explosion/spaCy
1
1
Fork 0
mirror of https://github.com/explosion/spaCy.git synced 2025-08-04 12:20:20 +03:00
Code Issues Packages Projects Releases Wiki Activity

Merge remote-tracking branch 'upstream/feature/refactor-parser' into feature/parser-refactor-cut-size

Browse Source
This commit is contained in:
Daniël de Kok 2023-01-11 08:20:13 +01:00
commit 74b9ddd03a
192 changed files with 6748 additions and 4059 deletions
Show Stats Download Patch File Download Diff File Expand all files Collapse all files

2
.github/ISSUE_TEMPLATE/01_bugs.md vendored
View File

@ -10,7 +10,7 @@ about: Use this template if you came across a bug or unexpected behaviour differ
<!-- Include a code example or the steps that led to the problem. Please try to be as specific as possible. -->
## Your Environment
<!-- Include details of your environment. If you're using spaCy 1.7+, you can also type `python -m spacy info --markdown` and copy-paste the result here.-->
<!-- Include details of your environment. You can also type `python -m spacy info --markdown` and copy-paste the result here.-->
* Operating System:
* Python Version Used:
* spaCy Version Used:

83
.github/azure-steps.yml vendored
View File

@ -1,75 +1,67 @@
parameters:
python_version: ''
architecture: ''
prefix: ''
gpu: false
num_build_jobs: 1
architecture: 'x64'
num_build_jobs: 2
steps:
- task: UsePythonVersion@0
inputs:
versionSpec: ${{ parameters.python_version }}
architecture: ${{ parameters.architecture }}
allowUnstable: true
- bash: |
echo "##vso[task.setvariable variable=python_version]${{ parameters.python_version }}"
displayName: 'Set variables'
- script: |
${{ parameters.prefix }} python -m pip install -U pip setuptools
${{ parameters.prefix }} python -m pip install -U -r requirements.txt
python -m pip install -U build pip setuptools
python -m pip install -U -r requirements.txt
displayName: "Install dependencies"
- script: |
${{ parameters.prefix }} python setup.py build_ext --inplace -j ${{ parameters.num_build_jobs }}
${{ parameters.prefix }} python setup.py sdist --formats=gztar
displayName: "Compile and build sdist"
python -m build --sdist
displayName: "Build sdist"
- script: python -m mypy spacy
- script: |
python -m mypy spacy
displayName: 'Run mypy'
condition: ne(variables['python_version'], '3.10')
condition: ne(variables['python_version'], '3.6')
- task: DeleteFiles@1
inputs:
contents: "spacy"
displayName: "Delete source directory"
- task: DeleteFiles@1
inputs:
contents: "*.egg-info"
displayName: "Delete egg-info directory"
- script: |
${{ parameters.prefix }} python -m pip freeze --exclude torch --exclude cupy-cuda110 > installed.txt
${{ parameters.prefix }} python -m pip uninstall -y -r installed.txt
python -m pip freeze > installed.txt
python -m pip uninstall -y -r installed.txt
displayName: "Uninstall all packages"
- bash: |
${{ parameters.prefix }} SDIST=$(python -c "import os;print(os.listdir('./dist')[-1])" 2>&1)
${{ parameters.prefix }} SPACY_NUM_BUILD_JOBS=2 python -m pip install dist/$SDIST
SDIST=$(python -c "import os;print(os.listdir('./dist')[-1])" 2>&1)
SPACY_NUM_BUILD_JOBS=${{ parameters.num_build_jobs }} python -m pip install dist/$SDIST
displayName: "Install from sdist"
- script: |
${{ parameters.prefix }} python -m pip install -U -r requirements.txt
displayName: "Install test requirements"
python -W error -c "import spacy"
displayName: "Test import"
- script: |
${{ parameters.prefix }} python -m pip install -U cupy-cuda110 -f https://github.com/cupy/cupy/releases/v9.0.0
${{ parameters.prefix }} python -m pip install "torch==1.7.1+cu110" -f https://download.pytorch.org/whl/torch_stable.html
displayName: "Install GPU requirements"
condition: eq(${{ parameters.gpu }}, true)
- script: |
${{ parameters.prefix }} python -m pytest --pyargs spacy -W error
displayName: "Run CPU tests"
condition: eq(${{ parameters.gpu }}, false)
- script: |
${{ parameters.prefix }} python -m pytest --pyargs spacy -W error -p spacy.tests.enable_gpu
displayName: "Run GPU tests"
condition: eq(${{ parameters.gpu }}, true)
# Re-enable when we have models trained for spacy.TransitionBasedParser.v3.
# - script: |
# python -m spacy download ca_core_news_sm
# python -m spacy download ca_core_news_md
# python -c "import spacy; nlp=spacy.load('ca_core_news_sm'); doc=nlp('test')"
# displayName: 'Test download CLI'
# condition: eq(variables['python_version'], '3.8')
#
# - script: |
# python -W error -c "import ca_core_news_sm; nlp = ca_core_news_sm.load(); doc=nlp('test')"
# displayName: 'Test no warnings on load (#11713)'
# condition: eq(variables['python_version'], '3.8')
- script: |
@ -94,27 +86,34 @@ steps:
displayName: 'Test train CLI'
condition: eq(variables['python_version'], '3.8')
# Re-enable when we have models trained for spacy.TransitionBasedParser.v3.
# - script: |
# python -c "import spacy; config = spacy.util.load_config('ner.cfg'); config['components']['ner'] = {'source': 'ca_core_news_sm'}; config.to_disk('ner_source_sm.cfg')"
# PYTHONWARNINGS="error,ignore::DeprecationWarning" python -m spacy assemble ner_source_sm.cfg output_dir
# displayName: 'Test assemble CLI'
# condition: eq(variables['python_version'], '3.8')
# Re-enable when we have models trained for spacy.TransitionBasedParser.v3.
#
# - script: |
# python -c "import spacy; config = spacy.util.load_config('ner.cfg'); config['components']['ner'] = {'source': 'ca_core_news_md'}; config.to_disk('ner_source_md.cfg')"
# python -m spacy assemble ner_source_md.cfg output_dir 2>&1 | grep -q W113
# displayName: 'Test assemble CLI vectors warning'
# condition: eq(variables['python_version'], '3.8')
- script: |
python -m pip install -U -r requirements.txt
displayName: "Install test requirements"
- script: |
python -m pytest --pyargs spacy -W error
displayName: "Run CPU tests"
- script: |
python -m pip install 'spacy[apple]'
python -m pytest --pyargs spacy
displayName: "Run CPU tests with thinc-apple-ops"
condition: and(startsWith(variables['imageName'], 'macos'), eq(variables['python.version'], '3.11'))
- script: |
python .github/validate_universe_json.py website/meta/universe.json
displayName: 'Test website/meta/universe.json'
condition: eq(variables['python_version'], '3.8')
- script: |
${{ parameters.prefix }} python -m pip install --pre thinc-apple-ops
${{ parameters.prefix }} python -m pytest --pyargs spacy
displayName: "Run CPU tests with thinc-apple-ops"
condition: and(startsWith(variables['imageName'], 'macos'), eq(variables['python.version'], '3.10'))

9
.github/workflows/autoblack.yml vendored
View File

@ -12,10 +12,10 @@ jobs:
if: github.repository_owner == 'explosion'
runs-on: ubuntu-latest
steps:
- uses: actions/checkout@v2
- uses: actions/checkout@v3
with:
ref: ${{ github.head_ref }}
- uses: actions/setup-python@v2
- uses: actions/setup-python@v4
- run: pip install black
- name: Auto-format code if needed
run: black spacy
@ -23,10 +23,11 @@ jobs:
# code and makes GitHub think the action failed
- name: Check for modified files
id: git-check
run: echo ::set-output name=modified::$(if git diff-index --quiet HEAD --; then echo "false"; else echo "true"; fi)
run: echo modified=$(if git diff-index --quiet HEAD --; then echo "false"; else echo "true"; fi) >> $GITHUB_OUTPUT
- name: Create Pull Request
if: steps.git-check.outputs.modified == 'true'
uses: peter-evans/create-pull-request@v3
uses: peter-evans/create-pull-request@v4
with:
title: Auto-format code with black
labels: meta

6
.github/workflows/explosionbot.yml vendored
View File

@ -8,14 +8,14 @@ on:
jobs:
explosion-bot:
runs-on: ubuntu-18.04
runs-on: ubuntu-latest
steps:
- name: Dump GitHub context
env:
GITHUB_CONTEXT: ${{ toJson(github) }}
run: echo "$GITHUB_CONTEXT"
- uses: actions/checkout@v1
- uses: actions/setup-python@v1
- uses: actions/checkout@v3
- uses: actions/setup-python@v4
- name: Install and run explosion-bot
run: |
pip install git+https://${{ secrets.EXPLOSIONBOT_TOKEN }}@github.com/explosion/explosion-bot

2
.github/workflows/lock.yml vendored
View File

@ -15,7 +15,7 @@ jobs:
action:
runs-on: ubuntu-latest
steps:
- uses: dessant/lock-threads@v3
- uses: dessant/lock-threads@v4
with:
process-only: 'issues'
issue-inactive-days: '30'

6
.github/workflows/slowtests.yml vendored
View File

@ -14,7 +14,7 @@ jobs:
runs-on: ubuntu-latest
steps:
- name: Checkout
uses: actions/checkout@v1
uses: actions/checkout@v3
with:
ref: ${{ matrix.branch }}
- name: Get commits from past 24 hours
@ -23,9 +23,9 @@ jobs:
today=$(date '+%Y-%m-%d %H:%M:%S')
yesterday=$(date -d "yesterday" '+%Y-%m-%d %H:%M:%S')
if git log --after="$yesterday" --before="$today" | grep commit ; then
echo "::set-output name=run_tests::true"
echo run_tests=true >> $GITHUB_OUTPUT
else
echo "::set-output name=run_tests::false"
echo run_tests=false >> $GITHUB_OUTPUT
fi
- name: Trigger buildkite build

6
.github/workflows/spacy_universe_alert.yml vendored
View File

@ -17,8 +17,10 @@ jobs:
run: |
echo "$GITHUB_CONTEXT"
- uses: actions/checkout@v1
- uses: actions/setup-python@v1
- uses: actions/checkout@v3
- uses: actions/setup-python@v4
with:
python-version: '3.10'
- name: Install Bernadette app dependency and send an alert
env:
SLACK_BOT_TOKEN: ${{ secrets.SLACK_BOT_TOKEN }}

1
.gitignore vendored
View File

@ -24,6 +24,7 @@ quickstart-training-generator.js
cythonize.json
spacy/*.html
*.cpp
*.c
*.so
# Vim / VSCode / editors

4
.pre-commit-config.yaml
View File

@ -5,8 +5,8 @@ repos:
- id: black
language_version: python3.7
additional_dependencies: ['click==8.0.4']
- repo: https://gitlab.com/pycqa/flake8
rev: 3.9.2
- repo: https://github.com/pycqa/flake8
rev: 5.0.4
hooks:
- id: flake8
args:

10
README.md
View File

@ -8,15 +8,15 @@ be used in real products.
spaCy comes with
[pretrained pipelines](https://spacy.io/models) and
currently supports tokenization and training for **60+ languages**. It features
currently supports tokenization and training for **70+ languages**. It features
state-of-the-art speed and **neural network models** for tagging,
parsing, **named entity recognition**, **text classification** and more,
multi-task learning with pretrained **transformers** like BERT, as well as a
production-ready [**training system**](https://spacy.io/usage/training) and easy
model packaging, deployment and workflow management. spaCy is commercial
open-source software, released under the MIT license.
open-source software, released under the [MIT license](https://github.com/explosion/spaCy/blob/master/LICENSE).
💫 **Version 3.4.0 out now!**
💫 **Version 3.4 out now!**
[Check out the release notes here.](https://github.com/explosion/spaCy/releases)
[![Azure Pipelines](https://img.shields.io/azure-devops/build/explosion-ai/public/8/master.svg?logo=azure-pipelines&style=flat-square&label=build)](https://dev.azure.com/explosion-ai/public/_build?definitionId=8)
@ -46,6 +46,7 @@ open-source software, released under the MIT license.
| 🛠 **[Changelog]** | Changes and version history. |
| 💝 **[Contribute]** | How to contribute to the spaCy project and code base. |
| <a href="https://explosion.ai/spacy-tailored-pipelines"><img src="https://user-images.githubusercontent.com/13643239/152853098-1c761611-ccb0-4ec6-9066-b234552831fe.png" width="125" alt="spaCy Tailored Pipelines"/></a> | Get a custom spaCy pipeline, tailor-made for your NLP problem by spaCy's core developers. Streamlined, production-ready, predictable and maintainable. Start by completing our 5-minute questionnaire to tell us what you need and we'll be in touch! **[Learn more &rarr;](https://explosion.ai/spacy-tailored-pipelines)** |
| <a href="https://explosion.ai/spacy-tailored-analysis"><img src="https://user-images.githubusercontent.com/1019791/206151300-b00cd189-e503-4797-aa1e-1bb6344062c5.png" width="125" alt="spaCy Tailored Pipelines"/></a> | Bespoke advice for problem solving, strategy and analysis for applied NLP projects. Services include data strategy, code reviews, pipeline design and annotation coaching. Curious? Fill in our 5-minute questionnaire to tell us what you need and we'll be in touch! **[Learn more &rarr;](https://explosion.ai/spacy-tailored-analysis)** |
[spacy 101]: https://spacy.io/usage/spacy-101
[new in v3.0]: https://spacy.io/usage/v3
@ -59,6 +60,7 @@ open-source software, released under the MIT license.
[changelog]: https://spacy.io/usage#changelog
[contribute]: https://github.com/explosion/spaCy/blob/master/CONTRIBUTING.md
## 💬 Where to ask questions
The spaCy project is maintained by the [spaCy team](https://explosion.ai/about).
@ -79,7 +81,7 @@ more people can benefit from it.
## Features
- Support for **60+ languages**
- Support for **70+ languages**
- **Trained pipelines** for different languages and tasks
- Multi-task learning with pretrained **transformers** like BERT
- Support for pretrained **word vectors** and embeddings

44
azure-pipelines.yml
View File

@ -31,7 +31,7 @@ jobs:
inputs:
versionSpec: "3.7"
- script: |
pip install flake8==3.9.2
pip install flake8==5.0.4
python -m flake8 spacy --count --select=E901,E999,F821,F822,F823,W605 --show-source --statistics
displayName: "flake8"
@ -41,7 +41,7 @@ jobs:
matrix:
# We're only running one platform per Python version to speed up builds
Python36Linux:
imageName: "ubuntu-latest"
imageName: "ubuntu-20.04"
python.version: "3.6"
# Python36Windows:
# imageName: "windows-latest"
@ -50,7 +50,7 @@ jobs:
# imageName: "macos-latest"
# python.version: "3.6"
# Python37Linux:
# imageName: "ubuntu-latest"
# imageName: "ubuntu-20.04"
# python.version: "3.7"
Python37Windows:
imageName: "windows-latest"
@ -76,15 +76,24 @@ jobs:
# Python39Mac:
# imageName: "macos-latest"
# python.version: "3.9"
Python310Linux:
imageName: "ubuntu-latest"
python.version: "3.10"
# Python310Linux:
# imageName: "ubuntu-latest"
# python.version: "3.10"
Python310Windows:
imageName: "windows-latest"
python.version: "3.10"
Python310Mac:
imageName: "macos-latest"
python.version: "3.10"
# Python310Mac:
# imageName: "macos-latest"
# python.version: "3.10"
Python311Linux:
imageName: 'ubuntu-latest'
python.version: '3.11'
Python311Windows:
imageName: 'windows-latest'
python.version: '3.11'
Python311Mac:
imageName: 'macos-latest'
python.version: '3.11'
maxParallel: 4
pool:
vmImage: $(imageName)
@ -92,20 +101,3 @@ jobs:
- template: .github/azure-steps.yml
parameters:
python_version: '$(python.version)'
architecture: 'x64'
# - job: "TestGPU"
# dependsOn: "Validate"
# strategy:
# matrix:
# Python38LinuxX64_GPU:
# python.version: '3.8'
# pool:
# name: "LinuxX64_GPU"
# steps:
# - template: .github/azure-steps.yml
# parameters:
# python_version: '$(python.version)'
# architecture: 'x64'
# gpu: true
# num_build_jobs: 24

3
build-constraints.txt
View File

@ -5,4 +5,5 @@ numpy==1.17.3; python_version=='3.8' and platform_machine!='aarch64'
numpy==1.19.2; python_version=='3.8' and platform_machine=='aarch64'
numpy==1.19.3; python_version=='3.9'
numpy==1.21.3; python_version=='3.10'
numpy; python_version>='3.11'
numpy==1.23.2; python_version=='3.11'
numpy; python_version>='3.12'

82
extra/DEVELOPER_DOCS/Satellite Packages.md Normal file
View File

@ -0,0 +1,82 @@
# spaCy Satellite Packages
This is a list of all the active repos relevant to spaCy besides the main one, with short descriptions, history, and current status. Archived repos will not be covered.
## Always Included in spaCy
These packages are always pulled in when you install spaCy. Most of them are direct dependencies, but some are transitive dependencies through other packages.
- [spacy-legacy](https://github.com/explosion/spacy-legacy): When an architecture in spaCy changes enough to get a new version, the old version is frozen and moved to spacy-legacy. This allows us to keep the core library slim while also preserving backwards compatability.
- [thinc](https://github.com/explosion/thinc): Thinc is the machine learning library that powers trainable components in spaCy. It wraps backends like Numpy, PyTorch, and Tensorflow to provide a functional interface for specifying architectures.
- [catalogue](https://github.com/explosion/catalogue): Small library for adding function registries, like those used for model architectures in spaCy.
- [confection](https://github.com/explosion/confection): This library contains the functionality for config parsing that was formerly contained directly in Thinc.
- [spacy-loggers](https://github.com/explosion/spacy-loggers): Contains loggers beyond the default logger available in spaCy&#39;s core code base. This includes loggers integrated with third-party services, which may differ in release cadence from spaCy itself.
- [wasabi](https://github.com/explosion/wasabi): A command line formatting library, used for terminal output in spaCy.
- [srsly](https://github.com/explosion/srsly): A wrapper that vendors several serialization libraries for spaCy. Includes parsers for JSON, JSONL, MessagePack, (extended) Pickle, and YAML.
- [preshed](https://github.com/explosion/preshed): A Cython library for low-level data structures like hash maps, used for memory efficient data storage.
- [cython-blis](https://github.com/explosion/cython-blis): Fast matrix multiplication using BLIS without depending on system libraries. Required by Thinc, rather than spaCy directly.
- [murmurhash](https://github.com/explosion/murmurhash): A wrapper library for a C++ murmurhash implementation, used for string IDs in spaCy and preshed.
- [cymem](https://github.com/explosion/cymem): A small library for RAII-style memory management in Cython.
## Optional Extensions for spaCy
These are repos that can be used by spaCy but aren&#39;t part of a default installation. Many of these are wrappers to integrate various kinds of third-party libraries.
- [spacy-transformers](https://github.com/explosion/spacy-transformers): A wrapper for the [HuggingFace Transformers](https://huggingface.co/docs/transformers/index) library, this handles the extensive conversion necessary to coordinate spaCy&#39;s powerful `Doc` representation, training pipeline, and the Transformer embeddings. When released, this was known as `spacy-pytorch-transformers`, but it changed to the current name when HuggingFace update the name of their library as well.
- [spacy-huggingface-hub](https://github.com/explosion/spacy-huggingface-hub): This package has a CLI script for uploading a packaged spaCy pipeline (created with `spacy package`) to the [Hugging Face Hub](https://huggingface.co/models).
- [spacy-alignments](https://github.com/explosion/spacy-alignments): A wrapper for the tokenizations library (mentioned below) with a modified build system to simplify cross-platform wheel creation. Used in spacy-transformers for aligning spaCy and HuggingFace tokenizations.
- [spacy-experimental](https://github.com/explosion/spacy-experimental): Experimental components that are not quite ready for inclusion in the main spaCy library. Usually there are unresolved questions around their APIs, so the experimental library allows us to expose them to the community for feedback before fully integrating them.
- [spacy-lookups-data](https://github.com/explosion/spacy-lookups-data): A repository of linguistic data, such as lemmas, that takes up a lot of disk space. Originally created to reduce the size of the spaCy core library. This is mainly useful if you want the data included but aren&#39;t using a pretrained pipeline; for the affected languages, the relevant data is included in pretrained pipelines directly.
- [coreferee](https://github.com/explosion/coreferee): Coreference resolution for English, French, German and Polish, optimised for limited training data and easily extensible for further languages. Used as a spaCy pipeline component.
- [spacy-stanza](https://github.com/explosion/spacy-stanza): This is a wrapper that allows the use of Stanford&#39;s Stanza library in spaCy.
- [spacy-streamlit](https://github.com/explosion/spacy-streamlit): A wrapper for the Streamlit dashboard building library to help with integrating [displaCy](https://spacy.io/api/top-level/#displacy).
- [spacymoji](https://github.com/explosion/spacymoji): A library to add extra support for emoji to spaCy, such as including character names.
- [thinc-apple-ops](https://github.com/explosion/thinc-apple-ops): A special backend for OSX that uses Apple&#39;s native libraries for improved performance.
- [os-signpost](https://github.com/explosion/os-signpost): A Python package that allows you to use the `OSSignposter` API in OSX for performance analysis.
- [spacy-ray](https://github.com/explosion/spacy-ray): A wrapper to integrate spaCy with Ray, a distributed training framework. Currently a work in progress.
## Prodigy
[Prodigy](https://prodi.gy) is Explosion&#39;s easy to use and highly customizable tool for annotating data. Prodigy itself requires a license, but the repos below contain documentation, examples, and editor or notebook integrations.
- [prodigy-recipes](https://github.com/explosion/prodigy-recipes): Sample recipes for Prodigy, along with notebooks and other examples of usage.
- [vscode-prodigy](https://github.com/explosion/vscode-prodigy): A VS Code extension that lets you run Prodigy inside VS Code.
- [jupyterlab-prodigy](https://github.com/explosion/jupyterlab-prodigy): An extension for JupyterLab that lets you run Prodigy inside JupyterLab.
## Independent Tools or Projects
These are tools that may be related to or use spaCy, but are functional independent projects in their own right as well.
- [floret](https://github.com/explosion/floret): A modification of fastText to use Bloom Embeddings. Can be used to add vectors with subword features to spaCy, and also works independently in the same manner as fastText.
- [sense2vec](https://github.com/explosion/sense2vec): A library to make embeddings of noun phrases or words coupled with their part of speech. This library uses spaCy.
- [spacy-vectors-builder](https://github.com/explosion/spacy-vectors-builder): This is a spaCy project that builds vectors using floret and a lot of input text. It handles downloading the input data as well as the actual building of vectors.
- [holmes-extractor](https://github.com/explosion/holmes-extractor): Information extraction from English and German texts based on predicate logic. Uses spaCy.
- [healthsea](https://github.com/explosion/healthsea): Healthsea is a project to extract information from comments about health supplements. Structurally, it&#39;s a self-contained, large spaCy project.
- [spacy-pkuseg](https://github.com/explosion/spacy-pkuseg): A fork of the pkuseg Chinese tokenizer. Used for Chinese support in spaCy, but also works independently.
- [ml-datasets](https://github.com/explosion/ml-datasets): This repo includes loaders for several standard machine learning datasets, like MNIST or WikiNER, and has historically been used in spaCy example code and documentation.
## Documentation and Informational Repos
These repos are used to support the spaCy docs or otherwise present information about spaCy or other Explosion projects.
- [projects](https://github.com/explosion/projects): The projects repo is used to show detailed examples of spaCy usage. Individual projects can be checked out using the spaCy command line tool, rather than checking out the projects repo directly.
- [spacy-course](https://github.com/explosion/spacy-course): Home to the interactive spaCy course for learning about how to use the library and some basic NLP principles.
- [spacy-io-binder](https://github.com/explosion/spacy-io-binder): Home to the notebooks used for interactive examples in the documentation.
## Organizational / Meta
These repos are used for organizing data around spaCy, but are not something an end user would need to install as part of using the library.
- [spacy-models](https://github.com/explosion/spacy-models): This repo contains metadata (but not training data) for all the spaCy models. This includes information about where their training data came from, version compatability, and performance information. It also includes tests for the model packages, and the built models are hosted as releases of this repo.
- [wheelwright](https://github.com/explosion/wheelwright): A tool for automating our PyPI builds and releases.
- [ec2buildwheel](https://github.com/explosion/ec2buildwheel): A small project that allows you to build Python packages in the manner of cibuildwheel, but on any EC2 image. Used by wheelwright.
## Other
Repos that don&#39;t fit in any of the above categories.
- [blis](https://github.com/explosion/blis): A fork of the official BLIS library. The main branch is not updated, but work continues in various branches. This is used for cython-blis.
- [tokenizations](https://github.com/explosion/tokenizations): A library originally by Yohei Tamura to align strings with tolerance to some variations in features like case and diacritics, used for aligning tokens and wordpieces. Adopted and maintained by Explosion, but usually spacy-alignments is used instead.
- [conll-2012](https://github.com/explosion/conll-2012): A repo to hold some slightly cleaned up versions of the official scripts for the CoNLL 2012 shared task involving coreference resolution. Used in the coref project.
- [fastapi-explosion-extras](https://github.com/explosion/fastapi-explosion-extras): Some small tweaks to FastAPI used at Explosion.

