
+    assert doc.user_data[_get_tuple(span_2)] == "span_2 extension"
+
+    # Change label of span and assert extensions
+    span_1.label_ = "NEW_LABEL"
+    assert doc.user_data[_get_tuple(span_1)] == "span_1 extension"
+    assert doc.user_data[_get_tuple(span_2)] == "span_2 extension"
+
+    # Change KB_ID and assert extensions
+    span_1.kb_id_ = "KB_ID"
+    assert doc.user_data[_get_tuple(span_1)] == "span_1 extension"
+    assert doc.user_data[_get_tuple(span_2)] == "span_2 extension"
+
+    # Change extensions and assert
+    span_2._.span_extension = "updated span_2 extension"
+    assert doc.user_data[_get_tuple(span_1)] == "span_1 extension"
+    assert doc.user_data[_get_tuple(span_2)] == "updated span_2 extension"
+
+    # Change span ID and assert extensions
+    span_2.id = 2
+    assert doc.user_data[_get_tuple(span_1)] == "span_1 extension"
+    assert doc.user_data[_get_tuple(span_2)] == "updated span_2 extension"
+
+    # Assert extensions with original key
+    assert doc.user_data[("._.", "doc_extension", None, None)] == "doc extension"
+    assert doc.user_data[("._.", "token_extension", 0, None)] == "token extension"
+
+
+def test_underscore_for_unique_span_from_docs(en_tokenizer):
+    """Test that spans in the user_data keep the same data structure when using Doc.from_docs"""
+    Span.set_extension(name="span_extension", default=None)
+    Token.set_extension(name="token_extension", default=None)
+
+    # Initialize doc
+    text_1 = "Hello, world!"
+    doc_1 = en_tokenizer(text_1)
+    span_1a = Span(doc_1, 0, 2, "SPAN_1a")
+    span_1b = Span(doc_1, 0, 2, "SPAN_1b")
+
+    text_2 = "This is a test."
+    doc_2 = en_tokenizer(text_2)
+    span_2a = Span(doc_2, 0, 3, "SPAN_2a")
+
+    # Set custom extensions
+    doc_1[0]._.token_extension = "token_1"
+    doc_2[1]._.token_extension = "token_2"
+    span_1a._.span_extension = "span_1a extension"
+    span_1b._.span_extension = "span_1b extension"
+    span_2a._.span_extension = "span_2a extension"
+
+    doc = Doc.from_docs([doc_1, doc_2])
+    # Assert extensions
+    assert doc_1.user_data[_get_tuple(span_1a)] == "span_1a extension"
+    assert doc_1.user_data[_get_tuple(span_1b)] == "span_1b extension"
+    assert doc_2.user_data[_get_tuple(span_2a)] == "span_2a extension"
+
+    # Check extensions on merged doc
+    assert doc.user_data[_get_tuple(span_1a)] == "span_1a extension"
+    assert doc.user_data[_get_tuple(span_1b)] == "span_1b extension"
+    assert (
+        doc.user_data[
+            (
+                "._.",
+                "span_extension",
+                span_2a.start_char + len(doc_1.text) + 1,
+                span_2a.end_char + len(doc_1.text) + 1,
+                span_2a.label,
+                span_2a.kb_id,
+                span_2a.id,
+            )
+        ]
+        == "span_2a extension"
+    )
+
+
+def test_underscore_for_unique_span_as_span(en_tokenizer):
+    """Test that spans in the user_data keep the same data structure when using Span.as_doc"""
+    Span.set_extension(name="span_extension", default=None)
+
+    # Initialize doc
+    text = "Hello, world!"
+    doc = en_tokenizer(text)
+    span_1 = Span(doc, 0, 2, "SPAN_1")
+    span_2 = Span(doc, 0, 2, "SPAN_2")
+
+    # Set custom extensions
+    span_1._.span_extension = "span_1 extension"
+    span_2._.span_extension = "span_2 extension"
+
+    span_doc = span_1.as_doc(copy_user_data=True)
+
+    # Assert extensions
+    assert span_doc.user_data[_get_tuple(span_1)] == "span_1 extension"
+    assert span_doc.user_data[_get_tuple(span_2)] == "span_2 extension"