31
licenses/3rd_party_licenses.txt
View File

@ -127,3 +127,34 @@ distributed under the License is distributed on an "AS IS" BASIS,
WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied.
See the License for the specific language governing permissions and
limitations under the License.
polyleven
---------
* Files: spacy/matcher/polyleven.c
MIT License
Copyright (c) 2021 Fujimoto Seiji <fujimoto@ceptord.net>
Copyright (c) 2021 Max Bachmann <kontakt@maxbachmann.de>
Copyright (c) 2022 Nick Mazuk
Copyright (c) 2022 Michael Weiss <code@mweiss.ch>
Permission is hereby granted, free of charge, to any person obtaining a copy
of this software and associated documentation files (the "Software"), to deal
in the Software without restriction, including without limitation the rights
to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
copies of the Software, and to permit persons to whom the Software is
furnished to do so, subject to the following conditions:
The above copyright notice and this permission notice shall be included in all
copies or substantial portions of the Software.
THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
SOFTWARE.

2
pyproject.toml
View File

@ -5,7 +5,7 @@ requires = [
"cymem>=2.0.2,<2.1.0",
"preshed>=3.0.2,<3.1.0",
"murmurhash>=0.28.0,<1.1.0",
"thinc>=8.1.0,<8.2.0",
"thinc>=9.0.0.dev1,<9.1.0",
"numpy>=1.15.0",
]
build-backend = "setuptools.build_meta"

18
requirements.txt
View File

@ -1,21 +1,22 @@
# Our libraries
spacy-legacy>=3.0.10,<3.1.0
spacy-legacy>=3.0.11,<3.1.0
spacy-loggers>=1.0.0,<2.0.0
cymem>=2.0.2,<2.1.0
preshed>=3.0.2,<3.1.0
thinc>=8.1.0,<8.2.0
thinc>=9.0.0.dev1,<9.1.0
ml_datasets>=0.2.0,<0.3.0
murmurhash>=0.28.0,<1.1.0
wasabi>=0.9.1,<1.1.0
wasabi>=0.9.1,<1.2.0
srsly>=2.4.3,<3.0.0
catalogue>=2.0.6,<2.1.0
typer>=0.3.0,<0.5.0
pathy>=0.3.5
typer>=0.3.0,<0.8.0
pathy>=0.10.0
smart-open>=5.2.1,<7.0.0
# Third party dependencies
numpy>=1.15.0
requests>=2.13.0,<3.0.0
tqdm>=4.38.0,<5.0.0
pydantic>=1.7.4,!=1.8,!=1.8.1,<1.10.0
pydantic>=1.7.4,!=1.8,!=1.8.1,<1.11.0
jinja2
langcodes>=3.2.0,<4.0.0
# Official Python utilities
@ -28,11 +29,12 @@ cython>=0.25,<3.0
pytest>=5.2.0,!=7.1.0
pytest-timeout>=1.3.0,<2.0.0
mock>=2.0.0,<3.0.0
flake8>=3.8.0,<3.10.0
flake8>=3.8.0,<6.0.0
hypothesis>=3.27.0,<7.0.0
mypy>=0.910,<0.970; platform_machine!='aarch64'
mypy>=0.990,<0.1000; platform_machine != "aarch64" and python_version >= "3.7"
types-dataclasses>=0.1.3; python_version < "3.7"
types-mock>=0.1.1
types-setuptools>=57.0.0
types-requests
types-setuptools>=57.0.0
black>=22.0,<23.0

50
setup.cfg
View File

@ -22,6 +22,7 @@ classifiers =
Programming Language :: Python :: 3.8
Programming Language :: Python :: 3.9
Programming Language :: Python :: 3.10
Programming Language :: Python :: 3.11
Topic :: Scientific/Engineering
project_urls =
Release notes = https://github.com/explosion/spaCy/releases
@ -33,22 +34,23 @@ include_package_data = true
python_requires = >=3.6
install_requires =
# Our libraries
spacy-legacy>=3.0.10,<3.1.0
spacy-legacy>=3.0.11,<3.1.0
spacy-loggers>=1.0.0,<2.0.0
murmurhash>=0.28.0,<1.1.0
cymem>=2.0.2,<2.1.0
preshed>=3.0.2,<3.1.0
thinc>=8.1.0,<8.2.0
wasabi>=0.9.1,<1.1.0
thinc>=9.0.0.dev1,<9.1.0
wasabi>=0.9.1,<1.2.0
srsly>=2.4.3,<3.0.0
catalogue>=2.0.6,<2.1.0
# Third-party dependencies
typer>=0.3.0,<0.5.0
pathy>=0.3.5
typer>=0.3.0,<0.8.0
pathy>=0.10.0
smart-open>=5.2.1,<7.0.0
tqdm>=4.38.0,<5.0.0
numpy>=1.15.0
requests>=2.13.0,<3.0.0
pydantic>=1.7.4,!=1.8,!=1.8.1,<1.10.0
pydantic>=1.7.4,!=1.8,!=1.8.1,<1.11.0
jinja2
# Official Python utilities
setuptools
@ -68,37 +70,41 @@ transformers =
ray =
spacy_ray>=0.1.0,<1.0.0
cuda =
cupy>=5.0.0b4,<11.0.0
cupy>=5.0.0b4,<12.0.0
cuda80 =
cupy-cuda80>=5.0.0b4,<11.0.0
cupy-cuda80>=5.0.0b4,<12.0.0
cuda90 =
cupy-cuda90>=5.0.0b4,<11.0.0
cupy-cuda90>=5.0.0b4,<12.0.0
cuda91 =
cupy-cuda91>=5.0.0b4,<11.0.0
cupy-cuda91>=5.0.0b4,<12.0.0
cuda92 =
cupy-cuda92>=5.0.0b4,<11.0.0
cupy-cuda92>=5.0.0b4,<12.0.0
cuda100 =
cupy-cuda100>=5.0.0b4,<11.0.0
cupy-cuda100>=5.0.0b4,<12.0.0
cuda101 =
cupy-cuda101>=5.0.0b4,<11.0.0
cupy-cuda101>=5.0.0b4,<12.0.0
cuda102 =
cupy-cuda102>=5.0.0b4,<11.0.0
cupy-cuda102>=5.0.0b4,<12.0.0
cuda110 =
cupy-cuda110>=5.0.0b4,<11.0.0
cupy-cuda110>=5.0.0b4,<12.0.0
cuda111 =
cupy-cuda111>=5.0.0b4,<11.0.0
cupy-cuda111>=5.0.0b4,<12.0.0
cuda112 =
cupy-cuda112>=5.0.0b4,<11.0.0
cupy-cuda112>=5.0.0b4,<12.0.0
cuda113 =
cupy-cuda113>=5.0.0b4,<11.0.0
cupy-cuda113>=5.0.0b4,<12.0.0
cuda114 =
cupy-cuda114>=5.0.0b4,<11.0.0
cupy-cuda114>=5.0.0b4,<12.0.0
cuda115 =
cupy-cuda115>=5.0.0b4,<11.0.0
cupy-cuda115>=5.0.0b4,<12.0.0
cuda116 =
cupy-cuda116>=5.0.0b4,<11.0.0
cupy-cuda116>=5.0.0b4,<12.0.0
cuda117 =
cupy-cuda117>=5.0.0b4,<11.0.0
cupy-cuda117>=5.0.0b4,<12.0.0
cuda11x =
cupy-cuda11x>=11.0.0,<12.0.0
cuda-autodetect =
cupy-wheel>=11.0.0,<12.0.0
apple =
thinc-apple-ops>=0.1.0.dev0,<1.0.0
# Language tokenizers with external dependencies

16
setup.py
View File

@ -30,12 +30,13 @@ MOD_NAMES = [
"spacy.lexeme",
"spacy.vocab",
"spacy.attrs",
"spacy.kb",
"spacy.kb.candidate",
"spacy.kb.kb",
"spacy.kb.kb_in_memory",
"spacy.ml.tb_framework",
"spacy.morphology",
"spacy.pipeline._edit_tree_internals.edit_trees",
"spacy.pipeline.morphologizer",
"spacy.pipeline.multitask",
"spacy.pipeline.pipe",
"spacy.pipeline.trainable_pipe",
"spacy.pipeline.sentencizer",
@ -207,6 +208,17 @@ def setup_package():
get_python_inc(plat_specific=True),
]
ext_modules = []
ext_modules.append(
Extension(
"spacy.matcher.levenshtein",
[
"spacy/matcher/levenshtein.pyx",
"spacy/matcher/polyleven.c",
],
language="c",
include_dirs=include_dirs,
)
)
for name in MOD_NAMES:
mod_path = name.replace(".", "/") + ".pyx"
ext = Extension(

6
spacy/__init__.py
View File

@ -31,9 +31,9 @@ def load(
name: Union[str, Path],
*,
vocab: Union[Vocab, bool] = True,
disable: Union[str, Iterable[str]] = util.SimpleFrozenList(),
enable: Union[str, Iterable[str]] = util.SimpleFrozenList(),
exclude: Union[str, Iterable[str]] = util.SimpleFrozenList(),
disable: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES,
enable: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES,
exclude: Union[str, Iterable[str]] = util._DEFAULT_EMPTY_PIPES,
config: Union[Dict[str, Any], Config] = util.SimpleFrozenDict(),
) -> Language:
"""Load a spaCy model from an installed package or a local path.

2
spacy/about.py
View File

@ -1,6 +1,6 @@
# fmt: off
__title__ = "spacy"
__version__ = "3.4.1"
__version__ = "3.5.0"
__download_url__ = "https://github.com/explosion/spacy-models/releases/download"
__compatibility__ = "https://raw.githubusercontent.com/explosion/spacy-models/master/compatibility.json"
__projects__ = "https://github.com/explosion/projects"

2
spacy/cli/__init__.py
View File

@ -16,6 +16,7 @@ from .debug_config import debug_config # noqa: F401
from .debug_model import debug_model # noqa: F401
from .debug_diff import debug_diff # noqa: F401
from .evaluate import evaluate # noqa: F401
from .apply import apply # noqa: F401
from .convert import convert # noqa: F401
from .init_pipeline import init_pipeline_cli # noqa: F401
from .init_config import init_config, fill_config # noqa: F401
@ -27,6 +28,7 @@ from .project.dvc import project_update_dvc # noqa: F401
from .project.push import project_push # noqa: F401
from .project.pull import project_pull # noqa: F401
from .project.document import project_document # noqa: F401
from .find_threshold import find_threshold # noqa: F401
@app.command("link", no_args_is_help=True, deprecated=True, hidden=True)

57
spacy/cli/_util.py
View File

@ -23,7 +23,7 @@ from ..util import is_compatible_version, SimpleFrozenDict, ENV_VARS
from .. import about
if TYPE_CHECKING:
from pathy import Pathy # noqa: F401
from pathy import FluidPath # noqa: F401
SDIST_SUFFIX = ".tar.gz"
@ -158,15 +158,15 @@ def load_project_config(
sys.exit(1)
validate_project_version(config)
validate_project_commands(config)
if interpolate:
err = f"{PROJECT_FILE} validation error"
with show_validation_error(title=err, hint_fill=False):
config = substitute_project_variables(config, overrides)
# Make sure directories defined in config exist
for subdir in config.get("directories", []):
dir_path = path / subdir
if not dir_path.exists():
dir_path.mkdir(parents=True)
if interpolate:
err = f"{PROJECT_FILE} validation error"
with show_validation_error(title=err, hint_fill=False):
config = substitute_project_variables(config, overrides)
return config
@ -331,7 +331,7 @@ def import_code(code_path: Optional[Union[Path, str]]) -> None:
msg.fail(f"Couldn't load Python code: {code_path}", e, exits=1)
def upload_file(src: Path, dest: Union[str, "Pathy"]) -> None:
def upload_file(src: Path, dest: Union[str, "FluidPath"]) -> None:
"""Upload a file.
src (Path): The source path.
@ -339,13 +339,20 @@ def upload_file(src: Path, dest: Union[str, "Pathy"]) -> None:
"""
import smart_open
# Create parent directories for local paths
if isinstance(dest, Path):
if not dest.parent.exists():
dest.parent.mkdir(parents=True)
dest = str(dest)
with smart_open.open(dest, mode="wb") as output_file:
with src.open(mode="rb") as input_file:
output_file.write(input_file.read())
def download_file(src: Union[str, "Pathy"], dest: Path, *, force: bool = False) -> None:
def download_file(
src: Union[str, "FluidPath"], dest: Path, *, force: bool = False
) -> None:
"""Download a file using smart_open.
url (str): The URL of the file.
@ -358,7 +365,7 @@ def download_file(src: Union[str, "Pathy"], dest: Path, *, force: bool = False)
if dest.exists() and not force:
return None
src = str(src)
with smart_open.open(src, mode="rb", ignore_ext=True) as input_file:
with smart_open.open(src, mode="rb", compression="disable") as input_file:
with dest.open(mode="wb") as output_file:
shutil.copyfileobj(input_file, output_file)
@ -368,7 +375,7 @@ def ensure_pathy(path):
slow and annoying Google Cloud warning)."""
from pathy import Pathy # noqa: F811
return Pathy(path)
return Pathy.fluid(path)
def git_checkout(
@ -573,3 +580,35 @@ def setup_gpu(use_gpu: int, silent=None) -> None:
local_msg.info("Using CPU")
if gpu_is_available():
local_msg.info("To switch to GPU 0, use the option: --gpu-id 0")
def walk_directory(path: Path, suffix: Optional[str] = None) -> List[Path]:
if not path.is_dir():
return [path]
paths = [path]
locs = []
seen = set()
for path in paths:
if str(path) in seen:
continue
seen.add(str(path))
if path.parts[-1].startswith("."):
continue
elif path.is_dir():
paths.extend(path.iterdir())
elif suffix is not None and not path.parts[-1].endswith(suffix):
continue
else:
locs.append(path)
# It's good to sort these, in case the ordering messes up cache.
locs.sort()
return locs
def _format_number(number: Union[int, float], ndigits: int = 2) -> str:
"""Formats a number (float or int) rounding to `ndigits`, without truncating trailing 0s,
as happens with `round(number, ndigits)`"""
if isinstance(number, float):
return f"{number:.{ndigits}f}"
else:
return str(number)

143
spacy/cli/apply.py Normal file
View File

@ -0,0 +1,143 @@
import tqdm
import srsly
from itertools import chain
from pathlib import Path
from typing import Optional, List, Iterable, cast, Union
from wasabi import msg
from ._util import app, Arg, Opt, setup_gpu, import_code, walk_directory
from ..tokens import Doc, DocBin
from ..vocab import Vocab
from ..util import ensure_path, load_model
path_help = """Location of the documents to predict on.
Can be a single file in .spacy format or a .jsonl file.
Files with other extensions are treated as single plain text documents.
If a directory is provided it is traversed recursively to grab
all files to be processed.
The files can be a mixture of .spacy, .jsonl and text files.
If .jsonl is provided the specified field is going
to be grabbed ("text" by default)."""
out_help = "Path to save the resulting .spacy file"
code_help = (
"Path to Python file with additional " "code (registered functions) to be imported"
)
gold_help = "Use gold preprocessing provided in the .spacy files"
force_msg = (
"The provided output file already exists. "
"To force overwriting the output file, set the --force or -F flag."
)
DocOrStrStream = Union[Iterable[str], Iterable[Doc]]
def _stream_docbin(path: Path, vocab: Vocab) -> Iterable[Doc]:
"""
Stream Doc objects from DocBin.
"""
docbin = DocBin().from_disk(path)
for doc in docbin.get_docs(vocab):
yield doc
def _stream_jsonl(path: Path, field: str) -> Iterable[str]:
"""
Stream "text" field from JSONL. If the field "text" is
not found it raises error.
"""
for entry in srsly.read_jsonl(path):
if field not in entry:
msg.fail(f"{path} does not contain the required '{field}' field.", exits=1)
else:
yield entry[field]
def _stream_texts(paths: Iterable[Path]) -> Iterable[str]:
"""
Yields strings from text files in paths.
"""
for path in paths:
with open(path, "r") as fin:
text = fin.read()
yield text
@app.command("apply")
def apply_cli(
# fmt: off
model: str = Arg(..., help="Model name or path"),
data_path: Path = Arg(..., help=path_help, exists=True),
output_file: Path = Arg(..., help=out_help, dir_okay=False),
code_path: Optional[Path] = Opt(None, "--code", "-c", help=code_help),
text_key: str = Opt("text", "--text-key", "-tk", help="Key containing text string for JSONL"),
force_overwrite: bool = Opt(False, "--force", "-F", help="Force overwriting the output file"),
use_gpu: int = Opt(-1, "--gpu-id", "-g", help="GPU ID or -1 for CPU."),
batch_size: int = Opt(1, "--batch-size", "-b", help="Batch size."),
n_process: int = Opt(1, "--n-process", "-n", help="number of processors to use.")
):
"""
Apply a trained pipeline to documents to get predictions.
Expects a loadable spaCy pipeline and path to the data, which
can be a directory or a file.
The data files can be provided in multiple formats:
1. .spacy files
2. .jsonl files with a specified "field" to read the text from.
3. Files with any other extension are assumed to be containing
a single document.
DOCS: https://spacy.io/api/cli#apply
"""
data_path = ensure_path(data_path)
output_file = ensure_path(output_file)
code_path = ensure_path(code_path)
if output_file.exists() and not force_overwrite:
msg.fail(force_msg, exits=1)
if not data_path.exists():
msg.fail(f"Couldn't find data path: {data_path}", exits=1)
import_code(code_path)
setup_gpu(use_gpu)
apply(data_path, output_file, model, text_key, batch_size, n_process)
def apply(
data_path: Path,
output_file: Path,
model: str,
json_field: str,
batch_size: int,
n_process: int,
):
docbin = DocBin(store_user_data=True)
paths = walk_directory(data_path)
if len(paths) == 0:
docbin.to_disk(output_file)
msg.warn(
"Did not find data to process,"
f" {data_path} seems to be an empty directory."
)
return
nlp = load_model(model)
msg.good(f"Loaded model {model}")
vocab = nlp.vocab
streams: List[DocOrStrStream] = []
text_files = []
for path in paths:
if path.suffix == ".spacy":
streams.append(_stream_docbin(path, vocab))
elif path.suffix == ".jsonl":
streams.append(_stream_jsonl(path, json_field))
else:
text_files.append(path)
if len(text_files) > 0:
streams.append(_stream_texts(text_files))
datagen = cast(DocOrStrStream, chain(*streams))
for doc in tqdm.tqdm(nlp.pipe(datagen, batch_size=batch_size, n_process=n_process)):
docbin.add(doc)
if output_file.suffix == "":
output_file = output_file.with_suffix(".spacy")
docbin.to_disk(output_file)

31
spacy/cli/convert.py
View File

@ -1,4 +1,4 @@
from typing import Callable, Iterable, Mapping, Optional, Any, List, Union
from typing import Callable, Iterable, Mapping, Optional, Any, Union
from enum import Enum
from pathlib import Path
from wasabi import Printer
@ -7,7 +7,7 @@ import re
import sys
import itertools
from ._util import app, Arg, Opt
from ._util import app, Arg, Opt, walk_directory
from ..training import docs_to_json
from ..tokens import Doc, DocBin
from ..training.converters import iob_to_docs, conll_ner_to_docs, json_to_docs
@ -189,33 +189,6 @@ def autodetect_ner_format(input_data: str) -> Optional[str]:
return None
def walk_directory(path: Path, converter: str) -> List[Path]:
if not path.is_dir():
return [path]
paths = [path]
locs = []
seen = set()
for path in paths:
if str(path) in seen:
continue
seen.add(str(path))
if path.parts[-1].startswith("."):
continue
elif path.is_dir():
paths.extend(path.iterdir())
elif converter == "json" and not path.parts[-1].endswith("json"):
continue
elif converter == "conll" and not path.parts[-1].endswith("conll"):
continue
elif converter == "iob" and not path.parts[-1].endswith("iob"):
continue
else:
locs.append(path)
# It's good to sort these, in case the ordering messes up cache.
locs.sort()
return locs
def verify_cli_args(
msg: Printer,
input_path: Path,

31
spacy/cli/debug_data.py
View File

@ -9,10 +9,11 @@ import typer
import math
from ._util import app, Arg, Opt, show_validation_error, parse_config_overrides
from ._util import import_code, debug_cli
from ._util import import_code, debug_cli, _format_number
from ..training import Example, remove_bilu_prefix
from ..training.initialize import get_sourced_components
from ..schemas import ConfigSchemaTraining
from ..pipeline import TrainablePipe
from ..pipeline._parser_internals import nonproj
from ..pipeline._parser_internals.nonproj import DELIMITER
from ..pipeline import Morphologizer, SpanCategorizer
@ -934,6 +935,7 @@ def _get_labels_from_model(nlp: Language, factory_name: str) -> Set[str]:
labels: Set[str] = set()
for pipe_name in pipe_names:
pipe = nlp.get_pipe(pipe_name)
assert isinstance(pipe, TrainablePipe)
labels.update(pipe.labels)
return labels
@ -989,7 +991,8 @@ def _get_kl_divergence(p: Counter, q: Counter) -> float:
def _format_span_row(span_data: List[Dict], labels: List[str]) -> List[Any]:
"""Compile into one list for easier reporting"""
d = {
label: [label] + list(round(d[label], 2) for d in span_data) for label in labels
label: [label] + list(_format_number(d[label]) for d in span_data)
for label in labels
}
return list(d.values())
@ -1004,6 +1007,10 @@ def _get_span_characteristics(
label: _gmean(l)
for label, l in compiled_gold["spans_length"][spans_key].items()
}
spans_per_type = {
label: len(spans)
for label, spans in compiled_gold["spans_per_type"][spans_key].items()
}
min_lengths = [min(l) for l in compiled_gold["spans_length"][spans_key].values()]
max_lengths = [max(l) for l in compiled_gold["spans_length"][spans_key].values()]
@ -1031,6 +1038,7 @@ def _get_span_characteristics(
return {
"sd": span_distinctiveness,
"bd": sb_distinctiveness,
"spans_per_type": spans_per_type,
"lengths": span_length,
"min_length": min(min_lengths),
"max_length": max(max_lengths),
@ -1045,12 +1053,15 @@ def _get_span_characteristics(
def _print_span_characteristics(span_characteristics: Dict[str, Any]):
"""Print all span characteristics into a table"""
headers = ("Span Type", "Length", "SD", "BD")
headers = ("Span Type", "Length", "SD", "BD", "N")
# Wasabi has this at 30 by default, but we might have some long labels
max_col = max(30, max(len(label) for label in span_characteristics["labels"]))
# Prepare table data with all span characteristics
table_data = [
span_characteristics["lengths"],
span_characteristics["sd"],
span_characteristics["bd"],
span_characteristics["spans_per_type"],
]
table = _format_span_row(
span_data=table_data, labels=span_characteristics["labels"]
@ -1061,8 +1072,18 @@ def _print_span_characteristics(span_characteristics: Dict[str, Any]):
span_characteristics["avg_sd"],
span_characteristics["avg_bd"],
]
footer = ["Wgt. Average"] + [str(round(f, 2)) for f in footer_data]
msg.table(table, footer=footer, header=headers, divider=True)
footer = (
["Wgt. Average"] + ["{:.2f}".format(round(f, 2)) for f in footer_data] + ["-"]
)
msg.table(
table,
footer=footer,
header=headers,
divider=True,
aligns=["l"] + ["r"] * (len(footer_data) + 1),
max_col=max_col,
)
def _get_spans_length_freq_dist(