spacy/tests/lang/grc/test_tokenizer.py

@@ -0,0 +1,18 @@
+import pytest
+
+
+# fmt: off
+GRC_TOKEN_EXCEPTION_TESTS = [
+    ("τὸ 〈τῆς〉 φιλοσοφίας ἔργον ἔνιοί φασιν ἀπὸ ⟦βαρβάρων⟧ ἄρξαι.", ["τὸ", "〈", "τῆς", "〉", "φιλοσοφίας", "ἔργον", "ἔνιοί", "φασιν", "ἀπὸ", "⟦", "βαρβάρων", "⟧", "ἄρξαι", "."]),
+    ("τὴν δὲ τῶν Αἰγυπτίων φιλοσοφίαν εἶναι τοιαύτην περί τε †θεῶν† καὶ ὑπὲρ δικαιοσύνης.", ["τὴν", "δὲ", "τῶν", "Αἰγυπτίων", "φιλοσοφίαν", "εἶναι", "τοιαύτην", "περί", "τε", "†", "θεῶν", "†", "καὶ", "ὑπὲρ", "δικαιοσύνης", "."]),
+    ("⸏πόσις δ' Ἐρεχθεύς ἐστί μοι σεσωσμένος⸏", ["⸏", "πόσις", "δ'", "Ἐρεχθεύς", "ἐστί", "μοι", "σεσωσμένος", "⸏"]),
+    ("⸏ὔπνον ἴδωμεν⸎", ["⸏", "ὔπνον", "ἴδωμεν", "⸎"]),
+]
+# fmt: on
+
+
+@pytest.mark.parametrize("text,expected_tokens", GRC_TOKEN_EXCEPTION_TESTS)
+def test_grc_tokenizer(grc_tokenizer, text, expected_tokens):
+    tokens = grc_tokenizer(text)
+    token_list = [token.text for token in tokens if not token.is_space]
+    assert expected_tokens == token_list

spacy/tests/lang/ru/test_lemmatizer.py

@@ -78,3 +78,32 @@ def test_ru_lemmatizer_punct(ru_lemmatizer):
     assert ru_lemmatizer.pymorphy2_lemmatize(doc[0]) == ['"']
     doc = Doc(ru_lemmatizer.vocab, words=["»"], pos=["PUNCT"])
     assert ru_lemmatizer.pymorphy2_lemmatize(doc[0]) == ['"']
+
+
+def test_ru_doc_lookup_lemmatization(ru_lookup_lemmatizer):
+    assert ru_lookup_lemmatizer.mode == "pymorphy3_lookup"
+    words = ["мама", "мыла", "раму"]
+    pos = ["NOUN", "VERB", "NOUN"]
+    morphs = [
+        "Animacy=Anim|Case=Nom|Gender=Fem|Number=Sing",
+        "Aspect=Imp|Gender=Fem|Mood=Ind|Number=Sing|Tense=Past|VerbForm=Fin|Voice=Act",
+        "Animacy=Anim|Case=Acc|Gender=Fem|Number=Sing",
+    ]
+    doc = Doc(ru_lookup_lemmatizer.vocab, words=words, pos=pos, morphs=morphs)
+    doc = ru_lookup_lemmatizer(doc)
+    lemmas = [token.lemma_ for token in doc]
+    assert lemmas == ["мама", "мыла", "раму"]
+
+
+@pytest.mark.parametrize(
+    "word,lemma",
+    (
+        ("бременем", "бремя"),
+        ("будешь", "быть"),
+        ("какая-то", "какой-то"),
+    ),
+)
+def test_ru_lookup_lemmatizer(ru_lookup_lemmatizer, word, lemma):
+    assert ru_lookup_lemmatizer.mode == "pymorphy3_lookup"
+    doc = Doc(ru_lookup_lemmatizer.vocab, words=[word])
+    assert ru_lookup_lemmatizer(doc)[0].lemma_ == lemma

spacy/tests/lang/uk/test_lemmatizer.py

@@ -8,4 +8,20 @@ pytestmark = pytest.mark.filterwarnings("ignore::DeprecationWarning")
 def test_uk_lemmatizer(uk_lemmatizer):
     """Check that the default uk lemmatizer runs."""
     doc = Doc(uk_lemmatizer.vocab, words=["a", "b", "c"])
+    assert uk_lemmatizer.mode == "pymorphy3"
     uk_lemmatizer(doc)
+    assert [token.lemma for token in doc]
+
+
+@pytest.mark.parametrize(
+    "word,lemma",
+    (
+        ("якийсь", "якийсь"),
+        ("розповідають", "розповідати"),
+        ("розповіси", "розповісти"),
+    ),
+)
+def test_uk_lookup_lemmatizer(uk_lookup_lemmatizer, word, lemma):
+    assert uk_lookup_lemmatizer.mode == "pymorphy3_lookup"
+    doc = Doc(uk_lookup_lemmatizer.vocab, words=[word])
+    assert uk_lookup_lemmatizer(doc)[0].lemma_ == lemma

spacy/tests/matcher/test_levenshtein.py

@@ -0,0 +1,44 @@
+import pytest
+from spacy.matcher import levenshtein
+
+
+# empty string plus 10 random ASCII, 10 random unicode, and 2 random long tests
+# from polyleven
+@pytest.mark.parametrize(
+    "dist,a,b",
+    [
+        (0, "", ""),
+        (4, "bbcb", "caba"),
+        (3, "abcb", "cacc"),
+        (3, "aa", "ccc"),
+        (1, "cca", "ccac"),
+        (1, "aba", "aa"),
+        (4, "bcbb", "abac"),
+        (3, "acbc", "bba"),
+        (3, "cbba", "a"),
+        (2, "bcc", "ba"),
+        (4, "aaa", "ccbb"),
+        (3, "うあい", "いいうい"),
+        (2, "あううい", "うあい"),
+        (3, "いういい", "うううあ"),
+        (2, "うい", "あいあ"),
+        (2, "いあい", "いう"),
+        (1, "いい", "あいい"),
+        (3, "あうあ", "いいああ"),
+        (4, "いあうう", "ううああ"),
+        (3, "いあいい", "ういああ"),
+        (3, "いいああ", "ううあう"),
+        (
+            166,
+            "TCTGGGCACGGATTCGTCAGATTCCATGTCCATATTTGAGGCTCTTGCAGGCAAAATTTGGGCATGTGAACTCCTTATAGTCCCCGTGC",
+            "ATATGGATTGGGGGCATTCAAAGATACGGTTTCCCTTTCTTCAGTTTCGCGCGGCGCACGTCCGGGTGCGAGCCAGTTCGTCTTACTCACATTGTCGACTTCACGAATCGCGCATGATGTGCTTAGCCTGTACTTACGAACGAACTTTCGGTCCAAATACATTCTATCAACACCGAGGTATCCGTGCCACACGCCGAAGCTCGACCGTGTTCGTTGAGAGGTGGAAATGGTAAAAGATGAACATAGTC",
+        ),
+        (
+            111,
+            "GGTTCGGCCGAATTCATAGAGCGTGGTAGTCGACGGTATCCCGCCTGGTAGGGGCCCCTTCTACCTAGCGGAAGTTTGTCAGTACTCTATAACACGAGGGCCTCTCACACCCTAGATCGTCCAGCCACTCGAAGATCGCAGCACCCTTACAGAAAGGCATTAATGTTTCTCCTAGCACTTGTGCAATGGTGAAGGAGTGATG",
+            "CGTAACACTTCGCGCTACTGGGCTGCAACGTCTTGGGCATACATGCAAGATTATCTAATGCAAGCTTGAGCCCCGCTTGCGGAATTTCCCTAATCGGGGTCCCTTCCTGTTACGATAAGGACGCGTGCACT",
+        ),
+    ],
+)
+def test_levenshtein(dist, a, b):
+    assert levenshtein(a, b) == dist