7
spacy/cli/download.py
View File

@ -8,7 +8,6 @@ from ._util import app, Arg, Opt, WHEEL_SUFFIX, SDIST_SUFFIX
from .. import about
from ..util import is_package, get_minor_version, run_command
from ..util import is_prerelease_version
from ..errors import OLD_MODEL_SHORTCUTS
@app.command(
@ -61,12 +60,6 @@ def download(
version = components[-1]
else:
model_name = model
if model in OLD_MODEL_SHORTCUTS:
msg.warn(
f"As of spaCy v3.0, shortcuts like '{model}' are deprecated. Please "
f"use the full pipeline package name '{OLD_MODEL_SHORTCUTS[model]}' instead."
)
model_name = OLD_MODEL_SHORTCUTS[model]
compatibility = get_compatibility()
version = get_version(model_name, compatibility)

233
spacy/cli/find_threshold.py Normal file
View File

@ -0,0 +1,233 @@
import functools
import operator
from pathlib import Path
import logging
from typing import Optional, Tuple, Any, Dict, List
import numpy
import wasabi.tables
from ..pipeline import TextCategorizer, MultiLabel_TextCategorizer
from ..errors import Errors
from ..training import Corpus
from ._util import app, Arg, Opt, import_code, setup_gpu
from .. import util
_DEFAULTS = {
"n_trials": 11,
"use_gpu": -1,
"gold_preproc": False,
}
@app.command(
"find-threshold",
context_settings={"allow_extra_args": False, "ignore_unknown_options": True},
)
def find_threshold_cli(
# fmt: off
model: str = Arg(..., help="Model name or path"),
data_path: Path = Arg(..., help="Location of binary evaluation data in .spacy format", exists=True),
pipe_name: str = Arg(..., help="Name of pipe to examine thresholds for"),
threshold_key: str = Arg(..., help="Key of threshold attribute in component's configuration"),
scores_key: str = Arg(..., help="Metric to optimize"),
n_trials: int = Opt(_DEFAULTS["n_trials"], "--n_trials", "-n", help="Number of trials to determine optimal thresholds"),
code_path: Optional[Path] = Opt(None, "--code", "-c", help="Path to Python file with additional code (registered functions) to be imported"),
use_gpu: int = Opt(_DEFAULTS["use_gpu"], "--gpu-id", "-g", help="GPU ID or -1 for CPU"),
gold_preproc: bool = Opt(_DEFAULTS["gold_preproc"], "--gold-preproc", "-G", help="Use gold preprocessing"),
verbose: bool = Opt(False, "--silent", "-V", "-VV", help="Display more information for debugging purposes"),
# fmt: on
):
"""
Runs prediction trials for a trained model with varying tresholds to maximize
the specified metric. The search space for the threshold is traversed linearly
from 0 to 1 in `n_trials` steps. Results are displayed in a table on `stdout`
(the corresponding API call to `spacy.cli.find_threshold.find_threshold()`
returns all results).
This is applicable only for components whose predictions are influenced by
thresholds - e.g. `textcat_multilabel` and `spancat`, but not `textcat`. Note
that the full path to the corresponding threshold attribute in the config has to
be provided.
DOCS: https://spacy.io/api/cli#find-threshold
"""
util.logger.setLevel(logging.DEBUG if verbose else logging.INFO)
import_code(code_path)
find_threshold(
model=model,
data_path=data_path,
pipe_name=pipe_name,
threshold_key=threshold_key,
scores_key=scores_key,
n_trials=n_trials,
use_gpu=use_gpu,
gold_preproc=gold_preproc,
silent=False,
)
def find_threshold(
model: str,
data_path: Path,
pipe_name: str,
threshold_key: str,
scores_key: str,
*,
n_trials: int = _DEFAULTS["n_trials"], # type: ignore
use_gpu: int = _DEFAULTS["use_gpu"], # type: ignore
gold_preproc: bool = _DEFAULTS["gold_preproc"], # type: ignore
silent: bool = True,
) -> Tuple[float, float, Dict[float, float]]:
"""
Runs prediction trials for models with varying tresholds to maximize the specified metric.
model (Union[str, Path]): Pipeline to evaluate. Can be a package or a path to a data directory.
data_path (Path): Path to file with DocBin with docs to use for threshold search.
pipe_name (str): Name of pipe to examine thresholds for.
threshold_key (str): Key of threshold attribute in component's configuration.
scores_key (str): Name of score to metric to optimize.
n_trials (int): Number of trials to determine optimal thresholds.
use_gpu (int): GPU ID or -1 for CPU.
gold_preproc (bool): Whether to use gold preprocessing. Gold preprocessing helps the annotations align to the
tokenization, and may result in sequences of more consistent length. However, it may reduce runtime accuracy due
to train/test skew.
silent (bool): Whether to print non-error-related output to stdout.
RETURNS (Tuple[float, float, Dict[float, float]]): Best found threshold, the corresponding score, scores for all
evaluated thresholds.
"""
setup_gpu(use_gpu, silent=silent)
data_path = util.ensure_path(data_path)
if not data_path.exists():
wasabi.msg.fail("Evaluation data not found", data_path, exits=1)
nlp = util.load_model(model)
if pipe_name not in nlp.component_names:
raise AttributeError(
Errors.E001.format(name=pipe_name, opts=nlp.component_names)
)
pipe = nlp.get_pipe(pipe_name)
if not hasattr(pipe, "scorer"):
raise AttributeError(Errors.E1045)
if type(pipe) == TextCategorizer:
wasabi.msg.warn(
"The `textcat` component doesn't use a threshold as it's not applicable to the concept of "
"exclusive classes. All thresholds will yield the same results."
)
if not silent:
wasabi.msg.info(
title=f"Optimizing for {scores_key} for component '{pipe_name}' with {n_trials} "
f"trials."
)
# Load evaluation corpus.
corpus = Corpus(data_path, gold_preproc=gold_preproc)
dev_dataset = list(corpus(nlp))
config_keys = threshold_key.split(".")
def set_nested_item(
config: Dict[str, Any], keys: List[str], value: float
) -> Dict[str, Any]:
"""Set item in nested dictionary. Adapted from https://stackoverflow.com/a/54138200.
config (Dict[str, Any]): Configuration dictionary.
keys (List[Any]): Path to value to set.
value (float): Value to set.
RETURNS (Dict[str, Any]): Updated dictionary.
"""
functools.reduce(operator.getitem, keys[:-1], config)[keys[-1]] = value
return config
def filter_config(
config: Dict[str, Any], keys: List[str], full_key: str
) -> Dict[str, Any]:
"""Filters provided config dictionary so that only the specified keys path remains.
config (Dict[str, Any]): Configuration dictionary.
keys (List[Any]): Path to value to set.
full_key (str): Full user-specified key.
RETURNS (Dict[str, Any]): Filtered dictionary.
"""
if keys[0] not in config:
wasabi.msg.fail(
title=f"Failed to look up `{full_key}` in config: sub-key {[keys[0]]} not found.",
text=f"Make sure you specified {[keys[0]]} correctly. The following sub-keys are available instead: "
f"{list(config.keys())}",
exits=1,
)
return {
keys[0]: filter_config(config[keys[0]], keys[1:], full_key)
if len(keys) > 1
else config[keys[0]]
}
# Evaluate with varying threshold values.
scores: Dict[float, float] = {}
config_keys_full = ["components", pipe_name, *config_keys]
table_col_widths = (10, 10)
thresholds = numpy.linspace(0, 1, n_trials)
print(wasabi.tables.row(["Threshold", f"{scores_key}"], widths=table_col_widths))
for threshold in thresholds:
# Reload pipeline with overrides specifying the new threshold.
nlp = util.load_model(
model,
config=set_nested_item(
filter_config(
nlp.config, config_keys_full, ".".join(config_keys_full)
).copy(),
config_keys_full,
threshold,
),
)
if hasattr(pipe, "cfg"):
setattr(
nlp.get_pipe(pipe_name),
"cfg",
set_nested_item(getattr(pipe, "cfg"), config_keys, threshold),
)
eval_scores = nlp.evaluate(dev_dataset)
if scores_key not in eval_scores:
wasabi.msg.fail(
title=f"Failed to look up score `{scores_key}` in evaluation results.",
text=f"Make sure you specified the correct value for `scores_key`. The following scores are "
f"available: {list(eval_scores.keys())}",
exits=1,
)
scores[threshold] = eval_scores[scores_key]
if not isinstance(scores[threshold], (float, int)):
wasabi.msg.fail(
f"Returned score for key '{scores_key}' is not numeric. Threshold optimization only works for numeric "
f"scores.",
exits=1,
)
print(
wasabi.row(
[round(threshold, 3), round(scores[threshold], 3)],
widths=table_col_widths,
)
)
best_threshold = max(scores.keys(), key=(lambda key: scores[key]))
# If all scores are identical, emit warning.
if len(set(scores.values())) == 1:
wasabi.msg.warn(
title="All scores are identical. Verify that all settings are correct.",
text=""
if (
not isinstance(pipe, MultiLabel_TextCategorizer)
or scores_key in ("cats_macro_f", "cats_micro_f")
)
else "Use `cats_macro_f` or `cats_micro_f` when optimizing the threshold for `textcat_multilabel`.",
)
else:
if not silent:
print(
f"\nBest threshold: {round(best_threshold, ndigits=4)} with {scores_key} value of {scores[best_threshold]}."
)
return best_threshold, scores[best_threshold], scores

1
spacy/cli/info.py
View File

@ -147,6 +147,7 @@ def info_installed_model_url(model: str) -> Optional[str]:
# something else, like no file or invalid JSON
return None
def info_model_url(model: str) -> Dict[str, Any]:
"""Return the download URL for the latest version of a pipeline."""
version = get_latest_version(model)

2
spacy/cli/package.py
View File

@ -299,8 +299,8 @@ def get_meta(
}
nlp = util.load_model_from_path(Path(model_path))
meta.update(nlp.meta)
meta.update(existing_meta)
meta["spacy_version"] = util.get_minor_version_range(about.__version__)
meta.update(existing_meta)
meta["vectors"] = {
"width": nlp.vocab.vectors_length,
"vectors": len(nlp.vocab.vectors),

6
spacy/cli/project/assets.py
View File

@ -189,7 +189,11 @@ def convert_asset_url(url: str) -> str:
RETURNS (str): The converted URL.
"""
# If the asset URL is a regular GitHub URL it's likely a mistake
if re.match(r"(http(s?)):\/\/github.com", url) and "releases/download" not in url:
if (
re.match(r"(http(s?)):\/\/github.com", url)
and "releases/download" not in url
and "/raw/" not in url
):
converted = url.replace("github.com", "raw.githubusercontent.com")
converted = re.sub(r"/(tree|blob)/", "/", converted)
msg.warn(

57
spacy/cli/project/dvc.py
View File

@ -25,6 +25,7 @@ def project_update_dvc_cli(
project_dir: Path = Arg(Path.cwd(), help="Location of project directory. Defaults to current working directory.", exists=True, file_okay=False),
workflow: Optional[str] = Arg(None, help=f"Name of workflow defined in {PROJECT_FILE}. Defaults to first workflow if not set."),
verbose: bool = Opt(False, "--verbose", "-V", help="Print more info"),
quiet: bool = Opt(False, "--quiet", "-q", help="Print less info"),
force: bool = Opt(False, "--force", "-F", help="Force update DVC config"),
# fmt: on
):
@ -36,7 +37,7 @@ def project_update_dvc_cli(
DOCS: https://spacy.io/api/cli#project-dvc
"""
project_update_dvc(project_dir, workflow, verbose=verbose, force=force)
project_update_dvc(project_dir, workflow, verbose=verbose, quiet=quiet, force=force)
def project_update_dvc(
@ -44,6 +45,7 @@ def project_update_dvc(
workflow: Optional[str] = None,
*,
verbose: bool = False,
quiet: bool = False,
force: bool = False,
) -> None:
"""Update the auto-generated Data Version Control (DVC) config file. A DVC
@ -54,11 +56,12 @@ def project_update_dvc(
workflow (Optional[str]): Optional name of workflow defined in project.yml.
If not set, the first workflow will be used.
verbose (bool): Print more info.
quiet (bool): Print less info.
force (bool): Force update DVC config.
"""
config = load_project_config(project_dir)
updated = update_dvc_config(
project_dir, config, workflow, verbose=verbose, force=force
project_dir, config, workflow, verbose=verbose, quiet=quiet, force=force
)
help_msg = "To execute the workflow with DVC, run: dvc repro"
if updated:
@ -72,7 +75,7 @@ def update_dvc_config(
config: Dict[str, Any],
workflow: Optional[str] = None,
verbose: bool = False,
silent: bool = False,
quiet: bool = False,
force: bool = False,
) -> bool:
"""Re-run the DVC commands in dry mode and update dvc.yaml file in the
@ -83,7 +86,7 @@ def update_dvc_config(
path (Path): The path to the project directory.
config (Dict[str, Any]): The loaded project.yml.
verbose (bool): Whether to print additional info (via DVC).
silent (bool): Don't output anything (via DVC).
quiet (bool): Don't output anything (via DVC).
force (bool): Force update, even if hashes match.
RETURNS (bool): Whether the DVC config file was updated.
"""
@ -105,6 +108,14 @@ def update_dvc_config(
dvc_config_path.unlink()
dvc_commands = []
config_commands = {cmd["name"]: cmd for cmd in config.get("commands", [])}
# some flags that apply to every command
flags = []
if verbose:
flags.append("--verbose")
if quiet:
flags.append("--quiet")
for name in workflows[workflow]:
command = config_commands[name]
deps = command.get("deps", [])
@ -118,14 +129,26 @@ def update_dvc_config(
deps_cmd = [c for cl in [["-d", p] for p in deps] for c in cl]
outputs_cmd = [c for cl in [["-o", p] for p in outputs] for c in cl]
outputs_nc_cmd = [c for cl in [["-O", p] for p in outputs_no_cache] for c in cl]
dvc_cmd = ["run", "-n", name, "-w", str(path), "--no-exec"]
dvc_cmd = ["run", *flags, "-n", name, "-w", str(path), "--no-exec"]
if command.get("no_skip"):
dvc_cmd.append("--always-changed")
full_cmd = [*dvc_cmd, *deps_cmd, *outputs_cmd, *outputs_nc_cmd, *project_cmd]
dvc_commands.append(join_command(full_cmd))
if not dvc_commands:
# If we don't check for this, then there will be an error when reading the
# config, since DVC wouldn't create it.
msg.fail(
"No usable commands for DVC found. This can happen if none of your "
"commands have dependencies or outputs.",
exits=1,
)
with working_dir(path):
dvc_flags = {"--verbose": verbose, "--quiet": silent}
run_dvc_commands(dvc_commands, flags=dvc_flags)
for c in dvc_commands:
dvc_command = "dvc " + c
run_command(dvc_command)
with dvc_config_path.open("r+", encoding="utf8") as f:
content = f.read()
f.seek(0, 0)
@ -133,26 +156,6 @@ def update_dvc_config(
return True
def run_dvc_commands(
commands: Iterable[str] = SimpleFrozenList(), flags: Dict[str, bool] = {}
) -> None:
"""Run a sequence of DVC commands in a subprocess, in order.
commands (List[str]): The string commands without the leading "dvc".
flags (Dict[str, bool]): Conditional flags to be added to command. Makes it
easier to pass flags like --quiet that depend on a variable or
command-line setting while avoiding lots of nested conditionals.
"""
for c in commands:
command = split_command(c)
dvc_command = ["dvc", *command]
# Add the flags if they are set to True
for flag, is_active in flags.items():
if is_active:
dvc_command.append(flag)
run_command(dvc_command)
def check_workflows(workflows: List[str], workflow: Optional[str] = None) -> None:
"""Validate workflows provided in project.yml and check that a given
workflow can be used to generate a DVC config.

55
spacy/cli/project/remote_storage.py
View File

@ -5,14 +5,17 @@ import hashlib
import urllib.parse
import tarfile
from pathlib import Path
from wasabi import msg
from .._util import get_hash, get_checksum, download_file, ensure_pathy
from ...util import make_tempdir, get_minor_version, ENV_VARS, check_bool_env_var
from .._util import get_hash, get_checksum, upload_file, download_file
from .._util import ensure_pathy, make_tempdir
from ...util import get_minor_version, ENV_VARS, check_bool_env_var
from ...git_info import GIT_VERSION
from ... import about
from ...errors import Errors
if TYPE_CHECKING:
from pathy import Pathy # noqa: F401
from pathy import FluidPath # noqa: F401
class RemoteStorage:
@ -27,7 +30,7 @@ class RemoteStorage:
self.url = ensure_pathy(url)
self.compression = compression
def push(self, path: Path, command_hash: str, content_hash: str) -> "Pathy":
def push(self, path: Path, command_hash: str, content_hash: str) -> "FluidPath":
"""Compress a file or directory within a project and upload it to a remote
storage. If an object exists at the full URL, nothing is done.
@ -48,9 +51,7 @@ class RemoteStorage:
mode_string = f"w:{self.compression}" if self.compression else "w"
with tarfile.open(tar_loc, mode=mode_string) as tar_file:
tar_file.add(str(loc), arcname=str(path))
with tar_loc.open(mode="rb") as input_file:
with url.open(mode="wb") as output_file:
output_file.write(input_file.read())
upload_file(tar_loc, url)
return url
def pull(
@ -59,7 +60,7 @@ class RemoteStorage:
*,
command_hash: Optional[str] = None,
content_hash: Optional[str] = None,
) -> Optional["Pathy"]:
) -> Optional["FluidPath"]:
"""Retrieve a file from the remote cache. If the file already exists,
nothing is done.
@ -84,7 +85,23 @@ class RemoteStorage:
with tarfile.open(tar_loc, mode=mode_string) as tar_file:
# This requires that the path is added correctly, relative
# to root. This is how we set things up in push()
tar_file.extractall(self.root)
# Disallow paths outside the current directory for the tar
# file (CVE-2007-4559, directory traversal vulnerability)
def is_within_directory(directory, target):
abs_directory = os.path.abspath(directory)
abs_target = os.path.abspath(target)
prefix = os.path.commonprefix([abs_directory, abs_target])
return prefix == abs_directory
def safe_extract(tar, path):
for member in tar.getmembers():
member_path = os.path.join(path, member.name)
if not is_within_directory(path, member_path):
raise ValueError(Errors.E852)
tar.extractall(path)
safe_extract(tar_file, self.root)
return url
def find(
@ -93,25 +110,37 @@ class RemoteStorage:
*,
command_hash: Optional[str] = None,
content_hash: Optional[str] = None,
) -> Optional["Pathy"]:
) -> Optional["FluidPath"]:
"""Find the best matching version of a file within the storage,
or `None` if no match can be found. If both the creation and content hash
are specified, only exact matches will be returned. Otherwise, the most
recent matching file is preferred.
"""
name = self.encode_name(str(path))
urls = []
if command_hash is not None and content_hash is not None:
url = self.make_url(path, command_hash, content_hash)
url = self.url / name / command_hash / content_hash
urls = [url] if url.exists() else []
elif command_hash is not None:
if (self.url / name / command_hash).exists():
urls = list((self.url / name / command_hash).iterdir())
else:
urls = list((self.url / name).iterdir())
if (self.url / name).exists():
for sub_dir in (self.url / name).iterdir():
urls.extend(sub_dir.iterdir())
if content_hash is not None:
urls = [url for url in urls if url.parts[-1] == content_hash]
if len(urls) >= 2:
try:
urls.sort(key=lambda x: x.stat().last_modified) # type: ignore
except Exception:
msg.warn(
"Unable to sort remote files by last modified. The file(s) "
"pulled from the cache may not be the most recent."
)
return urls[-1] if urls else None
def make_url(self, path: Path, command_hash: str, content_hash: str) -> "Pathy":
def make_url(self, path: Path, command_hash: str, content_hash: str) -> "FluidPath":
"""Construct a URL from a subpath, a creation hash and a content hash."""
return self.url / self.encode_name(str(path)) / command_hash / content_hash

56
spacy/cli/project/run.py
View File

@ -1,5 +1,8 @@
from typing import Optional, List, Dict, Sequence, Any, Iterable
from typing import Optional, List, Dict, Sequence, Any, Iterable, Tuple
import os.path
from pathlib import Path
import pkg_resources
from wasabi import msg
from wasabi.util import locale_escape
import sys
@ -50,6 +53,7 @@ def project_run(
force: bool = False,
dry: bool = False,
capture: bool = False,
skip_requirements_check: bool = False,
) -> None:
"""Run a named script defined in the project.yml. If the script is part
of the default pipeline (defined in the "run" section), DVC is used to
@ -66,11 +70,19 @@ def project_run(
sys.exit will be called with the return code. You should use capture=False
when you want to turn over execution to the command, and capture=True
when you want to run the command more like a function.
skip_requirements_check (bool): Whether to skip the requirements check.
"""
config = load_project_config(project_dir, overrides=overrides)
commands = {cmd["name"]: cmd for cmd in config.get("commands", [])}
workflows = config.get("workflows", {})
validate_subcommand(list(commands.keys()), list(workflows.keys()), subcommand)
req_path = project_dir / "requirements.txt"
if not skip_requirements_check:
if config.get("check_requirements", True) and os.path.exists(req_path):
with req_path.open() as requirements_file:
_check_requirements([req.strip() for req in requirements_file])
if subcommand in workflows:
msg.info(f"Running workflow '{subcommand}'")
for cmd in workflows[subcommand]:
@ -81,6 +93,7 @@ def project_run(
force=force,
dry=dry,
capture=capture,
skip_requirements_check=True,
)
else:
cmd = commands[subcommand]
@ -88,8 +101,8 @@ def project_run(
if not (project_dir / dep).exists():
err = f"Missing dependency specified by command '{subcommand}': {dep}"
err_help = "Maybe you forgot to run the 'project assets' command or a previous step?"
err_kwargs = {"exits": 1} if not dry else {}
msg.fail(err, err_help, **err_kwargs)
err_exits = 1 if not dry else None
msg.fail(err, err_help, exits=err_exits)
check_spacy_commit = check_bool_env_var(ENV_VARS.PROJECT_USE_GIT_VERSION)
with working_dir(project_dir) as current_dir:
msg.divider(subcommand)
@ -195,6 +208,8 @@ def validate_subcommand(
msg.fail(f"No commands or workflows defined in {PROJECT_FILE}", exits=1)
if subcommand not in commands and subcommand not in workflows:
help_msg = []
if subcommand in ["assets", "asset"]:
help_msg.append("Did you mean to run: python -m spacy project assets?")
if commands:
help_msg.append(f"Available commands: {', '.join(commands)}")
if workflows:
@ -308,3 +323,38 @@ def get_fileinfo(project_dir: Path, paths: List[str]) -> List[Dict[str, Optional
md5 = get_checksum(file_path) if file_path.exists() else None
data.append({"path": path, "md5": md5})
return data
def _check_requirements(requirements: List[str]) -> Tuple[bool, bool]:
"""Checks whether requirements are installed and free of version conflicts.
requirements (List[str]): List of requirements.
RETURNS (Tuple[bool, bool]): Whether (1) any packages couldn't be imported, (2) any packages with version conflicts
exist.
"""
failed_pkgs_msgs: List[str] = []
conflicting_pkgs_msgs: List[str] = []
for req in requirements:
try:
pkg_resources.require(req)
except pkg_resources.DistributionNotFound as dnf:
failed_pkgs_msgs.append(dnf.report())
except pkg_resources.VersionConflict as vc:
conflicting_pkgs_msgs.append(vc.report())
except Exception:
msg.warn(
f"Unable to check requirement: {req} "
"Checks are currently limited to requirement specifiers "
"(PEP 508)"
)
if len(failed_pkgs_msgs) or len(conflicting_pkgs_msgs):
msg.warn(
title="Missing requirements or requirement conflicts detected. Make sure your Python environment is set up "
"correctly and you installed all requirements specified in your project's requirements.txt: "
)
for pgk_msg in failed_pkgs_msgs + conflicting_pkgs_msgs:
msg.text(pgk_msg)
return len(failed_pkgs_msgs) > 0, len(conflicting_pkgs_msgs) > 0

9
spacy/cli/templates/quickstart_training.jinja
View File

@ -1,7 +1,7 @@
{# This is a template for training configs used for the quickstart widget in
the docs and the init config command. It encodes various best practices and
can help generate the best possible configuration, given a user's requirements. #}
{%- set use_transformer = hardware != "cpu" -%}
{%- set use_transformer = hardware != "cpu" and transformer_data -%}
{%- set transformer = transformer_data[optimize] if use_transformer else {} -%}
{%- set listener_components = ["tagger", "morphologizer", "parser", "ner", "textcat", "textcat_multilabel", "entity_linker", "spancat", "trainable_lemmatizer"] -%}
[paths]
@ -269,13 +269,8 @@ factory = "tok2vec"
[components.tok2vec.model.embed]
@architectures = "spacy.MultiHashEmbed.v2"
width = ${components.tok2vec.model.encode.width}
{% if has_letters -%}
attrs = ["NORM", "PREFIX", "SUFFIX", "SHAPE"]
rows = [5000, 2500, 2500, 2500]
{% else -%}
attrs = ["ORTH", "SHAPE"]
rows = [5000, 2500]
{% endif -%}
rows = [5000, 1000, 2500, 2500]
include_static_vectors = {{ "true" if optimize == "accuracy" else "false" }}
[components.tok2vec.model.encode]

10
spacy/cli/templates/quickstart_training_recommendations.yml
View File

@ -37,6 +37,15 @@ bn:
accuracy:
name: sagorsarker/bangla-bert-base
size_factor: 3
ca:
word_vectors: null
transformer:
efficiency:
name: projecte-aina/roberta-base-ca-v2
size_factor: 3
accuracy:
name: projecte-aina/roberta-base-ca-v2
size_factor: 3
da:
word_vectors: da_core_news_lg
transformer:
@ -271,4 +280,3 @@ zh:
accuracy:
name: bert-base-chinese
size_factor: 3
has_letters: false

2
spacy/default_config.cfg
View File

@ -90,6 +90,8 @@ dev_corpus = "corpora.dev"
train_corpus = "corpora.train"
# Optional callback before nlp object is saved to disk after training
before_to_disk = null
# Optional callback that is invoked at the start of each training step
before_update = null
[training.logger]
@loggers = "spacy.ConsoleLogger.v1"

5
spacy/displacy/__init__.py
View File

@ -228,12 +228,13 @@ def parse_spans(doc: Doc, options: Dict[str, Any] = {}) -> Dict[str, Any]:
"kb_id": span.kb_id_ if span.kb_id_ else "",
"kb_url": kb_url_template.format(span.kb_id_) if kb_url_template else "#",
}
for span in doc.spans[spans_key]
for span in doc.spans.get(spans_key, [])
]
tokens = [token.text for token in doc]
if not spans:
warnings.warn(Warnings.W117.format(spans_key=spans_key))
keys = list(doc.spans.keys())
warnings.warn(Warnings.W117.format(spans_key=spans_key, keys=keys))
title = doc.user_data.get("title", None) if hasattr(doc, "user_data") else None
settings = get_doc_settings(doc)
return {

73
spacy/errors.py
View File

@ -131,13 +131,6 @@ class Warnings(metaclass=ErrorsWithCodes):
"and make it independent. For example, `replace_listeners = "
"[\"model.tok2vec\"]` See the documentation for details: "
"https://spacy.io/usage/training#config-components-listeners")
W088 = ("The pipeline component {name} implements a `begin_training` "
"method, which won't be called by spaCy. As of v3.0, `begin_training` "
"has been renamed to `initialize`, so you likely want to rename the "
"component method. See the documentation for details: "
"https://spacy.io/api/language#initialize")
W089 = ("As of spaCy v3.0, the `nlp.begin_training` method has been renamed "
"to `nlp.initialize`.")
W090 = ("Could not locate any {format} files in path '{path}'.")
W091 = ("Could not clean/remove the temp directory at {dir}: {msg}.")
W092 = ("Ignoring annotations for sentence starts, as dependency heads are set.")
@ -199,7 +192,7 @@ class Warnings(metaclass=ErrorsWithCodes):
W117 = ("No spans to visualize found in Doc object with spans_key: '{spans_key}'. If this is "
"surprising to you, make sure the Doc was processed using a model "
"that supports span categorization, and check the `doc.spans[spans_key]` "
"property manually if necessary.")
"property manually if necessary.\n\nAvailable keys: {keys}")
W118 = ("Term '{term}' not found in glossary. It may however be explained in documentation "
"for the corpora used to train the language. Please check "
"`nlp.meta[\"sources\"]` for any relevant links.")
@ -212,6 +205,8 @@ class Warnings(metaclass=ErrorsWithCodes):
W121 = ("Attempting to trace non-existent method '{method}' in pipe '{pipe}'")
W122 = ("Couldn't trace method '{method}' in pipe '{pipe}'. This can happen if the pipe class "
"is a Cython extension type.")
W123 = ("Argument `enable` with value {enable} does not contain all values specified in the config option "
"`enabled` ({enabled}). Be aware that this might affect other components in your pipeline.")
W400 = ("`use_upper=False` is ignored, the upper layer is always enabled")
@ -250,9 +245,7 @@ class Errors(metaclass=ErrorsWithCodes):
"https://spacy.io/usage/models")
E011 = ("Unknown operator: '{op}'. Options: {opts}")
E012 = ("Cannot add pattern for zero tokens to matcher.\nKey: {key}")
E016 = ("MultitaskObjective target should be function or one of: dep, "
"tag, ent, dep_tag_offset, ent_tag.")
E017 = ("Can only add unicode or bytes. Got type: {value_type}")
E017 = ("Can only add 'str' inputs to StringStore. Got type: {value_type}")
E018 = ("Can't retrieve string for hash '{hash_value}'. This usually "
"refers to an issue with the `Vocab` or `StringStore`.")
E019 = ("Can't create transition with unknown action ID: {action}. Action "
@ -345,6 +338,11 @@ class Errors(metaclass=ErrorsWithCodes):
"clear the existing vectors and resize the table.")
E074 = ("Error interpreting compiled match pattern: patterns are expected "
"to end with the attribute {attr}. Got: {bad_attr}.")
E079 = ("Error computing states in beam: number of predicted beams "
"({pbeams}) does not equal number of gold beams ({gbeams}).")
E080 = ("Duplicate state found in beam: {key}.")
E081 = ("Error getting gradient in beam: number of histories ({n_hist}) "
"does not equal number of losses ({losses}).")
E082 = ("Error deprojectivizing parse: number of heads ({n_heads}), "
"projective heads ({n_proj_heads}) and labels ({n_labels}) do not "
"match.")
@ -460,13 +458,13 @@ class Errors(metaclass=ErrorsWithCodes):
"same, but found '{nlp}' and '{vocab}' respectively.")
E152 = ("The attribute {attr} is not supported for token patterns. "
"Please use the option `validate=True` with the Matcher, PhraseMatcher, "
"EntityRuler or AttributeRuler for more details.")
"SpanRuler or AttributeRuler for more details.")
E153 = ("The value type {vtype} is not supported for token patterns. "
"Please use the option validate=True with Matcher, PhraseMatcher, "
"EntityRuler or AttributeRuler for more details.")
"SpanRuler or AttributeRuler for more details.")
E154 = ("One of the attributes or values is not supported for token "
"patterns. Please use the option `validate=True` with the Matcher, "
"PhraseMatcher, or EntityRuler for more details.")
"PhraseMatcher, or SpanRuler for more details.")
E155 = ("The pipeline needs to include a {pipe} in order to use "
"Matcher or PhraseMatcher with the attribute {attr}. "
"Try using `nlp()` instead of `nlp.make_doc()` or `list(nlp.pipe())` "
@ -540,8 +538,14 @@ class Errors(metaclass=ErrorsWithCodes):
E199 = ("Unable to merge 0-length span at `doc[{start}:{end}]`.")
E200 = ("Can't set {attr} from Span.")
E202 = ("Unsupported {name} mode '{mode}'. Supported modes: {modes}.")
E203 = ("If the {name} embedding layer is not updated "
"during training, make sure to include it in 'annotating components'")
# New errors added in v3.x
E851 = ("The 'textcat' component labels should only have values of 0 or 1, "
"but found value of '{val}'.")
E852 = ("The tar file pulled from the remote attempted an unsafe path "
"traversal.")
E853 = ("Unsupported component factory name '{name}'. The character '.' is "
"not permitted in factory names.")
E854 = ("Unable to set doc.ents. Check that the 'ents_filter' does not "
@ -709,11 +713,11 @@ class Errors(metaclass=ErrorsWithCodes):
"need to modify the pipeline, use the built-in methods like "
"`nlp.add_pipe`, `nlp.remove_pipe`, `nlp.disable_pipe` or "
"`nlp.enable_pipe` instead.")
E927 = ("Can't write to frozen list Maybe you're trying to modify a computed "
E927 = ("Can't write to frozen list. Maybe you're trying to modify a computed "
"property or default function argument?")
E928 = ("A KnowledgeBase can only be serialized to/from from a directory, "
E928 = ("An InMemoryLookupKB can only be serialized to/from from a directory, "
"but the provided argument {loc} points to a file.")
E929 = ("Couldn't read KnowledgeBase from {loc}. The path does not seem to exist.")
E929 = ("Couldn't read InMemoryLookupKB from {loc}. The path does not seem to exist.")
E930 = ("Received invalid get_examples callback in `{method}`. "
"Expected function that returns an iterable of Example objects but "
"got: {obj}")
@ -721,13 +725,6 @@ class Errors(metaclass=ErrorsWithCodes):
"method in component '{name}'. If you want to use this "
"method, make sure it's overwritten on the subclass.")
E940 = ("Found NaN values in scores.")
E941 = ("Can't find model '{name}'. It looks like you're trying to load a "
"model from a shortcut, which is obsolete as of spaCy v3.0. To "
"load the model, use its full name instead:\n\n"
"nlp = spacy.load(\"{full}\")\n\nFor more details on the available "
"models, see the models directory: https://spacy.io/models. If you "
"want to create a blank model, use spacy.blank: "
"nlp = spacy.blank(\"{name}\")")
E942 = ("Executing `after_{name}` callback failed. Expected the function to "
"return an initialized nlp object but got: {value}. Maybe "
"you forgot to return the modified object in your function?")
@ -915,8 +912,6 @@ class Errors(metaclass=ErrorsWithCodes):
E1021 = ("`pos` value \"{pp}\" is not a valid Universal Dependencies tag. "
"Non-UD tags should use the `tag` property.")
E1022 = ("Words must be of type str or int, but input is of type '{wtype}'")
E1023 = ("Couldn't read EntityRuler from the {path}. This file doesn't "
"exist.")
E1024 = ("A pattern with {attr_type} '{label}' is not present in "
"'{component}' patterns.")
E1025 = ("Cannot intify the value '{value}' as an IOB string. The only "
@ -939,23 +934,25 @@ class Errors(metaclass=ErrorsWithCodes):
E1040 = ("Doc.from_json requires all tokens to have the same attributes. "
"Some tokens do not contain annotation for: {partial_attrs}")
E1041 = ("Expected a string, Doc, or bytes as input, but got: {type}")
E1042 = ("Function was called with `{arg1}`={arg1_values} and "
"`{arg2}`={arg2_values} but these arguments are conflicting.")
E1042 = ("`enable={enable}` and `disable={disable}` are inconsistent with each other.\nIf you only passed "
"one of `enable` or `disable`, the other argument is specified in your pipeline's configuration.\nIn that "
"case pass an empty list for the previously not specified argument to avoid this error.")
E1043 = ("Expected None or a value in range [{range_start}, {range_end}] for entity linker threshold, but got "
"{value}.")
E1044 = ("Expected `candidates_batch_size` to be >= 1, but got: {value}")
E1045 = ("Encountered {parent} subclass without `{parent}.{method}` "
"method in '{name}'. If you want to use this method, make "
"sure it's overwritten on the subclass.")
E1046 = ("{cls_name} is an abstract class and cannot be instantiated. If you are looking for spaCy's default "
"knowledge base, use `InMemoryLookupKB`.")
E1047 = ("`find_threshold()` only supports components with a `scorer` attribute.")
E1048 = ("Got '{unexpected}' as console progress bar type, but expected one of the following: {expected}")
# v4 error strings
E4000 = ("Expected a Doc as input, but got: '{type}'")
E4001 = ("Backprop is not supported when is_train is not set.")
# Deprecated model shortcuts, only used in errors and warnings
OLD_MODEL_SHORTCUTS = {
"en": "en_core_web_sm", "de": "de_core_news_sm", "es": "es_core_news_sm",
"pt": "pt_core_news_sm", "fr": "fr_core_news_sm", "it": "it_core_news_sm",
"nl": "nl_core_news_sm", "el": "el_core_news_sm", "nb": "nb_core_news_sm",
"lt": "lt_core_news_sm", "xx": "xx_ent_wiki_sm"
}
E4001 = ("Expected input to be one of the following types: ({expected_types}), "
"but got '{received_type}'")
E4002 = ("Backprop is not supported when is_train is not set.")
# fmt: on

3
spacy/kb/__init__.py Normal file
View File

@ -0,0 +1,3 @@
from .kb import KnowledgeBase
from .kb_in_memory import InMemoryLookupKB
from .candidate import Candidate, get_candidates, get_candidates_batch

12
spacy/kb/candidate.pxd Normal file
View File

@ -0,0 +1,12 @@
from .kb cimport KnowledgeBase
from libcpp.vector cimport vector
from ..typedefs cimport hash_t
# Object used by the Entity Linker that summarizes one entity-alias candidate combination.
cdef class Candidate:
cdef readonly KnowledgeBase kb
cdef hash_t entity_hash
cdef float entity_freq
cdef vector[float] entity_vector
cdef hash_t alias_hash
cdef float prior_prob

74
spacy/kb/candidate.pyx Normal file
View File

@ -0,0 +1,74 @@
# cython: infer_types=True, profile=True
from typing import Iterable
from .kb cimport KnowledgeBase
from ..tokens import Span
cdef class Candidate:
"""A `Candidate` object refers to a textual mention (`alias`) that may or may not be resolved
to a specific `entity` from a Knowledge Base. This will be used as input for the entity linking
algorithm which will disambiguate the various candidates to the correct one.
Each candidate (alias, entity) pair is assigned a certain prior probability.
DOCS: https://spacy.io/api/kb/#candidate-init
"""
def __init__(self, KnowledgeBase kb, entity_hash, entity_freq, entity_vector, alias_hash, prior_prob):
self.kb = kb
self.entity_hash = entity_hash
self.entity_freq = entity_freq
self.entity_vector = entity_vector
self.alias_hash = alias_hash
self.prior_prob = prior_prob
@property
def entity(self) -> int:
"""RETURNS (uint64): hash of the entity's KB ID/name"""
return self.entity_hash
@property
def entity_(self) -> str:
"""RETURNS (str): ID/name of this entity in the KB"""
return self.kb.vocab.strings[self.entity_hash]
@property
def alias(self) -> int:
"""RETURNS (uint64): hash of the alias"""
return self.alias_hash
@property
def alias_(self) -> str:
"""RETURNS (str): ID of the original alias"""
return self.kb.vocab.strings[self.alias_hash]
@property
def entity_freq(self) -> float:
return self.entity_freq
@property
def entity_vector(self) -> Iterable[float]:
return self.entity_vector
@property
def prior_prob(self) -> float:
return self.prior_prob
def get_candidates(kb: KnowledgeBase, mention: Span) -> Iterable[Candidate]:
"""
Return candidate entities for a given mention and fetching appropriate entries from the index.
kb (KnowledgeBase): Knowledge base to query.
mention (Span): Entity mention for which to identify candidates.
RETURNS (Iterable[Candidate]): Identified candidates.
"""
return kb.get_candidates(mention)
def get_candidates_batch(kb: KnowledgeBase, mentions: Iterable[Span]) -> Iterable[Iterable[Candidate]]:
"""
Return candidate entities for the given mentions and fetching appropriate entries from the index.
kb (KnowledgeBase): Knowledge base to query.
mention (Iterable[Span]): Entity mentions for which to identify candidates.
RETURNS (Iterable[Iterable[Candidate]]): Identified candidates.
"""
return kb.get_candidates_batch(mentions)

10
spacy/kb/kb.pxd Normal file
View File

@ -0,0 +1,10 @@
"""Knowledge-base for entity or concept linking."""
from cymem.cymem cimport Pool
from libc.stdint cimport int64_t
from ..vocab cimport Vocab
cdef class KnowledgeBase:
cdef Pool mem
cdef readonly Vocab vocab
cdef readonly int64_t entity_vector_length

108
spacy/kb/kb.pyx Normal file
View File

@ -0,0 +1,108 @@
# cython: infer_types=True, profile=True
from pathlib import Path
from typing import Iterable, Tuple, Union
from cymem.cymem cimport Pool
from .candidate import Candidate
from ..tokens import Span
from ..util import SimpleFrozenList
from ..errors import Errors
cdef class KnowledgeBase:
"""A `KnowledgeBase` instance stores unique identifiers for entities and their textual aliases,
to support entity linking of named entities to real-world concepts.
This is an abstract class and requires its operations to be implemented.
DOCS: https://spacy.io/api/kb
"""
def __init__(self, vocab: Vocab, entity_vector_length: int):
"""Create a KnowledgeBase."""
# Make sure abstract KB is not instantiated.
if self.__class__ == KnowledgeBase:
raise TypeError(
Errors.E1046.format(cls_name=self.__class__.__name__)
)
self.vocab = vocab
self.entity_vector_length = entity_vector_length
self.mem = Pool()
def get_candidates_batch(self, mentions: Iterable[Span]) -> Iterable[Iterable[Candidate]]:
"""
Return candidate entities for specified texts. Each candidate defines the entity, the original alias,
and the prior probability of that alias resolving to that entity.
If no candidate is found for a given text, an empty list is returned.
mentions (Iterable[Span]): Mentions for which to get candidates.
RETURNS (Iterable[Iterable[Candidate]]): Identified candidates.
"""
return [self.get_candidates(span) for span in mentions]
def get_candidates(self, mention: Span) -> Iterable[Candidate]:
"""
Return candidate entities for specified text. Each candidate defines the entity, the original alias,
and the prior probability of that alias resolving to that entity.
If the no candidate is found for a given text, an empty list is returned.
mention (Span): Mention for which to get candidates.
RETURNS (Iterable[Candidate]): Identified candidates.
"""
raise NotImplementedError(
Errors.E1045.format(parent="KnowledgeBase", method="get_candidates", name=self.__name__)
)
def get_vectors(self, entities: Iterable[str]) -> Iterable[Iterable[float]]:
"""
Return vectors for entities.
entity (str): Entity name/ID.
RETURNS (Iterable[Iterable[float]]): Vectors for specified entities.
"""
return [self.get_vector(entity) for entity in entities]
def get_vector(self, str entity) -> Iterable[float]:
"""
Return vector for entity.
entity (str): Entity name/ID.
RETURNS (Iterable[float]): Vector for specified entity.
"""
raise NotImplementedError(
Errors.E1045.format(parent="KnowledgeBase", method="get_vector", name=self.__name__)
)
def to_bytes(self, **kwargs) -> bytes:
"""Serialize the current state to a binary string.
RETURNS (bytes): Current state as binary string.
"""
raise NotImplementedError(
Errors.E1045.format(parent="KnowledgeBase", method="to_bytes", name=self.__name__)
)
def from_bytes(self, bytes_data: bytes, *, exclude: Tuple[str] = tuple()):
"""Load state from a binary string.
bytes_data (bytes): KB state.
exclude (Tuple[str]): Properties to exclude when restoring KB.
"""
raise NotImplementedError(
Errors.E1045.format(parent="KnowledgeBase", method="from_bytes", name=self.__name__)
)
def to_disk(self, path: Union[str, Path], exclude: Iterable[str] = SimpleFrozenList()) -> None:
"""
Write KnowledgeBase content to disk.
path (Union[str, Path]): Target file path.
exclude (Iterable[str]): List of components to exclude.
"""
raise NotImplementedError(
Errors.E1045.format(parent="KnowledgeBase", method="to_disk", name=self.__name__)
)
def from_disk(self, path: Union[str, Path], exclude: Iterable[str] = SimpleFrozenList()) -> None:
"""
Load KnowledgeBase content from disk.
path (Union[str, Path]): Target file path.
exclude (Iterable[str]): List of components to exclude.
"""
raise NotImplementedError(
Errors.E1045.format(parent="KnowledgeBase", method="from_disk", name=self.__name__)
)

24
spacy/kb.pxd → spacy/kb/kb_in_memory.pxd
View File

@ -1,14 +1,12 @@
"""Knowledge-base for entity or concept linking."""
from cymem.cymem cimport Pool
from preshed.maps cimport PreshMap
from libcpp.vector cimport vector
from libc.stdint cimport int32_t, int64_t
from libc.stdio cimport FILE
from .vocab cimport Vocab
from .typedefs cimport hash_t
from .structs cimport KBEntryC, AliasC
from ..typedefs cimport hash_t
from ..structs cimport KBEntryC, AliasC
from .kb cimport KnowledgeBase
ctypedef vector[KBEntryC] entry_vec
ctypedef vector[AliasC] alias_vec
@ -16,21 +14,7 @@ ctypedef vector[float] float_vec
ctypedef vector[float_vec] float_matrix
# Object used by the Entity Linker that summarizes one entity-alias candidate combination.
cdef class Candidate:
cdef readonly KnowledgeBase kb
cdef hash_t entity_hash
cdef float entity_freq
cdef vector[float] entity_vector
cdef hash_t alias_hash
cdef float prior_prob
cdef class KnowledgeBase:
cdef Pool mem
cdef readonly Vocab vocab
cdef int64_t entity_vector_length
cdef class InMemoryLookupKB(KnowledgeBase):
# This maps 64bit keys (hash of unique entity string)
# to 64bit values (position of the _KBEntryC struct in the _entries vector).
# The PreshMap is pretty space efficient, as it uses open addressing. So

96
spacy/kb.pyx → spacy/kb/kb_in_memory.pyx
View File

@ -1,8 +1,7 @@
# cython: infer_types=True, profile=True
from typing import Iterator, Iterable, Callable, Dict, Any
from typing import Iterable, Callable, Dict, Any, Union
import srsly
from cymem.cymem cimport Pool
from preshed.maps cimport PreshMap
from cpython.exc cimport PyErr_SetFromErrno
from libc.stdio cimport fopen, fclose, fread, fwrite, feof, fseek
@ -12,85 +11,28 @@ from libcpp.vector cimport vector
from pathlib import Path
import warnings
from .typedefs cimport hash_t
from .errors import Errors, Warnings
from . import util
from .util import SimpleFrozenList, ensure_path
cdef class Candidate:
"""A `Candidate` object refers to a textual mention (`alias`) that may or may not be resolved
to a specific `entity` from a Knowledge Base. This will be used as input for the entity linking
algorithm which will disambiguate the various candidates to the correct one.
Each candidate (alias, entity) pair is assigned to a certain prior probability.
DOCS: https://spacy.io/api/kb/#candidate_init
"""
def __init__(self, KnowledgeBase kb, entity_hash, entity_freq, entity_vector, alias_hash, prior_prob):
self.kb = kb
self.entity_hash = entity_hash
self.entity_freq = entity_freq
self.entity_vector = entity_vector
self.alias_hash = alias_hash
self.prior_prob = prior_prob
@property
def entity(self):
"""RETURNS (uint64): hash of the entity's KB ID/name"""
return self.entity_hash
@property
def entity_(self):
"""RETURNS (str): ID/name of this entity in the KB"""
return self.kb.vocab.strings[self.entity_hash]
@property
def alias(self):
"""RETURNS (uint64): hash of the alias"""
return self.alias_hash
@property
def alias_(self):
"""RETURNS (str): ID of the original alias"""
return self.kb.vocab.strings[self.alias_hash]
@property
def entity_freq(self):
return self.entity_freq
@property
def entity_vector(self):
return self.entity_vector
@property
def prior_prob(self):
return self.prior_prob
from ..tokens import Span
from ..typedefs cimport hash_t
from ..errors import Errors, Warnings
from .. import util
from ..util import SimpleFrozenList, ensure_path
from ..vocab cimport Vocab
from .kb cimport KnowledgeBase
from .candidate import Candidate as Candidate
def get_candidates(KnowledgeBase kb, span) -> Iterator[Candidate]:
"""
Return candidate entities for a given span by using the text of the span as the alias
and fetching appropriate entries from the index.
This particular function is optimized to work with the built-in KB functionality,
but any other custom candidate generation method can be used in combination with the KB as well.
"""
return kb.get_alias_candidates(span.text)
cdef class KnowledgeBase:
"""A `KnowledgeBase` instance stores unique identifiers for entities and their textual aliases,
cdef class InMemoryLookupKB(KnowledgeBase):
"""An `InMemoryLookupKB` instance stores unique identifiers for entities and their textual aliases,
to support entity linking of named entities to real-world concepts.
DOCS: https://spacy.io/api/kb
DOCS: https://spacy.io/api/kb_in_memory
"""
def __init__(self, Vocab vocab, entity_vector_length):
"""Create a KnowledgeBase."""
self.mem = Pool()
self.entity_vector_length = entity_vector_length
"""Create an InMemoryLookupKB."""
super().__init__(vocab, entity_vector_length)
self._entry_index = PreshMap()
self._alias_index = PreshMap()
self.vocab = vocab
self._create_empty_vectors(dummy_hash=self.vocab.strings[""])
def _initialize_entities(self, int64_t nr_entities):
@ -104,11 +46,6 @@ cdef class KnowledgeBase:
self._alias_index = PreshMap(nr_aliases + 1)
self._aliases_table = alias_vec(nr_aliases + 1)
@property
def entity_vector_length(self):
"""RETURNS (uint64): length of the entity vectors"""
return self.entity_vector_length
def __len__(self):
return self.get_size_entities()
@ -286,7 +223,10 @@ cdef class KnowledgeBase:
alias_entry.probs = probs
self._aliases_table[alias_index] = alias_entry
def get_alias_candidates(self, str alias) -> Iterator[Candidate]:
def get_candidates(self, mention: Span) -> Iterable[Candidate]:
return self.get_alias_candidates(mention.text) # type: ignore
def get_alias_candidates(self, str alias) -> Iterable[Candidate]:
"""
Return candidate entities for an alias. Each candidate defines the entity, the original alias,
and the prior probability of that alias resolving to that entity.