spacy/tests/matcher/test_matcher_api.py

@@ -50,8 +50,6 @@ def test_matcher_from_usage_docs(en_vocab):
 
     def label_sentiment(matcher, doc, i, matches):
         match_id, start, end = matches[i]
-        if doc.vocab.strings[match_id] == "HAPPY":
-            doc.sentiment += 0.1
         span = doc[start:end]
         with doc.retokenize() as retokenizer:
             retokenizer.merge(span)
@@ -61,7 +59,6 @@ def test_matcher_from_usage_docs(en_vocab):
     matcher = Matcher(en_vocab)
     matcher.add("HAPPY", pos_patterns, on_match=label_sentiment)
     matcher(doc)
-    assert doc.sentiment != 0
     assert doc[1].norm_ == "happy emoji"
 
 

spacy/tests/matcher/test_phrase_matcher.py

@@ -87,14 +87,15 @@ def test_issue4373():
 
 @pytest.mark.issue(4651)
 def test_issue4651_with_phrase_matcher_attr():
-    """Test that the EntityRuler PhraseMatcher is deserialized correctly using
+    """Test that the entity_ruler PhraseMatcher is deserialized correctly using
-    the method from_disk when the EntityRuler argument phrase_matcher_attr is
+    the method from_disk when the entity_ruler argument phrase_matcher_attr is
     specified.
     """
     text = "Spacy is a python library for nlp"
     nlp = English()
     patterns = [{"label": "PYTHON_LIB", "pattern": "spacy", "id": "spaCy"}]
-    ruler = nlp.add_pipe("entity_ruler", config={"phrase_matcher_attr": "LOWER"})
+    config = {"phrase_matcher_attr": "LOWER"}
+    ruler = nlp.add_pipe("entity_ruler", config=config)
     ruler.add_patterns(patterns)
     doc = nlp(text)
     res = [(ent.text, ent.label_, ent.ent_id_) for ent in doc.ents]
@@ -102,7 +103,7 @@ def test_issue4651_with_phrase_matcher_attr():
     with make_tempdir() as d:
         file_path = d / "entityruler"
         ruler.to_disk(file_path)
-        nlp_reloaded.add_pipe("entity_ruler").from_disk(file_path)
+        nlp_reloaded.add_pipe("entity_ruler", config=config).from_disk(file_path)
     doc_reloaded = nlp_reloaded(text)
     res_reloaded = [(ent.text, ent.label_, ent.ent_id_) for ent in doc_reloaded.ents]
     assert res == res_reloaded

spacy/tests/pipeline/test_edit_tree_lemmatizer.py

@@ -62,10 +62,45 @@ def test_initialize_from_labels():
     nlp2 = Language()
     lemmatizer2 = nlp2.add_pipe("trainable_lemmatizer")
     lemmatizer2.initialize(
-        get_examples=lambda: train_examples,
+        # We want to check that the strings in replacement nodes are
+        # added to the string store. Avoid that they get added through
+        # the examples.
+        get_examples=lambda: train_examples[:1],
         labels=lemmatizer.label_data,
     )
     assert lemmatizer2.tree2label == {1: 0, 3: 1, 4: 2, 6: 3}
+    assert lemmatizer2.label_data == {
+        "trees": [
+            {"orig": "S", "subst": "s"},
+            {
+                "prefix_len": 1,
+                "suffix_len": 0,
+                "prefix_tree": 0,
+                "suffix_tree": 4294967295,
+            },
+            {"orig": "s", "subst": ""},
+            {
+                "prefix_len": 0,
+                "suffix_len": 1,
+                "prefix_tree": 4294967295,
+                "suffix_tree": 2,
+            },
+            {
+                "prefix_len": 0,
+                "suffix_len": 0,
+                "prefix_tree": 4294967295,
+                "suffix_tree": 4294967295,
+            },
+            {"orig": "E", "subst": "e"},
+            {
+                "prefix_len": 1,
+                "suffix_len": 0,
+                "prefix_tree": 5,
+                "suffix_tree": 4294967295,
+            },
+        ],
+        "labels": (1, 3, 4, 6),
+    }
 
 
 def test_no_data():