2
spacy/lang/char_classes.py
View File

@ -280,7 +280,7 @@ _currency = (
_punct = (
r"… …… , : ; \! \? ¿ ؟ ¡ \( \) \[ \] \{ \} < > _ # \* & 。 ？ ！ ， 、 ； ： ～ · । ، ۔ ؛ ٪"
)
_quotes = r'\' " ” “ ` ‘ ´ ’ ‚ , „ » « 「 」 『 』 （ ） 〔 〕 【 】 《 》 〈 〉'
_quotes = r'\' " ” “ ` ‘ ´ ’ ‚ , „ » « 「 」 『 』 （ ） 〔 〕 【 】 《 》 〈 〉 〈 〉 ⟦ ⟧'
_hyphens = "- – — -- --- —— ~"
# Various symbols like dingbats, but also emoji

4
spacy/lang/grc/__init__.py
View File

@ -1,11 +1,15 @@
from .tokenizer_exceptions import TOKENIZER_EXCEPTIONS
from .stop_words import STOP_WORDS
from .lex_attrs import LEX_ATTRS
from .punctuation import TOKENIZER_PREFIXES, TOKENIZER_SUFFIXES, TOKENIZER_INFIXES
from ...language import Language, BaseDefaults
class AncientGreekDefaults(BaseDefaults):
tokenizer_exceptions = TOKENIZER_EXCEPTIONS
prefixes = TOKENIZER_PREFIXES
suffixes = TOKENIZER_SUFFIXES
infixes = TOKENIZER_INFIXES
lex_attr_getters = LEX_ATTRS
stop_words = STOP_WORDS

46
spacy/lang/grc/punctuation.py Normal file
View File

@ -0,0 +1,46 @@
from ..char_classes import LIST_PUNCT, LIST_ELLIPSES, LIST_QUOTES, LIST_CURRENCY
from ..char_classes import LIST_ICONS, ALPHA_LOWER, ALPHA_UPPER, ALPHA, HYPHENS
from ..char_classes import CONCAT_QUOTES
_prefixes = (
[
"†",
"⸏",
]
+ LIST_PUNCT
+ LIST_ELLIPSES
+ LIST_QUOTES
+ LIST_CURRENCY
+ LIST_ICONS
)
_suffixes = (
LIST_PUNCT
+ LIST_ELLIPSES
+ LIST_QUOTES
+ LIST_ICONS
+ [
"†",
"⸎",
r"(?<=[\u1F00-\u1FFF\u0370-\u03FF])[\-\.⸏]",
]
)
_infixes = (
LIST_ELLIPSES
+ LIST_ICONS
+ [
r"(?<=[0-9])[+\-\*^](?=[0-9-])",
r"(?<=[{al}{q}])\.(?=[{au}{q}])".format(
al=ALPHA_LOWER, au=ALPHA_UPPER, q=CONCAT_QUOTES
),
r"(?<=[{a}]),(?=[{a}])".format(a=ALPHA),
r"(?<=[{a}0-9])(?:{h})(?=[{a}])".format(a=ALPHA, h=HYPHENS),
r"(?<=[{a}0-9])[:<>=/](?=[{a}])".format(a=ALPHA),
r"(?<=[\u1F00-\u1FFF\u0370-\u03FF])—",
]
)
TOKENIZER_PREFIXES = _prefixes
TOKENIZER_SUFFIXES = _suffixes
TOKENIZER_INFIXES = _infixes

2
spacy/lang/nl/stop_words.py
View File

@ -15,7 +15,7 @@
STOP_WORDS = set(
"""
aan af al alle alles allebei alleen allen als altijd ander anders andere anderen aangaangde aangezien achter achterna
aan af al alle alles allebei alleen allen als altijd ander anders andere anderen aangaande aangezien achter achterna
afgelopen aldus alhoewel anderzijds
ben bij bijna bijvoorbeeld behalve beide beiden beneden bent bepaald beter betere betreffende binnen binnenin boven

53
spacy/lang/ru/lemmatizer.py
View File

@ -23,39 +23,44 @@ class RussianLemmatizer(Lemmatizer):
overwrite: bool = False,
scorer: Optional[Callable] = lemmatizer_score,
) -> None:
if mode == "pymorphy2":
if mode in {"pymorphy2", "pymorphy2_lookup"}:
try:
from pymorphy2 import MorphAnalyzer
except ImportError:
raise ImportError(
"The Russian lemmatizer mode 'pymorphy2' requires the "
"pymorphy2 library. Install it with: pip install pymorphy2"
"The lemmatizer mode 'pymorphy2' requires the "
"pymorphy2 library and dictionaries. Install them with: "
"pip install pymorphy2"
"# for Ukrainian dictionaries:"
"pip install pymorphy2-dicts-uk"
) from None
if getattr(self, "_morph", None) is None:
self._morph = MorphAnalyzer()
elif mode == "pymorphy3":
self._morph = MorphAnalyzer(lang="ru")
elif mode in {"pymorphy3", "pymorphy3_lookup"}:
try:
from pymorphy3 import MorphAnalyzer
except ImportError:
raise ImportError(
"The Russian lemmatizer mode 'pymorphy3' requires the "
"pymorphy3 library. Install it with: pip install pymorphy3"
"The lemmatizer mode 'pymorphy3' requires the "
"pymorphy3 library and dictionaries. Install them with: "
"pip install pymorphy3"
"# for Ukrainian dictionaries:"
"pip install pymorphy3-dicts-uk"
) from None
if getattr(self, "_morph", None) is None:
self._morph = MorphAnalyzer()
self._morph = MorphAnalyzer(lang="ru")
super().__init__(
vocab, model, name, mode=mode, overwrite=overwrite, scorer=scorer
)
def pymorphy2_lemmatize(self, token: Token) -> List[str]:
def _pymorphy_lemmatize(self, token: Token) -> List[str]:
string = token.text
univ_pos = token.pos_
morphology = token.morph.to_dict()
if univ_pos == "PUNCT":
return [PUNCT_RULES.get(string, string)]
if univ_pos not in ("ADJ", "DET", "NOUN", "NUM", "PRON", "PROPN", "VERB"):
# Skip unchangeable pos
return [string.lower()]
return self._pymorphy_lookup_lemmatize(token)
analyses = self._morph.parse(string)
filtered_analyses = []
for analysis in analyses:
@ -63,8 +68,10 @@ class RussianLemmatizer(Lemmatizer):
# Skip suggested parse variant for unknown word for pymorphy
continue
analysis_pos, _ = oc2ud(str(analysis.tag))
if analysis_pos == univ_pos or (
analysis_pos in ("NOUN", "PROPN") and univ_pos in ("NOUN", "PROPN")
if (
analysis_pos == univ_pos
or (analysis_pos in ("NOUN", "PROPN") and univ_pos in ("NOUN", "PROPN"))
or ((analysis_pos == "PRON") and (univ_pos == "DET"))
):
filtered_analyses.append(analysis)
if not len(filtered_analyses):
@ -107,15 +114,27 @@ class RussianLemmatizer(Lemmatizer):
dict.fromkeys([analysis.normal_form for analysis in filtered_analyses])
)
def pymorphy2_lookup_lemmatize(self, token: Token) -> List[str]:
def _pymorphy_lookup_lemmatize(self, token: Token) -> List[str]:
string = token.text
analyses = self._morph.parse(string)
if len(analyses) == 1:
return [analyses[0].normal_form]
# often multiple forms would derive from the same normal form
# thus check _unique_ normal forms
normal_forms = set([an.normal_form for an in analyses])
if len(normal_forms) == 1:
return [next(iter(normal_forms))]
return [string]
def pymorphy2_lemmatize(self, token: Token) -> List[str]:
return self._pymorphy_lemmatize(token)
def pymorphy2_lookup_lemmatize(self, token: Token) -> List[str]:
return self._pymorphy_lookup_lemmatize(token)
def pymorphy3_lemmatize(self, token: Token) -> List[str]:
return self.pymorphy2_lemmatize(token)
return self._pymorphy_lemmatize(token)
def pymorphy3_lookup_lemmatize(self, token: Token) -> List[str]:
return self._pymorphy_lookup_lemmatize(token)
def oc2ud(oc_tag: str) -> Tuple[str, Dict[str, str]]:

18
spacy/lang/ru/tokenizer_exceptions.py
View File

@ -61,6 +61,11 @@ for abbr in [
{ORTH: "2к23", NORM: "2023"},
{ORTH: "2к24", NORM: "2024"},
{ORTH: "2к25", NORM: "2025"},
{ORTH: "2к26", NORM: "2026"},
{ORTH: "2к27", NORM: "2027"},
{ORTH: "2к28", NORM: "2028"},
{ORTH: "2к29", NORM: "2029"},
{ORTH: "2к30", NORM: "2030"},
]:
_exc[abbr[ORTH]] = [abbr]
@ -268,8 +273,8 @@ for abbr in [
{ORTH: "з-ка", NORM: "заимка"},
{ORTH: "п-к", NORM: "починок"},
{ORTH: "киш.", NORM: "кишлак"},
{ORTH: "п. ст. ", NORM: "поселок станция"},
{ORTH: "п. ж/д ст. ", NORM: "поселок при железнодорожной станции"},
{ORTH: "п. ст.", NORM: "поселок станция"},
{ORTH: "п. ж/д ст.", NORM: "поселок при железнодорожной станции"},
{ORTH: "ж/д бл-ст", NORM: "железнодорожный блокпост"},
{ORTH: "ж/д б-ка", NORM: "железнодорожная будка"},
{ORTH: "ж/д в-ка", NORM: "железнодорожная ветка"},
@ -280,12 +285,12 @@ for abbr in [
{ORTH: "ж/д п.п.", NORM: "железнодорожный путевой пост"},
{ORTH: "ж/д о.п.", NORM: "железнодорожный остановочный пункт"},
{ORTH: "ж/д рзд.", NORM: "железнодорожный разъезд"},
{ORTH: "ж/д ст. ", NORM: "железнодорожная станция"},
{ORTH: "ж/д ст.", NORM: "железнодорожная станция"},
{ORTH: "м-ко", NORM: "местечко"},
{ORTH: "д.", NORM: "деревня"},
{ORTH: "с.", NORM: "село"},
{ORTH: "сл.", NORM: "слобода"},
{ORTH: "ст. ", NORM: "станция"},
{ORTH: "ст.", NORM: "станция"},
{ORTH: "ст-ца", NORM: "станица"},
{ORTH: "у.", NORM: "улус"},
{ORTH: "х.", NORM: "хутор"},
@ -388,8 +393,9 @@ for abbr in [
{ORTH: "прим.", NORM: "примечание"},
{ORTH: "прим.ред.", NORM: "примечание редакции"},
{ORTH: "см. также", NORM: "смотри также"},
{ORTH: "кв.м.", NORM: "квадрантный метр"},
{ORTH: "м2", NORM: "квадрантный метр"},
{ORTH: "см.", NORM: "смотри"},
{ORTH: "кв.м.", NORM: "квадратный метр"},
{ORTH: "м2", NORM: "квадратный метр"},
{ORTH: "б/у", NORM: "бывший в употреблении"},
{ORTH: "сокр.", NORM: "сокращение"},
{ORTH: "чел.", NORM: "человек"},

4
spacy/lang/uk/lemmatizer.py
View File

@ -18,7 +18,7 @@ class UkrainianLemmatizer(RussianLemmatizer):
overwrite: bool = False,
scorer: Optional[Callable] = lemmatizer_score,
) -> None:
if mode == "pymorphy2":
if mode in {"pymorphy2", "pymorphy2_lookup"}:
try:
from pymorphy2 import MorphAnalyzer
except ImportError:
@ -29,7 +29,7 @@ class UkrainianLemmatizer(RussianLemmatizer):
) from None
if getattr(self, "_morph", None) is None:
self._morph = MorphAnalyzer(lang="uk")
elif mode == "pymorphy3":
elif mode in {"pymorphy3", "pymorphy3_lookup"}:
try:
from pymorphy3 import MorphAnalyzer
except ImportError:

140
spacy/language.py
View File

@ -1,4 +1,4 @@
from typing import Iterator, Optional, Any, Dict, Callable, Iterable, Collection
from typing import Iterator, Optional, Any, Dict, Callable, Iterable
from typing import Union, Tuple, List, Set, Pattern, Sequence
from typing import NoReturn, TYPE_CHECKING, TypeVar, cast, overload
@ -10,6 +10,7 @@ from contextlib import contextmanager
from copy import deepcopy
from pathlib import Path
import warnings
from thinc.api import get_current_ops, Config, CupyOps, Optimizer
import srsly
import multiprocessing as mp
@ -24,7 +25,7 @@ from .pipe_analysis import validate_attrs, analyze_pipes, print_pipe_analysis
from .training import Example, validate_examples
from .training.initialize import init_vocab, init_tok2vec
from .scorer import Scorer
from .util import registry, SimpleFrozenList, _pipe, raise_error
from .util import registry, SimpleFrozenList, _pipe, raise_error, _DEFAULT_EMPTY_PIPES
from .util import SimpleFrozenDict, combine_score_weights, CONFIG_SECTION_ORDER
from .util import warn_if_jupyter_cupy
from .lang.tokenizer_exceptions import URL_MATCH, BASE_EXCEPTIONS
@ -42,8 +43,7 @@ from .lookups import load_lookups
from .compat import Literal
if TYPE_CHECKING:
from .pipeline import Pipe # noqa: F401
PipeCallable = Callable[[Doc], Doc]
# This is the base config will all settings (training etc.)
@ -180,7 +180,7 @@ class Language:
self.vocab: Vocab = vocab
if self.lang is None:
self.lang = self.vocab.lang
self._components: List[Tuple[str, "Pipe"]] = []
self._components: List[Tuple[str, PipeCallable]] = []
self._disabled: Set[str] = set()
self.max_length = max_length
# Create the default tokenizer from the default config
@ -302,7 +302,7 @@ class Language:
return SimpleFrozenList(names)
@property
def components(self) -> List[Tuple[str, "Pipe"]]:
def components(self) -> List[Tuple[str, PipeCallable]]:
"""Get all (name, component) tuples in the pipeline, including the
currently disabled components.
"""
@ -321,12 +321,12 @@ class Language:
return SimpleFrozenList(names, error=Errors.E926.format(attr="component_names"))
@property
def pipeline(self) -> List[Tuple[str, "Pipe"]]:
def pipeline(self) -> List[Tuple[str, PipeCallable]]:
"""The processing pipeline consisting of (name, component) tuples. The
components are called on the Doc in order as it passes through the
pipeline.
RETURNS (List[Tuple[str, Pipe]]): The pipeline.
RETURNS (List[Tuple[str, Callable[[Doc], Doc]]]): The pipeline.
"""
pipes = [(n, p) for n, p in self._components if n not in self._disabled]
return SimpleFrozenList(pipes, error=Errors.E926.format(attr="pipeline"))
@ -526,7 +526,7 @@ class Language:
assigns: Iterable[str] = SimpleFrozenList(),
requires: Iterable[str] = SimpleFrozenList(),
retokenizes: bool = False,
func: Optional["Pipe"] = None,
func: Optional[PipeCallable] = None,
) -> Callable[..., Any]:
"""Register a new pipeline component. Can be used for stateless function
components that don't require a separate factory. Can be used as a
@ -541,7 +541,7 @@ class Language:
e.g. "token.ent_id". Used for pipeline analysis.
retokenizes (bool): Whether the component changes the tokenization.
Used for pipeline analysis.
func (Optional[Callable]): Factory function if not used as a decorator.
func (Optional[Callable[[Doc], Doc]): Factory function if not used as a decorator.
DOCS: https://spacy.io/api/language#component
"""
@ -552,11 +552,11 @@ class Language:
raise ValueError(Errors.E853.format(name=name))
component_name = name if name is not None else util.get_object_name(func)
def add_component(component_func: "Pipe") -> Callable:
def add_component(component_func: PipeCallable) -> Callable:
if isinstance(func, type): # function is a class
raise ValueError(Errors.E965.format(name=component_name))
def factory_func(nlp, name: str) -> "Pipe":
def factory_func(nlp, name: str) -> PipeCallable:
return component_func
internal_name = cls.get_factory_name(name)
@ -606,7 +606,7 @@ class Language:
print_pipe_analysis(analysis, keys=keys)
return analysis
def get_pipe(self, name: str) -> "Pipe":
def get_pipe(self, name: str) -> PipeCallable:
"""Get a pipeline component for a given component name.
name (str): Name of pipeline component to get.
@ -627,7 +627,7 @@ class Language:
config: Dict[str, Any] = SimpleFrozenDict(),
raw_config: Optional[Config] = None,
validate: bool = True,
) -> "Pipe":
) -> PipeCallable:
"""Create a pipeline component. Mostly used internally. To create and
add a component to the pipeline, you can use nlp.add_pipe.
@ -639,7 +639,7 @@ class Language:
raw_config (Optional[Config]): Internals: the non-interpolated config.
validate (bool): Whether to validate the component config against the
arguments and types expected by the factory.
RETURNS (Pipe): The pipeline component.
RETURNS (Callable[[Doc], Doc]): The pipeline component.
DOCS: https://spacy.io/api/language#create_pipe
"""
@ -694,24 +694,18 @@ class Language:
def create_pipe_from_source(
self, source_name: str, source: "Language", *, name: str
) -> Tuple["Pipe", str]:
) -> Tuple[PipeCallable, str]:
"""Create a pipeline component by copying it from an existing model.
source_name (str): Name of the component in the source pipeline.
source (Language): The source nlp object to copy from.
name (str): Optional alternative name to use in current pipeline.
RETURNS (Tuple[Callable, str]): The component and its factory name.
RETURNS (Tuple[Callable[[Doc], Doc], str]): The component and its factory name.
"""
# Check source type
if not isinstance(source, Language):
raise ValueError(Errors.E945.format(name=source_name, source=type(source)))
# Check vectors, with faster checks first
if (
self.vocab.vectors.shape != source.vocab.vectors.shape
or self.vocab.vectors.key2row != source.vocab.vectors.key2row
or self.vocab.vectors.to_bytes(exclude=["strings"])
!= source.vocab.vectors.to_bytes(exclude=["strings"])
):
if self.vocab.vectors != source.vocab.vectors:
warnings.warn(Warnings.W113.format(name=source_name))
if source_name not in source.component_names:
raise KeyError(
@ -745,7 +739,7 @@ class Language:
config: Dict[str, Any] = SimpleFrozenDict(),
raw_config: Optional[Config] = None,
validate: bool = True,
) -> "Pipe":
) -> PipeCallable:
"""Add a component to the processing pipeline. Valid components are
callables that take a `Doc` object, modify it and return it. Only one
of before/after/first/last can be set. Default behaviour is "last".
@ -768,7 +762,7 @@ class Language:
raw_config (Optional[Config]): Internals: the non-interpolated config.
validate (bool): Whether to validate the component config against the
arguments and types expected by the factory.
RETURNS (Pipe): The pipeline component.
RETURNS (Callable[[Doc], Doc]): The pipeline component.
DOCS: https://spacy.io/api/language#add_pipe
"""
@ -789,14 +783,6 @@ class Language:
factory_name, source, name=name
)
else:
if not self.has_factory(factory_name):
err = Errors.E002.format(
name=factory_name,
opts=", ".join(self.factory_names),
method="add_pipe",
lang=util.get_object_name(self),
lang_code=self.lang,
)
pipe_component = self.create_pipe(
factory_name,
name=name,
@ -882,7 +868,7 @@ class Language:
*,
config: Dict[str, Any] = SimpleFrozenDict(),
validate: bool = True,
) -> "Pipe":
) -> PipeCallable:
"""Replace a component in the pipeline.
name (str): Name of the component to replace.
@ -891,7 +877,7 @@ class Language:
component. Will be merged with default config, if available.
validate (bool): Whether to validate the component config against the
arguments and types expected by the factory.
RETURNS (Pipe): The new pipeline component.
RETURNS (Callable[[Doc], Doc]): The new pipeline component.
DOCS: https://spacy.io/api/language#replace_pipe
"""
@ -943,11 +929,11 @@ class Language:
init_cfg = self._config["initialize"]["components"].pop(old_name)
self._config["initialize"]["components"][new_name] = init_cfg
def remove_pipe(self, name: str) -> Tuple[str, "Pipe"]:
def remove_pipe(self, name: str) -> Tuple[str, PipeCallable]:
"""Remove a component from the pipeline.
name (str): Name of the component to remove.
RETURNS (tuple): A `(name, component)` tuple of the removed component.
RETURNS (Tuple[str, Callable[[Doc], Doc]]): A `(name, component)` tuple of the removed component.
DOCS: https://spacy.io/api/language#remove_pipe
"""
@ -1253,15 +1239,6 @@ class Language:
sgd(key, W, dW) # type: ignore[call-arg, misc]
return losses
def begin_training(
self,
get_examples: Optional[Callable[[], Iterable[Example]]] = None,
*,
sgd: Optional[Optimizer] = None,
) -> Optimizer:
warnings.warn(Warnings.W089, DeprecationWarning)
return self.initialize(get_examples, sgd=sgd)
def initialize(
self,
get_examples: Optional[Callable[[], Iterable[Example]]] = None,
@ -1362,15 +1339,15 @@ class Language:
def set_error_handler(
self,
error_handler: Callable[[str, "Pipe", List[Doc], Exception], NoReturn],
error_handler: Callable[[str, PipeCallable, List[Doc], Exception], NoReturn],
):
"""Set an error handler object for all the components in the pipeline that implement
a set_error_handler function.
"""Set an error handler object for all the components in the pipeline
that implement a set_error_handler function.
error_handler (Callable[[str, Pipe, List[Doc], Exception], NoReturn]):
Function that deals with a failing batch of documents. This callable function should take in
the component's name, the component itself, the offending batch of documents, and the exception
that was thrown.
error_handler (Callable[[str, Callable[[Doc], Doc], List[Doc], Exception], NoReturn]):
Function that deals with a failing batch of documents. This callable
function should take in the component's name, the component itself,
the offending batch of documents, and the exception that was thrown.
DOCS: https://spacy.io/api/language#set_error_handler
"""
self.default_error_handler = error_handler
@ -1698,9 +1675,9 @@ class Language:
config: Union[Dict[str, Any], Config] = {},
*,
vocab: Union[Vocab, bool] = True,
disable: Union[str, Iterable[str]] = SimpleFrozenList(),
enable: Union[str, Iterable[str]] = SimpleFrozenList(),
exclude: Union[str, Iterable[str]] = SimpleFrozenList(),
disable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
enable: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
exclude: Union[str, Iterable[str]] = _DEFAULT_EMPTY_PIPES,
meta: Dict[str, Any] = SimpleFrozenDict(),
auto_fill: bool = True,
validate: bool = True,
@ -1727,12 +1704,6 @@ class Language:
DOCS: https://spacy.io/api/language#from_config
"""
if isinstance(disable, str):
disable = [disable]
if isinstance(enable, str):
enable = [enable]
if isinstance(exclude, str):
exclude = [exclude]
if auto_fill:
config = Config(
cls.default_config, section_order=CONFIG_SECTION_ORDER
@ -1877,9 +1848,29 @@ class Language:
nlp.vocab.from_bytes(vocab_b)
# Resolve disabled/enabled settings.
if isinstance(disable, str):
disable = [disable]
if isinstance(enable, str):
enable = [enable]
if isinstance(exclude, str):
exclude = [exclude]
# `enable` should not be merged with `enabled` (the opposite is true for `disable`/`disabled`). If the config
# specifies values for `enabled` not included in `enable`, emit warning.
if id(enable) != id(_DEFAULT_EMPTY_PIPES):
enabled = config["nlp"].get("enabled", [])
if len(enabled) and not set(enabled).issubset(enable):
warnings.warn(
Warnings.W123.format(
enable=enable,
enabled=enabled,
)
)
# Ensure sets of disabled/enabled pipe names are not contradictory.
disabled_pipes = cls._resolve_component_status(
[*config["nlp"]["disabled"], *disable],
[*config["nlp"].get("enabled", []), *enable],
list({*disable, *config["nlp"].get("disabled", [])}),
enable,
config["nlp"]["pipeline"],
)
nlp._disabled = set(p for p in disabled_pipes if p not in exclude)
@ -2060,18 +2051,13 @@ class Language:
if enable:
if isinstance(enable, str):
enable = [enable]
to_disable = [
pipe_name for pipe_name in pipe_names if pipe_name not in enable
]
if disable and disable != to_disable:
raise ValueError(
Errors.E1042.format(
arg1="enable",
arg2="disable",
arg1_values=enable,
arg2_values=disable,
)
)
to_disable = {
*[pipe_name for pipe_name in pipe_names if pipe_name not in enable],
*disable,
}
# If any pipe to be enabled is in to_disable, the specification is inconsistent.
if len(set(enable) & to_disable):
raise ValueError(Errors.E1042.format(enable=enable, disable=disable))
return tuple(to_disable)

1
spacy/lexeme.pxd
View File

@ -5,7 +5,6 @@ from .attrs cimport attr_id_t
from .attrs cimport ID, ORTH, LOWER, NORM, SHAPE, PREFIX, SUFFIX, LENGTH, LANG
from .structs cimport LexemeC
from .strings cimport StringStore
from .vocab cimport Vocab

1
spacy/lexeme.pyi
View File

@ -20,7 +20,6 @@ class Lexeme:
def vector_norm(self) -> float: ...
vector: Floats1d
rank: int
sentiment: float
@property
def orth_(self) -> str: ...
@property

13
spacy/lexeme.pyx
View File

@ -173,19 +173,6 @@ cdef class Lexeme:
def __set__(self, value):
self.c.id = value
property sentiment:
"""RETURNS (float): A scalar value indicating the positivity or
negativity of the lexeme."""
def __get__(self):
sentiment_table = self.vocab.lookups.get_table("lexeme_sentiment", {})
return sentiment_table.get(self.c.orth, 0.0)
def __set__(self, float x):
if "lexeme_sentiment" not in self.vocab.lookups:
self.vocab.lookups.add_table("lexeme_sentiment")
sentiment_table = self.vocab.lookups.get_table("lexeme_sentiment")
sentiment_table[self.c.orth] = x
@property
def orth_(self):
"""RETURNS (str): The original verbatim text of the lexeme

3
spacy/matcher/__init__.py
View File

@ -1,5 +1,6 @@
from .matcher import Matcher
from .phrasematcher import PhraseMatcher
from .dependencymatcher import DependencyMatcher
from .levenshtein import levenshtein
__all__ = ["Matcher", "PhraseMatcher", "DependencyMatcher"]
__all__ = ["Matcher", "PhraseMatcher", "DependencyMatcher", "levenshtein"]

15
spacy/matcher/levenshtein.pyx Normal file
View File

@ -0,0 +1,15 @@
# cython: profile=True, binding=True, infer_types=True
from cpython.object cimport PyObject
from libc.stdint cimport int64_t
from typing import Optional
cdef extern from "polyleven.c":
int64_t polyleven(PyObject *o1, PyObject *o2, int64_t k)
cpdef int64_t levenshtein(a: str, b: str, k: Optional[int] = None):
if k is None:
k = -1
return polyleven(<PyObject*>a, <PyObject*>b, k)

4
spacy/matcher/matcher.pyx
View File

@ -1,4 +1,4 @@
# cython: infer_types=True, cython: profile=True
# cython: infer_types=True, profile=True
from typing import List, Iterable
from libcpp.vector cimport vector
@ -22,7 +22,7 @@ from ..attrs cimport ID, attr_id_t, NULL_ATTR, ORTH, POS, TAG, DEP, LEMMA, MORPH
from ..schemas import validate_token_pattern
from ..errors import Errors, MatchPatternError, Warnings
from ..strings import get_string_id
from ..strings cimport get_string_id
from ..attrs import IDS

384
spacy/matcher/polyleven.c Normal file
View File

@ -0,0 +1,384 @@
/*
* Adapted from Polyleven (https://ceptord.net/)
*
* Source: https://github.com/fujimotos/polyleven/blob/c3f95a080626c5652f0151a2e449963288ccae84/polyleven.c
*
* Copyright (c) 2021 Fujimoto Seiji <fujimoto@ceptord.net>
* Copyright (c) 2021 Max Bachmann <kontakt@maxbachmann.de>
* Copyright (c) 2022 Nick Mazuk
* Copyright (c) 2022 Michael Weiss <code@mweiss.ch>
*
* Permission is hereby granted, free of charge, to any person obtaining a copy
* of this software and associated documentation files (the "Software"), to deal
* in the Software without restriction, including without limitation the rights
* to use, copy, modify, merge, publish, distribute, sublicense, and/or sell
* copies of the Software, and to permit persons to whom the Software is
* furnished to do so, subject to the following conditions:
*
* The above copyright notice and this permission notice shall be included in all
* copies or substantial portions of the Software.
*
* THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR
* IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY,
* FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE
* AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER
* LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM,
* OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE
* SOFTWARE.
*/
#include <Python.h>
#include <stdint.h>
#define MIN(a,b) ((a) < (b) ? (a) : (b))
#define MAX(a,b) ((a) > (b) ? (a) : (b))
#define CDIV(a,b) ((a) / (b) + ((a) % (b) > 0))
#define BIT(i,n) (((i) >> (n)) & 1)
#define FLIP(i,n) ((i) ^ ((uint64_t) 1 << (n)))
#define ISASCII(kd) ((kd) == PyUnicode_1BYTE_KIND)
/*
* Bare bone of PyUnicode
*/
struct strbuf {
void *ptr;
int kind;
int64_t len;
};
static void strbuf_init(struct strbuf *s, PyObject *o)
{
s->ptr = PyUnicode_DATA(o);
s->kind = PyUnicode_KIND(o);
s->len = PyUnicode_GET_LENGTH(o);
}
#define strbuf_read(s, i) PyUnicode_READ((s)->kind, (s)->ptr, (i))
/*
* An encoded mbleven model table.
*
* Each 8-bit integer represents an edit sequence, with using two
* bits for a single operation.
*
* 01 = DELETE, 10 = INSERT, 11 = REPLACE
*
* For example, 13 is '1101' in binary notation, so it means
* DELETE + REPLACE.
*/
static const uint8_t MBLEVEN_MATRIX[] = {
3, 0, 0, 0, 0, 0, 0, 0,
1, 0, 0, 0, 0, 0, 0, 0,
15, 9, 6, 0, 0, 0, 0, 0,
13, 7, 0, 0, 0, 0, 0, 0,
5, 0, 0, 0, 0, 0, 0, 0,
63, 39, 45, 57, 54, 30, 27, 0,
61, 55, 31, 37, 25, 22, 0, 0,
53, 29, 23, 0, 0, 0, 0, 0,
21, 0, 0, 0, 0, 0, 0, 0,
};
#define MBLEVEN_MATRIX_GET(k, d) ((((k) + (k) * (k)) / 2 - 1) + (d)) * 8
static int64_t mbleven_ascii(char *s1, int64_t len1,
char *s2, int64_t len2, int k)
{
int pos;
uint8_t m;
int64_t i, j, c, r;
pos = MBLEVEN_MATRIX_GET(k, len1 - len2);
r = k + 1;
while (MBLEVEN_MATRIX[pos]) {
m = MBLEVEN_MATRIX[pos++];
i = j = c = 0;
while (i < len1 && j < len2) {
if (s1[i] != s2[j]) {
c++;
if (!m) break;
if (m & 1) i++;
if (m & 2) j++;
m >>= 2;
} else {
i++;
j++;
}
}
c += (len1 - i) + (len2 - j);
r = MIN(r, c);
if (r < 2) {
return r;
}
}
return r;
}
static int64_t mbleven(PyObject *o1, PyObject *o2, int64_t k)
{
int pos;
uint8_t m;
int64_t i, j, c, r;
struct strbuf s1, s2;
strbuf_init(&s1, o1);
strbuf_init(&s2, o2);
if (s1.len < s2.len)
return mbleven(o2, o1, k);
if (k > 3)
return -1;
if (k < s1.len - s2.len)
return k + 1;
if (ISASCII(s1.kind) && ISASCII(s2.kind))
return mbleven_ascii(s1.ptr, s1.len, s2.ptr, s2.len, k);
pos = MBLEVEN_MATRIX_GET(k, s1.len - s2.len);
r = k + 1;
while (MBLEVEN_MATRIX[pos]) {
m = MBLEVEN_MATRIX[pos++];
i = j = c = 0;
while (i < s1.len && j < s2.len) {
if (strbuf_read(&s1, i) != strbuf_read(&s2, j)) {
c++;
if (!m) break;
if (m & 1) i++;
if (m & 2) j++;
m >>= 2;
} else {
i++;
j++;
}
}
c += (s1.len - i) + (s2.len - j);
r = MIN(r, c);
if (r < 2) {
return r;
}
}
return r;
}
/*
* Data structure to store Peq (equality bit-vector).
*/
struct blockmap_entry {
uint32_t key[128];
uint64_t val[128];
};
struct blockmap {
int64_t nr;
struct blockmap_entry *list;
};
#define blockmap_key(c) ((c) | 0x80000000U)
#define blockmap_hash(c) ((c) % 128)
static int blockmap_init(struct blockmap *map, struct strbuf *s)
{
int64_t i;
struct blockmap_entry *be;
uint32_t c, k;
uint8_t h;
map->nr = CDIV(s->len, 64);
map->list = calloc(1, map->nr * sizeof(struct blockmap_entry));
if (map->list == NULL) {
PyErr_NoMemory();
return -1;
}
for (i = 0; i < s->len; i++) {
be = &(map->list[i / 64]);
c = strbuf_read(s, i);
h = blockmap_hash(c);
k = blockmap_key(c);
while (be->key[h] && be->key[h] != k)
h = blockmap_hash(h + 1);
be->key[h] = k;
be->val[h] |= (uint64_t) 1 << (i % 64);
}
return 0;
}
static void blockmap_clear(struct blockmap *map)
{
if (map->list)
free(map->list);
map->list = NULL;
map->nr = 0;
}
static uint64_t blockmap_get(struct blockmap *map, int block, uint32_t c)
{
struct blockmap_entry *be;
uint8_t h;
uint32_t k;
h = blockmap_hash(c);
k = blockmap_key(c);
be = &(map->list[block]);
while (be->key[h] && be->key[h] != k)
h = blockmap_hash(h + 1);
return be->key[h] == k ? be->val[h] : 0;
}
/*
* Myers' bit-parallel algorithm
*
* See: G. Myers. "A fast bit-vector algorithm for approximate string
* matching based on dynamic programming." Journal of the ACM, 1999.
*/
static int64_t myers1999_block(struct strbuf *s1, struct strbuf *s2,
struct blockmap *map)
{
uint64_t Eq, Xv, Xh, Ph, Mh, Pv, Mv, Last;
uint64_t *Mhc, *Phc;
int64_t i, b, hsize, vsize, Score;
uint8_t Pb, Mb;
hsize = CDIV(s1->len, 64);
vsize = CDIV(s2->len, 64);
Score = s2->len;
Phc = malloc(hsize * 2 * sizeof(uint64_t));
if (Phc == NULL) {
PyErr_NoMemory();
return -1;
}
Mhc = Phc + hsize;
memset(Phc, -1, hsize * sizeof(uint64_t));
memset(Mhc, 0, hsize * sizeof(uint64_t));
Last = (uint64_t)1 << ((s2->len - 1) % 64);
for (b = 0; b < vsize; b++) {
Mv = 0;
Pv = (uint64_t) -1;
Score = s2->len;
for (i = 0; i < s1->len; i++) {
Eq = blockmap_get(map, b, strbuf_read(s1, i));
Pb = BIT(Phc[i / 64], i % 64);
Mb = BIT(Mhc[i / 64], i % 64);
Xv = Eq | Mv;
Xh = ((((Eq | Mb) & Pv) + Pv) ^ Pv) | Eq | Mb;
Ph = Mv | ~ (Xh | Pv);
Mh = Pv & Xh;
if (Ph & Last) Score++;
if (Mh & Last) Score--;
if ((Ph >> 63) ^ Pb)
Phc[i / 64] = FLIP(Phc[i / 64], i % 64);
if ((Mh >> 63) ^ Mb)
Mhc[i / 64] = FLIP(Mhc[i / 64], i % 64);
Ph = (Ph << 1) | Pb;
Mh = (Mh << 1) | Mb;
Pv = Mh | ~ (Xv | Ph);
Mv = Ph & Xv;
}
}
free(Phc);
return Score;
}
static int64_t myers1999_simple(uint8_t *s1, int64_t len1, uint8_t *s2, int64_t len2)
{
uint64_t Peq[256];
uint64_t Eq, Xv, Xh, Ph, Mh, Pv, Mv, Last;
int64_t i;
int64_t Score = len2;
memset(Peq, 0, sizeof(Peq));
for (i = 0; i < len2; i++)
Peq[s2[i]] |= (uint64_t) 1 << i;
Mv = 0;
Pv = (uint64_t) -1;
Last = (uint64_t) 1 << (len2 - 1);
for (i = 0; i < len1; i++) {
Eq = Peq[s1[i]];
Xv = Eq | Mv;
Xh = (((Eq & Pv) + Pv) ^ Pv) | Eq;
Ph = Mv | ~ (Xh | Pv);
Mh = Pv & Xh;
if (Ph & Last) Score++;
if (Mh & Last) Score--;
Ph = (Ph << 1) | 1;
Mh = (Mh << 1);
Pv = Mh | ~ (Xv | Ph);
Mv = Ph & Xv;
}
return Score;
}
static int64_t myers1999(PyObject *o1, PyObject *o2)
{
struct strbuf s1, s2;
struct blockmap map;
int64_t ret;
strbuf_init(&s1, o1);
strbuf_init(&s2, o2);
if (s1.len < s2.len)
return myers1999(o2, o1);
if (ISASCII(s1.kind) && ISASCII(s2.kind) && s2.len < 65)
return myers1999_simple(s1.ptr, s1.len, s2.ptr, s2.len);
if (blockmap_init(&map, &s2))
return -1;
ret = myers1999_block(&s1, &s2, &map);
blockmap_clear(&map);
return ret;
}
/*
* Interface functions
*/
static int64_t polyleven(PyObject *o1, PyObject *o2, int64_t k)
{
int64_t len1, len2;
len1 = PyUnicode_GET_LENGTH(o1);
len2 = PyUnicode_GET_LENGTH(o2);
if (len1 < len2)
return polyleven(o2, o1, k);
if (k == 0)
return PyUnicode_Compare(o1, o2) ? 1 : 0;
if (0 < k && k < len1 - len2)
return k + 1;
if (len2 == 0)
return len1;
if (0 < k && k < 4)
return mbleven(o1, o2, k);
return myers1999(o1, o2);
}

7
spacy/ml/callbacks.py
View File

@ -89,11 +89,14 @@ def pipes_with_nvtx_range(
types.MethodType(nvtx_range_wrapper_for_pipe_method, pipe), func
)
# Try to preserve the original function signature.
# We need to preserve the original function signature so that
# the original parameters are passed to pydantic for validation downstream.
try:
wrapped_func.__signature__ = inspect.signature(func) # type: ignore
except:
pass
# Can fail for Cython methods that do not have bindings.
warnings.warn(Warnings.W122.format(method=name, pipe=pipe.name))
continue
try:
setattr(

37
spacy/ml/models/entity_linker.py
View File

@ -1,11 +1,12 @@
from pathlib import Path
from typing import Optional, Callable, Iterable, List, Tuple
from thinc.types import Floats2d
from thinc.api import chain, clone, list2ragged, reduce_mean, residual
from thinc.api import Model, Maxout, Linear, noop, tuplify, Ragged
from thinc.api import chain, list2ragged, reduce_mean, residual
from thinc.api import Model, Maxout, Linear, tuplify, Ragged
from ...util import registry
from ...kb import KnowledgeBase, Candidate, get_candidates
from ...kb import KnowledgeBase, InMemoryLookupKB
from ...kb import Candidate, get_candidates, get_candidates_batch
from ...vocab import Vocab
from ...tokens import Span, Doc
from ..extract_spans import extract_spans
@ -70,17 +71,18 @@ def span_maker_forward(model, docs: List[Doc], is_train) -> Tuple[Ragged, Callab
cands.append((start_token, end_token))
candidates.append(ops.asarray2i(cands))
candlens = ops.asarray1i([len(cands) for cands in candidates])
candidates = ops.xp.concatenate(candidates)
outputs = Ragged(candidates, candlens)
lengths = model.ops.asarray1i([len(cands) for cands in candidates])
out = Ragged(model.ops.flatten(candidates), lengths)
# because this is just rearranging docs, the backprop does nothing
return outputs, lambda x: []
return out, lambda x: []
@registry.misc("spacy.KBFromFile.v1")
def load_kb(kb_path: Path) -> Callable[[Vocab], KnowledgeBase]:
def kb_from_file(vocab):
kb = KnowledgeBase(vocab, entity_vector_length=1)
def load_kb(
kb_path: Path,
) -> Callable[[Vocab], KnowledgeBase]:
def kb_from_file(vocab: Vocab):
kb = InMemoryLookupKB(vocab, entity_vector_length=1)
kb.from_disk(kb_path)
return kb
@ -88,9 +90,11 @@ def load_kb(kb_path: Path) -> Callable[[Vocab], KnowledgeBase]:
@registry.misc("spacy.EmptyKB.v1")
def empty_kb(entity_vector_length: int) -> Callable[[Vocab], KnowledgeBase]:
def empty_kb_factory(vocab):
return KnowledgeBase(vocab=vocab, entity_vector_length=entity_vector_length)
def empty_kb(
entity_vector_length: int,
) -> Callable[[Vocab], KnowledgeBase]:
def empty_kb_factory(vocab: Vocab):
return InMemoryLookupKB(vocab=vocab, entity_vector_length=entity_vector_length)
return empty_kb_factory
@ -98,3 +102,10 @@ def empty_kb(entity_vector_length: int) -> Callable[[Vocab], KnowledgeBase]:
@registry.misc("spacy.CandidateGenerator.v1")
def create_candidates() -> Callable[[KnowledgeBase, Span], Iterable[Candidate]]:
return get_candidates
@registry.misc("spacy.CandidateBatchGenerator.v1")
def create_candidates_batch() -> Callable[
[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]
]:
return get_candidates_batch

2
spacy/ml/tb_framework.pyx
View File

@ -233,7 +233,7 @@ def _forward_greedy_cpu(model: Model, TransitionSystem moves, states: List[State
scores = _parse_batch(cblas, moves, &c_states[0], weights, sizes, actions=actions)
def backprop(dY):
raise ValueError(Errors.E4001)
raise ValueError(Errors.E4002)
return (states, scores), backprop

2
spacy/pipeline/__init__.py
View File

@ -3,7 +3,6 @@ from .dep_parser import DependencyParser
from .edit_tree_lemmatizer import EditTreeLemmatizer
from .entity_linker import EntityLinker
from .ner import EntityRecognizer
from .entity_ruler import EntityRuler
from .lemmatizer import Lemmatizer
from .morphologizer import Morphologizer
from .pipe import Pipe
@ -23,7 +22,6 @@ __all__ = [
"DependencyParser",
"EntityLinker",
"EntityRecognizer",
"EntityRuler",
"Morphologizer",
"Lemmatizer",
"MultiLabel_TextCategorizer",

16
spacy/pipeline/edit_tree_lemmatizer.py
View File

@ -1,13 +1,13 @@
from typing import cast, Any, Callable, Dict, Iterable, List, Optional
from typing import Sequence, Tuple, Union
from typing import cast, Any, Callable, Dict, Iterable, List, Optional, Union
from typing import Tuple
from collections import Counter
from copy import deepcopy
from itertools import islice
import numpy as np
import srsly
from thinc.api import Config, Model, SequenceCategoricalCrossentropy
from thinc.api import Config, Model
from thinc.types import ArrayXd, Floats2d, Ints1d
from thinc.legacy import LegacySequenceCategoricalCrossentropy
from ._edit_tree_internals.edit_trees import EditTrees
from ._edit_tree_internals.schemas import validate_edit_tree
@ -130,7 +130,9 @@ class EditTreeLemmatizer(TrainablePipe):
self, examples: Iterable[Example], scores: List[Floats2d]
) -> Tuple[float, List[Floats2d]]:
validate_examples(examples, "EditTreeLemmatizer.get_loss")
loss_func = SequenceCategoricalCrossentropy(normalize=False, missing_value=-1)
loss_func = LegacySequenceCategoricalCrossentropy(
normalize=False, missing_value=-1
)
truths = []
for eg in examples:
@ -348,9 +350,9 @@ class EditTreeLemmatizer(TrainablePipe):
tree = dict(tree)
if "orig" in tree:
tree["orig"] = self.vocab.strings[tree["orig"]]
tree["orig"] = self.vocab.strings.add(tree["orig"])
if "orig" in tree:
tree["subst"] = self.vocab.strings[tree["subst"]]
tree["subst"] = self.vocab.strings.add(tree["subst"])
trees.append(tree)

77
spacy/pipeline/entity_linker.py
View File

@ -60,9 +60,11 @@ DEFAULT_NEL_MODEL = Config().from_str(default_model_config)["model"]
"incl_context": True,
"entity_vector_length": 64,
"get_candidates": {"@misc": "spacy.CandidateGenerator.v1"},
"get_candidates_batch": {"@misc": "spacy.CandidateBatchGenerator.v1"},
"overwrite": True,
"scorer": {"@scorers": "spacy.entity_linker_scorer.v1"},
"use_gold_ents": True,
"candidates_batch_size": 1,
"threshold": None,
"save_activations": False,
},
@ -83,9 +85,13 @@ def make_entity_linker(
incl_context: bool,
entity_vector_length: int,
get_candidates: Callable[[KnowledgeBase, Span], Iterable[Candidate]],
get_candidates_batch: Callable[
[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]
],
overwrite: bool,
scorer: Optional[Callable],
use_gold_ents: bool,
candidates_batch_size: int,
threshold: Optional[float] = None,
save_activations: bool,
):
@ -99,18 +105,22 @@ def make_entity_linker(
incl_prior (bool): Whether or not to include prior probabilities from the KB in the model.
incl_context (bool): Whether or not to include the local context in the model.
entity_vector_length (int): Size of encoding vectors in the KB.
get_candidates (Callable[[KnowledgeBase, "Span"], Iterable[Candidate]]): Function that
get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that
produces a list of candidates, given a certain knowledge base and a textual mention.
get_candidates_batch (
Callable[[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]], Iterable[Candidate]]
): Function that produces a list of candidates, given a certain knowledge base and several textual mentions.
scorer (Optional[Callable]): The scoring method.
use_gold_ents (bool): Whether to copy entities from gold docs or not. If false, another
component must provide entity annotations.
candidates_batch_size (int): Size of batches for entity candidate generation.
threshold (Optional[float]): Confidence threshold for entity predictions. If confidence is below the threshold,
prediction is discarded. If None, predictions are not filtered by any threshold.
save_activations (bool): save model activations in Doc when annotating.
"""
if not model.attrs.get("include_span_maker", False):
# The only difference in arguments here is that use_gold_ents is not available
# The only difference in arguments here is that use_gold_ents and threshold aren't available.
return EntityLinker_v1(
nlp.vocab,
model,
@ -134,9 +144,11 @@ def make_entity_linker(
incl_context=incl_context,
entity_vector_length=entity_vector_length,
get_candidates=get_candidates,
get_candidates_batch=get_candidates_batch,
overwrite=overwrite,
scorer=scorer,
use_gold_ents=use_gold_ents,
candidates_batch_size=candidates_batch_size,
threshold=threshold,
save_activations=save_activations,
)
@ -171,9 +183,13 @@ class EntityLinker(TrainablePipe):
incl_context: bool,
entity_vector_length: int,
get_candidates: Callable[[KnowledgeBase, Span], Iterable[Candidate]],
get_candidates_batch: Callable[
[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]
],
overwrite: bool = BACKWARD_OVERWRITE,
scorer: Optional[Callable] = entity_linker_score,
use_gold_ents: bool,
candidates_batch_size: int,
threshold: Optional[float] = None,
save_activations: bool = False,
) -> None:
@ -190,10 +206,14 @@ class EntityLinker(TrainablePipe):
entity_vector_length (int): Size of encoding vectors in the KB.
get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that
produces a list of candidates, given a certain knowledge base and a textual mention.
scorer (Optional[Callable]): The scoring method. Defaults to
Scorer.score_links.
get_candidates_batch (
Callable[[KnowledgeBase, Iterable[Span]], Iterable[Iterable[Candidate]]],
Iterable[Candidate]]
): Function that produces a list of candidates, given a certain knowledge base and several textual mentions.
scorer (Optional[Callable]): The scoring method. Defaults to Scorer.score_links.
use_gold_ents (bool): Whether to copy entities from gold docs or not. If false, another
component must provide entity annotations.
candidates_batch_size (int): Size of batches for entity candidate generation.
threshold (Optional[float]): Confidence threshold for entity predictions. If confidence is below the
threshold, prediction is discarded. If None, predictions are not filtered by any threshold.
DOCS: https://spacy.io/api/entitylinker#init
@ -216,23 +236,28 @@ class EntityLinker(TrainablePipe):
self.incl_prior = incl_prior
self.incl_context = incl_context
self.get_candidates = get_candidates
self.get_candidates_batch = get_candidates_batch
self.cfg: Dict[str, Any] = {"overwrite": overwrite}
self.distance = CosineDistance(normalize=False)
# how many neighbour sentences to take into account
# create an empty KB by default. If you want to load a predefined one, specify it in 'initialize'.
# create an empty KB by default
self.kb = empty_kb(entity_vector_length)(self.vocab)
self.scorer = scorer
self.use_gold_ents = use_gold_ents
self.candidates_batch_size = candidates_batch_size
self.threshold = threshold
self.save_activations = save_activations
if candidates_batch_size < 1:
raise ValueError(Errors.E1044)
def set_kb(self, kb_loader: Callable[[Vocab], KnowledgeBase]):
"""Define the KB of this pipe by providing a function that will
create it using this object's vocab."""
if not callable(kb_loader):
raise ValueError(Errors.E885.format(arg_type=type(kb_loader)))
self.kb = kb_loader(self.vocab)
self.kb = kb_loader(self.vocab) # type: ignore
def validate_kb(self) -> None:
# Raise an error if the knowledge base is not initialized.
@ -254,8 +279,8 @@ class EntityLinker(TrainablePipe):
get_examples (Callable[[], Iterable[Example]]): Function that
returns a representative sample of gold-standard Example objects.
nlp (Language): The current nlp object the component is part of.
kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates a KnowledgeBase from a Vocab instance.
Note that providing this argument, will overwrite all data accumulated in the current KB.
kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates a KnowledgeBase from a Vocab
instance. Note that providing this argument will overwrite all data accumulated in the current KB.
Use this only when loading a KB as-such from file.
DOCS: https://spacy.io/api/entitylinker#initialize
@ -439,15 +464,40 @@ class EntityLinker(TrainablePipe):
docs_ents.append(Ragged(xp.zeros(0, dtype="uint64"), ops.alloc1i(0)))
continue
sentences = [s for s in doc.sents]
# Looping through each entity (TODO: rewrite)
for ent in doc.ents:
# Loop over entities in batches.
for ent_idx in range(0, len(doc.ents), self.candidates_batch_size):
ent_batch = doc.ents[ent_idx : ent_idx + self.candidates_batch_size]
# Look up candidate entities.
valid_ent_idx = [
idx
for idx in range(len(ent_batch))
if ent_batch[idx].label_ not in self.labels_discard
]
batch_candidates = list(
self.get_candidates_batch(
self.kb, [ent_batch[idx] for idx in valid_ent_idx]
)
if self.candidates_batch_size > 1
else [
self.get_candidates(self.kb, ent_batch[idx])
for idx in valid_ent_idx
]
)
# Looping through each entity in batch (TODO: rewrite)
for j, ent in enumerate(ent_batch):
sent_index = sentences.index(ent.sent)
assert sent_index >= 0
if self.incl_context:
# get n_neighbour sentences, clipped to the length of the document
start_sentence = max(0, sent_index - self.n_sents)
end_sentence = min(len(sentences) - 1, sent_index + self.n_sents)
end_sentence = min(
len(sentences) - 1, sent_index + self.n_sents
)
start_token = sentences[start_sentence].start
end_token = sentences[end_sentence].end
sent_doc = doc[start_token:end_token].as_doc()
@ -466,7 +516,7 @@ class EntityLinker(TrainablePipe):
ents=[0],
)
else:
candidates = list(self.get_candidates(self.kb, ent))
candidates = list(batch_candidates[j])
if not candidates:
# no prediction possible for this entity - setting to NIL
final_kb_ids.append(self.NIL)
@ -514,7 +564,8 @@ class EntityLinker(TrainablePipe):
scores = prior_probs + sims - (prior_probs * sims)
final_kb_ids.append(
candidates[scores.argmax().item()].entity_
if self.threshold is None or scores.max() >= self.threshold
if self.threshold is None
or scores.max() >= self.threshold
else EntityLinker.NIL
)
self._add_activations(

526
spacy/pipeline/entity_ruler.py
View File

@ -1,526 +0,0 @@
import warnings
from typing import Optional, Union, List, Dict, Tuple, Iterable, Any, Callable, Sequence
from typing import cast
from collections import defaultdict
from pathlib import Path
import srsly
from .pipe import Pipe
from ..training import Example
from ..language import Language
from ..errors import Errors, Warnings
from ..util import ensure_path, to_disk, from_disk, SimpleFrozenList, registry
from ..tokens import Doc, Span
from ..matcher import Matcher, PhraseMatcher
from ..scorer import get_ner_prf
DEFAULT_ENT_ID_SEP = "||"
PatternType = Dict[str, Union[str, List[Dict[str, Any]]]]
@Language.factory(
"entity_ruler",
assigns=["doc.ents", "token.ent_type", "token.ent_iob"],
default_config={
"phrase_matcher_attr": None,
"validate": False,
"overwrite_ents": False,
"ent_id_sep": DEFAULT_ENT_ID_SEP,
"scorer": {"@scorers": "spacy.entity_ruler_scorer.v1"},
},
default_score_weights={
"ents_f": 1.0,
"ents_p": 0.0,
"ents_r": 0.0,
"ents_per_type": None,
},
)
def make_entity_ruler(
nlp: Language,
name: str,
phrase_matcher_attr: Optional[Union[int, str]],
validate: bool,
overwrite_ents: bool,
ent_id_sep: str,
scorer: Optional[Callable],
):
return EntityRuler(
nlp,
name,
phrase_matcher_attr=phrase_matcher_attr,
validate=validate,
overwrite_ents=overwrite_ents,
ent_id_sep=ent_id_sep,
scorer=scorer,
)
def entity_ruler_score(examples, **kwargs):
return get_ner_prf(examples)
@registry.scorers("spacy.entity_ruler_scorer.v1")
def make_entity_ruler_scorer():
return entity_ruler_score
class EntityRuler(Pipe):
"""The EntityRuler lets you add spans to the `Doc.ents` using token-based
rules or exact phrase matches. It can be combined with the statistical
`EntityRecognizer` to boost accuracy, or used on its own to implement a
purely rule-based entity recognition system. After initialization, the
component is typically added to the pipeline using `nlp.add_pipe`.
DOCS: https://spacy.io/api/entityruler
USAGE: https://spacy.io/usage/rule-based-matching#entityruler
"""
def __init__(
self,
nlp: Language,
name: str = "entity_ruler",
*,
phrase_matcher_attr: Optional[Union[int, str]] = None,
validate: bool = False,
overwrite_ents: bool = False,
ent_id_sep: str = DEFAULT_ENT_ID_SEP,
patterns: Optional[List[PatternType]] = None,
scorer: Optional[Callable] = entity_ruler_score,
) -> None:
"""Initialize the entity ruler. If patterns are supplied here, they
need to be a list of dictionaries with a `"label"` and `"pattern"`
key. A pattern can either be a token pattern (list) or a phrase pattern
(string). For example: `{'label': 'ORG', 'pattern': 'Apple'}`.
nlp (Language): The shared nlp object to pass the vocab to the matchers
and process phrase patterns.
name (str): Instance name of the current pipeline component. Typically
passed in automatically from the factory when the component is
added. Used to disable the current entity ruler while creating
phrase patterns with the nlp object.
phrase_matcher_attr (int / str): Token attribute to match on, passed
to the internal PhraseMatcher as `attr`
validate (bool): Whether patterns should be validated, passed to
Matcher and PhraseMatcher as `validate`
patterns (iterable): Optional patterns to load in.
overwrite_ents (bool): If existing entities are present, e.g. entities
added by the model, overwrite them by matches if necessary.
ent_id_sep (str): Separator used internally for entity IDs.
scorer (Optional[Callable]): The scoring method. Defaults to
spacy.scorer.get_ner_prf.
DOCS: https://spacy.io/api/entityruler#init
"""
self.nlp = nlp
self.name = name
self.overwrite = overwrite_ents
self.token_patterns = defaultdict(list) # type: ignore
self.phrase_patterns = defaultdict(list) # type: ignore
self._validate = validate
self.matcher = Matcher(nlp.vocab, validate=validate)
self.phrase_matcher_attr = phrase_matcher_attr
self.phrase_matcher = PhraseMatcher(
nlp.vocab, attr=self.phrase_matcher_attr, validate=validate
)
self.ent_id_sep = ent_id_sep
self._ent_ids = defaultdict(tuple) # type: ignore
if patterns is not None:
self.add_patterns(patterns)
self.scorer = scorer
def __len__(self) -> int:
"""The number of all patterns added to the entity ruler."""
n_token_patterns = sum(len(p) for p in self.token_patterns.values())
n_phrase_patterns = sum(len(p) for p in self.phrase_patterns.values())
return n_token_patterns + n_phrase_patterns
def __contains__(self, label: str) -> bool:
"""Whether a label is present in the patterns."""
return label in self.token_patterns or label in self.phrase_patterns
def __call__(self, doc: Doc) -> Doc:
"""Find matches in document and add them as entities.
doc (Doc): The Doc object in the pipeline.
RETURNS (Doc): The Doc with added entities, if available.
DOCS: https://spacy.io/api/entityruler#call
"""
error_handler = self.get_error_handler()
try:
matches = self.match(doc)
self.set_annotations(doc, matches)
return doc
except Exception as e:
return error_handler(self.name, self, [doc], e)
def match(self, doc: Doc):
self._require_patterns()
with warnings.catch_warnings():
warnings.filterwarnings("ignore", message="\\[W036")
matches = list(self.matcher(doc)) + list(self.phrase_matcher(doc))
final_matches = set(
[(m_id, start, end) for m_id, start, end in matches if start != end]
)
get_sort_key = lambda m: (m[2] - m[1], -m[1])
final_matches = sorted(final_matches, key=get_sort_key, reverse=True)
return final_matches
def set_annotations(self, doc, matches):
"""Modify the document in place"""
entities = list(doc.ents)
new_entities = []
seen_tokens = set()
for match_id, start, end in matches:
if any(t.ent_type for t in doc[start:end]) and not self.overwrite:
continue
# check for end - 1 here because boundaries are inclusive
if start not in seen_tokens and end - 1 not in seen_tokens:
if match_id in self._ent_ids:
label, ent_id = self._ent_ids[match_id]
span = Span(doc, start, end, label=label, span_id=ent_id)
else:
span = Span(doc, start, end, label=match_id)
new_entities.append(span)
entities = [
e for e in entities if not (e.start < end and e.end > start)
]
seen_tokens.update(range(start, end))
doc.ents = entities + new_entities
@property
def labels(self) -> Tuple[str, ...]:
"""All labels present in the match patterns.
RETURNS (set): The string labels.
DOCS: https://spacy.io/api/entityruler#labels
"""
keys = set(self.token_patterns.keys())
keys.update(self.phrase_patterns.keys())
all_labels = set()
for l in keys:
if self.ent_id_sep in l:
label, _ = self._split_label(l)
all_labels.add(label)
else:
all_labels.add(l)
return tuple(sorted(all_labels))
def initialize(
self,
get_examples: Callable[[], Iterable[Example]],
*,
nlp: Optional[Language] = None,
patterns: Optional[Sequence[PatternType]] = None,
):
"""Initialize the pipe for training.
get_examples (Callable[[], Iterable[Example]]): Function that
returns a representative sample of gold-standard Example objects.
nlp (Language): The current nlp object the component is part of.
patterns Optional[Iterable[PatternType]]: The list of patterns.
DOCS: https://spacy.io/api/entityruler#initialize
"""
self.clear()
if patterns:
self.add_patterns(patterns) # type: ignore[arg-type]
@property
def ent_ids(self) -> Tuple[Optional[str], ...]:
"""All entity ids present in the match patterns `id` properties
RETURNS (set): The string entity ids.
DOCS: https://spacy.io/api/entityruler#ent_ids
"""
keys = set(self.token_patterns.keys())
keys.update(self.phrase_patterns.keys())
all_ent_ids = set()
for l in keys:
if self.ent_id_sep in l:
_, ent_id = self._split_label(l)
all_ent_ids.add(ent_id)
return tuple(all_ent_ids)
@property
def patterns(self) -> List[PatternType]:
"""Get all patterns that were added to the entity ruler.
RETURNS (list): The original patterns, one dictionary per pattern.
DOCS: https://spacy.io/api/entityruler#patterns
"""
all_patterns = []
for label, patterns in self.token_patterns.items():
for pattern in patterns:
ent_label, ent_id = self._split_label(label)
p = {"label": ent_label, "pattern": pattern}
if ent_id:
p["id"] = ent_id
all_patterns.append(p)
for label, patterns in self.phrase_patterns.items():
for pattern in patterns:
ent_label, ent_id = self._split_label(label)
p = {"label": ent_label, "pattern": pattern.text}
if ent_id:
p["id"] = ent_id
all_patterns.append(p)
return all_patterns
def add_patterns(self, patterns: List[PatternType]) -> None:
"""Add patterns to the entity ruler. A pattern can either be a token
pattern (list of dicts) or a phrase pattern (string). For example:
{'label': 'ORG', 'pattern': 'Apple'}
{'label': 'GPE', 'pattern': [{'lower': 'san'}, {'lower': 'francisco'}]}
patterns (list): The patterns to add.
DOCS: https://spacy.io/api/entityruler#add_patterns
"""
# disable the nlp components after this one in case they hadn't been initialized / deserialised yet
try:
current_index = -1
for i, (name, pipe) in enumerate(self.nlp.pipeline):
if self == pipe:
current_index = i
break
subsequent_pipes = [pipe for pipe in self.nlp.pipe_names[current_index:]]
except ValueError:
subsequent_pipes = []
with self.nlp.select_pipes(disable=subsequent_pipes):
token_patterns = []
phrase_pattern_labels = []
phrase_pattern_texts = []
phrase_pattern_ids = []
for entry in patterns:
if isinstance(entry["pattern"], str):
phrase_pattern_labels.append(entry["label"])
phrase_pattern_texts.append(entry["pattern"])
phrase_pattern_ids.append(entry.get("id"))
elif isinstance(entry["pattern"], list):
token_patterns.append(entry)
phrase_patterns = []
for label, pattern, ent_id in zip(
phrase_pattern_labels,
self.nlp.pipe(phrase_pattern_texts),
phrase_pattern_ids,
):
phrase_pattern = {"label": label, "pattern": pattern}
if ent_id:
phrase_pattern["id"] = ent_id
phrase_patterns.append(phrase_pattern)
for entry in token_patterns + phrase_patterns: # type: ignore[operator]
label = entry["label"]
if "id" in entry:
ent_label = label
label = self._create_label(label, entry["id"])
key = self.matcher._normalize_key(label)
self._ent_ids[key] = (ent_label, entry["id"])
pattern = entry["pattern"] # type: ignore
if isinstance(pattern, Doc):
self.phrase_patterns[label].append(pattern)
self.phrase_matcher.add(label, [pattern]) # type: ignore
elif isinstance(pattern, list):
self.token_patterns[label].append(pattern)
self.matcher.add(label, [pattern])
else:
raise ValueError(Errors.E097.format(pattern=pattern))
def clear(self) -> None:
"""Reset all patterns."""
self.token_patterns = defaultdict(list)
self.phrase_patterns = defaultdict(list)
self._ent_ids = defaultdict(tuple)
self.matcher = Matcher(self.nlp.vocab, validate=self._validate)
self.phrase_matcher = PhraseMatcher(
self.nlp.vocab, attr=self.phrase_matcher_attr, validate=self._validate
)
def remove(self, ent_id: str) -> None:
"""Remove a pattern by its ent_id if a pattern with this ent_id was added before
ent_id (str): id of the pattern to be removed
RETURNS: None
DOCS: https://spacy.io/api/entityruler#remove
"""
label_id_pairs = [
(label, eid) for (label, eid) in self._ent_ids.values() if eid == ent_id
]
if not label_id_pairs:
raise ValueError(
Errors.E1024.format(attr_type="ID", label=ent_id, component=self.name)
)
created_labels = [
self._create_label(label, eid) for (label, eid) in label_id_pairs
]
# remove the patterns from self.phrase_patterns
self.phrase_patterns = defaultdict(
list,
{
label: val
for (label, val) in self.phrase_patterns.items()
if label not in created_labels
},
)
# remove the patterns from self.token_pattern
self.token_patterns = defaultdict(
list,
{
label: val
for (label, val) in self.token_patterns.items()
if label not in created_labels
},
)
# remove the patterns from self.token_pattern
for label in created_labels:
if label in self.phrase_matcher:
self.phrase_matcher.remove(label)
else:
self.matcher.remove(label)
def _require_patterns(self) -> None:
"""Raise a warning if this component has no patterns defined."""
if len(self) == 0:
warnings.warn(Warnings.W036.format(name=self.name))
def _split_label(self, label: str) -> Tuple[str, Optional[str]]:
"""Split Entity label into ent_label and ent_id if it contains self.ent_id_sep
label (str): The value of label in a pattern entry
RETURNS (tuple): ent_label, ent_id
"""
if self.ent_id_sep in label:
ent_label, ent_id = label.rsplit(self.ent_id_sep, 1)
else:
ent_label = label
ent_id = None # type: ignore
return ent_label, ent_id
def _create_label(self, label: Any, ent_id: Any) -> str:
"""Join Entity label with ent_id if the pattern has an `id` attribute
If ent_id is not a string, the label is returned as is.
label (str): The label to set for ent.label_
ent_id (str): The label
RETURNS (str): The ent_label joined with configured `ent_id_sep`
"""
if isinstance(ent_id, str):
label = f"{label}{self.ent_id_sep}{ent_id}"
return label
def from_bytes(
self, patterns_bytes: bytes, *, exclude: Iterable[str] = SimpleFrozenList()
) -> "EntityRuler":
"""Load the entity ruler from a bytestring.
patterns_bytes (bytes): The bytestring to load.
RETURNS (EntityRuler): The loaded entity ruler.
DOCS: https://spacy.io/api/entityruler#from_bytes
"""
cfg = srsly.msgpack_loads(patterns_bytes)
self.clear()
if isinstance(cfg, dict):
self.add_patterns(cfg.get("patterns", cfg))
self.overwrite = cfg.get("overwrite", False)
self.phrase_matcher_attr = cfg.get("phrase_matcher_attr", None)
self.phrase_matcher = PhraseMatcher(
self.nlp.vocab, attr=self.phrase_matcher_attr
)
self.ent_id_sep = cfg.get("ent_id_sep", DEFAULT_ENT_ID_SEP)
else:
self.add_patterns(cfg)
return self
def to_bytes(self, *, exclude: Iterable[str] = SimpleFrozenList()) -> bytes:
"""Serialize the entity ruler patterns to a bytestring.
RETURNS (bytes): The serialized patterns.
DOCS: https://spacy.io/api/entityruler#to_bytes
"""
serial = {
"overwrite": self.overwrite,
"ent_id_sep": self.ent_id_sep,
"phrase_matcher_attr": self.phrase_matcher_attr,
"patterns": self.patterns,
}
return srsly.msgpack_dumps(serial)
def from_disk(
self, path: Union[str, Path], *, exclude: Iterable[str] = SimpleFrozenList()
) -> "EntityRuler":
"""Load the entity ruler from a file. Expects a file containing
newline-delimited JSON (JSONL) with one entry per line.
path (str / Path): The JSONL file to load.
RETURNS (EntityRuler): The loaded entity ruler.
DOCS: https://spacy.io/api/entityruler#from_disk
"""
path = ensure_path(path)
self.clear()
depr_patterns_path = path.with_suffix(".jsonl")
if path.suffix == ".jsonl": # user provides a jsonl
if path.is_file:
patterns = srsly.read_jsonl(path)
self.add_patterns(patterns)
else:
raise ValueError(Errors.E1023.format(path=path))
elif depr_patterns_path.is_file():
patterns = srsly.read_jsonl(depr_patterns_path)
self.add_patterns(patterns)
elif path.is_dir(): # path is a valid directory
cfg = {}
deserializers_patterns = {
"patterns": lambda p: self.add_patterns(
srsly.read_jsonl(p.with_suffix(".jsonl"))
)
}
deserializers_cfg = {"cfg": lambda p: cfg.update(srsly.read_json(p))}
from_disk(path, deserializers_cfg, {})
self.overwrite = cfg.get("overwrite", False)
self.phrase_matcher_attr = cfg.get("phrase_matcher_attr")
self.ent_id_sep = cfg.get("ent_id_sep", DEFAULT_ENT_ID_SEP)
self.phrase_matcher = PhraseMatcher(
self.nlp.vocab, attr=self.phrase_matcher_attr
)
from_disk(path, deserializers_patterns, {})
else: # path is not a valid directory or file
raise ValueError(Errors.E146.format(path=path))
return self
def to_disk(
self, path: Union[str, Path], *, exclude: Iterable[str] = SimpleFrozenList()
) -> None:
"""Save the entity ruler patterns to a directory. The patterns will be
saved as newline-delimited JSON (JSONL).
path (str / Path): The JSONL file to save.
DOCS: https://spacy.io/api/entityruler#to_disk
"""
path = ensure_path(path)
cfg = {
"overwrite": self.overwrite,
"phrase_matcher_attr": self.phrase_matcher_attr,
"ent_id_sep": self.ent_id_sep,
}
serializers = {
"patterns": lambda p: srsly.write_jsonl(
p.with_suffix(".jsonl"), self.patterns
),
"cfg": lambda p: srsly.write_json(p, cfg),
}
if path.suffix == ".jsonl": # user wants to save only JSONL
srsly.write_jsonl(path, self.patterns)
else:
to_disk(path, serializers, {})

5
spacy/pipeline/legacy/entity_linker.py
View File

@ -68,8 +68,7 @@ class EntityLinker_v1(TrainablePipe):
entity_vector_length (int): Size of encoding vectors in the KB.
get_candidates (Callable[[KnowledgeBase, Span], Iterable[Candidate]]): Function that
produces a list of candidates, given a certain knowledge base and a textual mention.
scorer (Optional[Callable]): The scoring method. Defaults to
Scorer.score_links.
scorer (Optional[Callable]): The scoring method. Defaults to Scorer.score_links.
DOCS: https://spacy.io/api/entitylinker#init
"""
self.vocab = vocab
@ -115,7 +114,7 @@ class EntityLinker_v1(TrainablePipe):
get_examples (Callable[[], Iterable[Example]]): Function that
returns a representative sample of gold-standard Example objects.
nlp (Language): The current nlp object the component is part of.
kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates a KnowledgeBase from a Vocab instance.
kb_loader (Callable[[Vocab], KnowledgeBase]): A function that creates an InMemoryLookupKB from a Vocab instance.
Note that providing this argument, will overwrite all data accumulated in the current KB.
Use this only when loading a KB as-such from file.

5
spacy/pipeline/morphologizer.pyx
View File

@ -1,7 +1,8 @@
# cython: infer_types=True, profile=True, binding=True
from typing import Callable, Dict, Iterable, List, Optional, Union
import srsly
from thinc.api import SequenceCategoricalCrossentropy, Model, Config
from thinc.api import Model, Config
from thinc.legacy import LegacySequenceCategoricalCrossentropy
from thinc.types import Floats2d, Ints1d
from itertools import islice
@ -290,7 +291,7 @@ class Morphologizer(Tagger):
DOCS: https://spacy.io/api/morphologizer#get_loss
"""
validate_examples(examples, "Morphologizer.get_loss")
loss_func = SequenceCategoricalCrossentropy(names=tuple(self.labels), normalize=False)
loss_func = LegacySequenceCategoricalCrossentropy(names=tuple(self.labels), normalize=False)
truths = []
for eg in examples:
eg_truths = []

221
spacy/pipeline/multitask.pyx
View File

@ -1,221 +0,0 @@
# cython: infer_types=True, profile=True, binding=True
from typing import Optional
import numpy
from thinc.api import CosineDistance, to_categorical, Model, Config
from thinc.api import set_dropout_rate
from ..tokens.doc cimport Doc
from .trainable_pipe import TrainablePipe
from .tagger import Tagger
from ..training import validate_examples
from ..language import Language
from ._parser_internals import nonproj
from ..attrs import POS, ID
from ..errors import Errors
default_model_config = """
[model]
@architectures = "spacy.MultiTask.v1"
maxout_pieces = 3
token_vector_width = 96
[model.tok2vec]
@architectures = "spacy.HashEmbedCNN.v2"
pretrained_vectors = null
width = 96
depth = 4
embed_size = 2000
window_size = 1
maxout_pieces = 2
subword_features = true
"""
DEFAULT_MT_MODEL = Config().from_str(default_model_config)["model"]
@Language.factory(
"nn_labeller",
default_config={"labels": None, "target": "dep_tag_offset", "model": DEFAULT_MT_MODEL}
)
def make_nn_labeller(nlp: Language, name: str, model: Model, labels: Optional[dict], target: str):
return MultitaskObjective(nlp.vocab, model, name)
class MultitaskObjective(Tagger):
"""Experimental: Assist training of a parser or tagger, by training a
side-objective.
"""
def __init__(self, vocab, model, name="nn_labeller", *, target):
self.vocab = vocab
self.model = model
self.name = name
if target == "dep":
self.make_label = self.make_dep
elif target == "tag":
self.make_label = self.make_tag
elif target == "ent":
self.make_label = self.make_ent
elif target == "dep_tag_offset":
self.make_label = self.make_dep_tag_offset
elif target == "ent_tag":
self.make_label = self.make_ent_tag
elif target == "sent_start":
self.make_label = self.make_sent_start
elif hasattr(target, "__call__"):
self.make_label = target
else:
raise ValueError(Errors.E016)
cfg = {"labels": {}, "target": target}
self.cfg = dict(cfg)
@property
def labels(self):
return self.cfg.setdefault("labels", {})
@labels.setter
def labels(self, value):
self.cfg["labels"] = value
def set_annotations(self, docs, dep_ids):
pass
def initialize(self, get_examples, nlp=None, labels=None):
if not hasattr(get_examples, "__call__"):
err = Errors.E930.format(name="MultitaskObjective", obj=type(get_examples))
raise ValueError(err)
if labels is not None:
self.labels = labels
else:
for example in get_examples():
for token in example.y:
label = self.make_label(token)
if label is not None and label not in self.labels:
self.labels[label] = len(self.labels)
self.model.initialize() # TODO: fix initialization by defining X and Y
def predict(self, docs):
tokvecs = self.model.get_ref("tok2vec")(docs)
scores = self.model.get_ref("softmax")(tokvecs)
return tokvecs, scores
def get_loss(self, examples, scores):
cdef int idx = 0
correct = numpy.zeros((scores.shape[0],), dtype="i")
guesses = scores.argmax(axis=1)
docs = [eg.predicted for eg in examples]
for i, eg in enumerate(examples):
# Handles alignment for tokenization differences
doc_annots = eg.get_aligned() # TODO
for j in range(len(eg.predicted)):
tok_annots = {key: values[j] for key, values in tok_annots.items()}
label = self.make_label(j, tok_annots)
if label is None or label not in self.labels:
correct[idx] = guesses[idx]
else:
correct[idx] = self.labels[label]
idx += 1
correct = self.model.ops.xp.array(correct, dtype="i")
d_scores = scores - to_categorical(correct, n_classes=scores.shape[1])
loss = (d_scores**2).sum()
return float(loss), d_scores
@staticmethod
def make_dep(token):
return token.dep_
@staticmethod
def make_tag(token):
return token.tag_
@staticmethod
def make_ent(token):
if token.ent_iob_ == "O":
return "O"
else:
return token.ent_iob_ + "-" + token.ent_type_
@staticmethod
def make_dep_tag_offset(token):
dep = token.dep_
tag = token.tag_
offset = token.head.i - token.i
offset = min(offset, 2)
offset = max(offset, -2)
return f"{dep}-{tag}:{offset}"
@staticmethod
def make_ent_tag(token):
if token.ent_iob_ == "O":
ent = "O"
else:
ent = token.ent_iob_ + "-" + token.ent_type_
tag = token.tag_
return f"{tag}-{ent}"
@staticmethod
def make_sent_start(token):
"""A multi-task objective for representing sentence boundaries,
using BILU scheme. (O is impossible)
"""
if token.is_sent_start and token.is_sent_end:
return "U-SENT"
elif token.is_sent_start:
return "B-SENT"
else:
return "I-SENT"
class ClozeMultitask(TrainablePipe):
def __init__(self, vocab, model, **cfg):
self.vocab = vocab
self.model = model
self.cfg = cfg
self.distance = CosineDistance(ignore_zeros=True, normalize=False) # TODO: in config
def set_annotations(self, docs, dep_ids):
pass
def initialize(self, get_examples, nlp=None):
self.model.initialize() # TODO: fix initialization by defining X and Y
X = self.model.ops.alloc((5, self.model.get_ref("tok2vec").get_dim("nO")))
self.model.output_layer.initialize(X)
def predict(self, docs):
tokvecs = self.model.get_ref("tok2vec")(docs)
vectors = self.model.get_ref("output_layer")(tokvecs)
return tokvecs, vectors
def get_loss(self, examples, vectors, prediction):
validate_examples(examples, "ClozeMultitask.get_loss")
# The simplest way to implement this would be to vstack the
# token.vector values, but that's a bit inefficient, especially on GPU.
# Instead we fetch the index into the vectors table for each of our tokens,
# and look them up all at once. This prevents data copying.
ids = self.model.ops.flatten([eg.predicted.to_array(ID).ravel() for eg in examples])
target = vectors[ids]
gradient = self.distance.get_grad(prediction, target)
loss = self.distance.get_loss(prediction, target)
return float(loss), gradient
def update(self, examples, *, drop=0., sgd=None, losses=None):
pass
def rehearse(self, examples, drop=0., sgd=None, losses=None):
if losses is not None and self.name not in losses:
losses[self.name] = 0.
set_dropout_rate(self.model, drop)
validate_examples(examples, "ClozeMultitask.rehearse")
docs = [eg.predicted for eg in examples]
predictions, bp_predictions = self.model.begin_update()
loss, d_predictions = self.get_loss(examples, self.vocab.vectors.data, predictions)
bp_predictions(d_predictions)
if sgd is not None:
self.finish_update(sgd)
if losses is not None:
losses[self.name] += loss
return losses
def add_label(self, label):
raise NotImplementedError

9
spacy/pipeline/pipe.pyx
View File

@ -1,4 +1,4 @@
# cython: infer_types=True, profile=True
# cython: infer_types=True, profile=True, binding=True
from typing import Optional, Tuple, Iterable, Iterator, Callable, Union, Dict
import srsly
import warnings
@ -19,13 +19,6 @@ cdef class Pipe:
DOCS: https://spacy.io/api/pipe
"""
@classmethod
def __init_subclass__(cls, **kwargs):
"""Raise a warning if an inheriting class implements 'begin_training'
(from v2) instead of the new 'initialize' method (from v3)"""
if hasattr(cls, "begin_training"):
warnings.warn(Warnings.W088.format(name=cls.__name__))
def __call__(self, Doc doc) -> Doc:
"""Apply the pipe to one document. The document is modified in place,
and returned. This usually happens under the hood when the nlp object

6
spacy/pipeline/senter.pyx
View File

@ -3,7 +3,9 @@ from typing import Dict, Iterable, Optional, Callable, List, Union
from itertools import islice
import srsly
from thinc.api import Model, SequenceCategoricalCrossentropy, Config
from thinc.api import Model, Config
from thinc.legacy import LegacySequenceCategoricalCrossentropy
from thinc.types import Floats2d, Ints1d
from ..tokens.doc cimport Doc
@ -161,7 +163,7 @@ class SentenceRecognizer(Tagger):
"""
validate_examples(examples, "SentenceRecognizer.get_loss")
labels = self.labels
loss_func = SequenceCategoricalCrossentropy(names=labels, normalize=False)
loss_func = LegacySequenceCategoricalCrossentropy(names=labels, normalize=False)
truths = []
for eg in examples:
eg_truth = []

19
spacy/pipeline/span_ruler.py
View File

@ -11,7 +11,7 @@ from ..language import Language
from ..errors import Errors, Warnings
from ..util import ensure_path, SimpleFrozenList, registry
from ..tokens import Doc, Span
from ..scorer import Scorer
from ..scorer import Scorer, get_ner_prf
from ..matcher import Matcher, PhraseMatcher
from .. import util
@ -20,7 +20,7 @@ DEFAULT_SPANS_KEY = "ruler"
@Language.factory(
"future_entity_ruler",
"entity_ruler",
assigns=["doc.ents"],
default_config={
"phrase_matcher_attr": None,
@ -63,6 +63,15 @@ def make_entity_ruler(
)
def entity_ruler_score(examples, **kwargs):
return get_ner_prf(examples)
@registry.scorers("spacy.entity_ruler_scorer.v1")
def make_entity_ruler_scorer():
return entity_ruler_score
@Language.factory(
"span_ruler",
assigns=["doc.spans"],
@ -117,7 +126,7 @@ def prioritize_new_ents_filter(
) -> List[Span]:
"""Merge entities and spans into one list without overlaps by allowing
spans to overwrite any entities that they overlap with. Intended to
replicate the overwrite_ents=True behavior from the EntityRuler.
replicate the overwrite_ents=True behavior from the v3 EntityRuler.
entities (Iterable[Span]): The entities, already filtered for overlaps.
spans (Iterable[Span]): The spans to merge, may contain overlaps.
@ -148,7 +157,7 @@ def prioritize_existing_ents_filter(
) -> List[Span]:
"""Merge entities and spans into one list without overlaps by prioritizing
existing entities. Intended to replicate the overwrite_ents=False behavior
from the EntityRuler.
from the v3 EntityRuler.
entities (Iterable[Span]): The entities, already filtered for overlaps.
spans (Iterable[Span]): The spans to merge, may contain overlaps.
@ -170,7 +179,7 @@ def prioritize_existing_ents_filter(
@registry.misc("spacy.prioritize_existing_ents_filter.v1")
def make_preverse_existing_ents_filter():
def make_preserve_existing_ents_filter():
return prioritize_existing_ents_filter

14
spacy/pipeline/spancat.py
View File

@ -2,7 +2,7 @@ from typing import List, Dict, Callable, Tuple, Optional, Iterable, Any, cast
from typing import Union
from thinc.api import Config, Model, get_current_ops, set_dropout_rate, Ops
from thinc.api import Optimizer
from thinc.types import Ragged, Ints2d, Floats2d, Ints1d
from thinc.types import Ragged, Ints2d, Floats2d
import numpy
@ -30,17 +30,17 @@ scorer = {"@layers": "spacy.LinearLogistic.v1"}
hidden_size = 128
[model.tok2vec]
@architectures = "spacy.Tok2Vec.v1"
@architectures = "spacy.Tok2Vec.v2"
[model.tok2vec.embed]
@architectures = "spacy.MultiHashEmbed.v1"
@architectures = "spacy.MultiHashEmbed.v2"
width = 96
rows = [5000, 2000, 1000, 1000]
attrs = ["ORTH", "PREFIX", "SUFFIX", "SHAPE"]
include_static_vectors = false
[model.tok2vec.encode]
@architectures = "spacy.MaxoutWindowEncoder.v1"
@architectures = "spacy.MaxoutWindowEncoder.v2"
width = ${model.tok2vec.embed.width}
window_size = 1
maxout_pieces = 3
@ -139,6 +139,9 @@ def make_spancat(
spans_key (str): Key of the doc.spans dict to save the spans under. During
initialization and training, the component will look for spans on the
reference document under the same key.
scorer (Optional[Callable]): The scoring method. Defaults to
Scorer.score_spans for the Doc.spans[spans_key] with overlapping
spans allowed.
threshold (float): Minimum probability to consider a prediction positive.
Spans with a positive prediction will be saved on the Doc. Defaults to
0.5.
@ -279,6 +282,9 @@ class SpanCategorizer(TrainablePipe):
DOCS: https://spacy.io/api/spancategorizer#predict
"""
indices = self.suggester(docs, ops=self.model.ops)
if indices.lengths.sum() == 0:
scores = self.model.ops.alloc2f(0, 0)
else:
scores = self.model.predict((docs, indices)) # type: ignore
return {"indices": indices, "scores": scores}

7
spacy/pipeline/tagger.pyx
View File

@ -2,7 +2,8 @@
from typing import Callable, Dict, Iterable, List, Optional, Union
import numpy
import srsly
from thinc.api import Model, set_dropout_rate, SequenceCategoricalCrossentropy, Config
from thinc.api import Model, set_dropout_rate, Config
from thinc.legacy import LegacySequenceCategoricalCrossentropy
from thinc.types import Floats2d, Ints1d
import warnings
from itertools import islice
@ -244,7 +245,7 @@ class Tagger(TrainablePipe):
DOCS: https://spacy.io/api/tagger#rehearse
"""
loss_func = SequenceCategoricalCrossentropy()
loss_func = LegacySequenceCategoricalCrossentropy()
if losses is None:
losses = {}
losses.setdefault(self.name, 0.0)
@ -275,7 +276,7 @@ class Tagger(TrainablePipe):
DOCS: https://spacy.io/api/tagger#get_loss
"""
validate_examples(examples, "Tagger.get_loss")
loss_func = SequenceCategoricalCrossentropy(names=self.labels, normalize=False, neg_prefix=self.cfg["neg_prefix"])
loss_func = LegacySequenceCategoricalCrossentropy(names=self.labels, normalize=False, neg_prefix=self.cfg["neg_prefix"])
# Convert empty tag "" to missing value None so that both misaligned
# tokens and tokens with missing annotation have the default missing
# value None.

26
spacy/pipeline/textcat.py
View File

@ -27,8 +27,8 @@ single_label_default_config = """
[model.tok2vec.embed]
@architectures = "spacy.MultiHashEmbed.v2"
width = 64
rows = [2000, 2000, 1000, 1000, 1000, 1000]
attrs = ["ORTH", "LOWER", "PREFIX", "SUFFIX", "SHAPE", "ID"]
rows = [2000, 2000, 500, 1000, 500]
attrs = ["NORM", "LOWER", "PREFIX", "SUFFIX", "SHAPE"]
include_static_vectors = false
[model.tok2vec.encode]
@ -75,9 +75,9 @@ subword_features = true
"textcat",
assigns=["doc.cats"],
default_config={
"threshold": 0.5,
"threshold": 0.0,
"model": DEFAULT_SINGLE_TEXTCAT_MODEL,
"scorer": {"@scorers": "spacy.textcat_scorer.v1"},
"scorer": {"@scorers": "spacy.textcat_scorer.v2"},
"save_activations": False,
},
default_score_weights={
@ -91,7 +91,6 @@ subword_features = true
"cats_macro_f": None,
"cats_macro_auc": None,
"cats_f_per_type": None,
"cats_macro_auc_per_type": None,
},
)
def make_textcat(
@ -131,7 +130,7 @@ def textcat_score(examples: Iterable[Example], **kwargs) -> Dict[str, Any]:
)
@registry.scorers("spacy.textcat_scorer.v1")
@registry.scorers("spacy.textcat_scorer.v2")
def make_textcat_scorer():
return textcat_score
@ -158,7 +157,8 @@ class TextCategorizer(TrainablePipe):
model (thinc.api.Model): The Thinc Model powering the pipeline component.
name (str): The component instance name, used to add entries to the
losses during training.
threshold (float): Cutoff to consider a prediction "positive".
threshold (float): Unused, not needed for single-label (exclusive
classes) classification.
scorer (Optional[Callable]): The scoring method. Defaults to
Scorer.score_cats for the attribute "cats".
@ -168,7 +168,11 @@ class TextCategorizer(TrainablePipe):
self.model = model
self.name = name
self._rehearsal_model = None
cfg = {"labels": [], "threshold": threshold, "positive_label": None}
cfg: Dict[str, Any] = {
"labels": [],
"threshold": threshold,
"positive_label": None,
}
self.cfg = dict(cfg)
self.scorer = scorer
self.save_activations = save_activations
@ -415,5 +419,9 @@ class TextCategorizer(TrainablePipe):
def _validate_categories(self, examples: Iterable[Example]):
"""Check whether the provided examples all have single-label cats annotations."""
for ex in examples:
if list(ex.reference.cats.values()).count(1.0) > 1:
vals = list(ex.reference.cats.values())
if vals.count(1.0) > 1:
raise ValueError(Errors.E895.format(value=ex.reference.cats))
for val in vals:
if not (val == 1.0 or val == 0.0):
raise ValueError(Errors.E851.format(val=val))

21
spacy/pipeline/textcat_multilabel.py
View File

@ -19,17 +19,17 @@ multi_label_default_config = """
@architectures = "spacy.TextCatEnsemble.v2"
[model.tok2vec]
@architectures = "spacy.Tok2Vec.v1"
@architectures = "spacy.Tok2Vec.v2"
[model.tok2vec.embed]
@architectures = "spacy.MultiHashEmbed.v2"
width = 64
rows = [2000, 2000, 1000, 1000, 1000, 1000]
attrs = ["ORTH", "LOWER", "PREFIX", "SUFFIX", "SHAPE", "ID"]
rows = [2000, 2000, 500, 1000, 500]
attrs = ["NORM", "LOWER", "PREFIX", "SUFFIX", "SHAPE"]
include_static_vectors = false
[model.tok2vec.encode]
@architectures = "spacy.MaxoutWindowEncoder.v1"
@architectures = "spacy.MaxoutWindowEncoder.v2"
width = ${model.tok2vec.embed.width}
window_size = 1
maxout_pieces = 3
@ -88,7 +88,6 @@ subword_features = true
"cats_macro_f": None,
"cats_macro_auc": None,
"cats_f_per_type": None,
"cats_macro_auc_per_type": None,
},
)
def make_multilabel_textcat(
@ -98,7 +97,7 @@ def make_multilabel_textcat(
threshold: float,
scorer: Optional[Callable],
save_activations: bool,
) -> "TextCategorizer":
) -> "MultiLabel_TextCategorizer":
"""Create a TextCategorizer component. The text categorizer predicts categories
over a whole document. It can learn one or more labels, and the labels are considered
to be non-mutually exclusive, which means that there can be zero or more labels
@ -107,6 +106,7 @@ def make_multilabel_textcat(
model (Model[List[Doc], List[Floats2d]]): A model instance that predicts
scores for each category.
threshold (float): Cutoff to consider a prediction "positive".
scorer (Optional[Callable]): The scoring method.
"""
return MultiLabel_TextCategorizer(
nlp.vocab,
@ -155,6 +155,7 @@ class MultiLabel_TextCategorizer(TextCategorizer):
name (str): The component instance name, used to add entries to the
losses during training.
threshold (float): Cutoff to consider a prediction "positive".
scorer (Optional[Callable]): The scoring method.
save_activations (bool): save model activations in Doc when annotating.
DOCS: https://spacy.io/api/textcategorizer#init
@ -200,6 +201,8 @@ class MultiLabel_TextCategorizer(TextCategorizer):
for label in labels:
self.add_label(label)
subbatch = list(islice(get_examples(), 10))
self._validate_categories(subbatch)
doc_sample = [eg.reference for eg in subbatch]
label_sample, _ = self._examples_to_truth(subbatch)
self._require_labels()
@ -210,4 +213,8 @@ class MultiLabel_TextCategorizer(TextCategorizer):
def _validate_categories(self, examples: Iterable[Example]):
"""This component allows any type of single- or multi-label annotations.
This method overwrites the more strict one from 'textcat'."""
pass
# check that annotation values are valid
for ex in examples:
for val in ex.reference.cats.values():
if not (val == 1.0 or val == 0.0):
raise ValueError(Errors.E851.format(val=val))

16
spacy/pipeline/tok2vec.py
View File

@ -123,9 +123,6 @@ class Tok2Vec(TrainablePipe):
width = self.model.get_dim("nO")
return [self.model.ops.alloc((0, width)) for doc in docs]
tokvecs = self.model.predict(docs)
batch_id = Tok2VecListener.get_batch_id(docs)
for listener in self.listeners:
listener.receive(batch_id, tokvecs, _empty_backprop)
return tokvecs
def set_annotations(self, docs: Sequence[Doc], tokvecses) -> None:
@ -286,6 +283,17 @@ class Tok2VecListener(Model):
def forward(model: Tok2VecListener, inputs, is_train: bool):
"""Supply the outputs from the upstream Tok2Vec component."""
if is_train:
# This might occur during training when the tok2vec layer is frozen / hasn't been updated.
# In that case, it should be set to "annotating" so we can retrieve the embeddings from the doc.
if model._batch_id is None:
outputs = []
for doc in inputs:
if doc.tensor.size == 0:
raise ValueError(Errors.E203.format(name="tok2vec"))
else:
outputs.append(doc.tensor)
return outputs, _empty_backprop
else:
model.verify_inputs(inputs)
return model._outputs, model._backprop
else:
@ -306,7 +314,7 @@ def forward(model: Tok2VecListener, inputs, is_train: bool):
outputs.append(model.ops.alloc2f(len(doc), width))
else:
outputs.append(doc.tensor)
return outputs, lambda dX: []
return outputs, _empty_backprop
def _empty_backprop(dX): # for pickling

2
spacy/pipeline/trainable_pipe.pyx
View File

@ -1,4 +1,4 @@
# cython: infer_types=True, profile=True
# cython: infer_types=True, profile=True, binding=True
from typing import Iterable, Iterator, Optional, Dict, Tuple, Callable
import srsly
from thinc.api import set_dropout_rate, Model, Optimizer

1
spacy/pipeline/transition_parser.pyx
View File

@ -13,7 +13,6 @@ import contextlib
import srsly
from thinc.api import get_ops, set_dropout_rate, CupyOps, NumpyOps
from thinc.api import get_array_module
from thinc.extra.search cimport Beam
from thinc.types import Ints1d
import numpy.random
import numpy

27
spacy/schemas.py
View File

@ -181,12 +181,12 @@ class TokenPatternNumber(BaseModel):
IS_SUBSET: Optional[List[StrictInt]] = Field(None, alias="is_subset")
IS_SUPERSET: Optional[List[StrictInt]] = Field(None, alias="is_superset")
INTERSECTS: Optional[List[StrictInt]] = Field(None, alias="intersects")
EQ: Union[StrictInt, StrictFloat] = Field(None, alias="==")
NEQ: Union[StrictInt, StrictFloat] = Field(None, alias="!=")
GEQ: Union[StrictInt, StrictFloat] = Field(None, alias=">=")
LEQ: Union[StrictInt, StrictFloat] = Field(None, alias="<=")
GT: Union[StrictInt, StrictFloat] = Field(None, alias=">")
LT: Union[StrictInt, StrictFloat] = Field(None, alias="<")
EQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="==")
NEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="!=")
GEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias=">=")
LEQ: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="<=")
GT: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias=">")
LT: Optional[Union[StrictInt, StrictFloat]] = Field(None, alias="<")
class Config:
extra = "forbid"
@ -329,6 +329,7 @@ class ConfigSchemaTraining(BaseModel):
frozen_components: List[str] = Field(..., title="Pipeline components that shouldn't be updated during training")
annotating_components: List[str] = Field(..., title="Pipeline components that should set annotations during training")
before_to_disk: Optional[Callable[["Language"], "Language"]] = Field(..., title="Optional callback to modify nlp object after training, before it's saved to disk")
before_update: Optional[Callable[["Language", Dict[str, Any]], None]] = Field(..., title="Optional callback that is invoked at the start of each training step")
# fmt: on
class Config:
@ -430,7 +431,7 @@ class ProjectConfigAssetURL(BaseModel):
# fmt: off
dest: StrictStr = Field(..., title="Destination of downloaded asset")
url: Optional[StrictStr] = Field(None, title="URL of asset")
checksum: str = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
checksum: Optional[str] = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
description: StrictStr = Field("", title="Description of asset")
# fmt: on
@ -438,7 +439,7 @@ class ProjectConfigAssetURL(BaseModel):
class ProjectConfigAssetGit(BaseModel):
# fmt: off
git: ProjectConfigAssetGitItem = Field(..., title="Git repo information")
checksum: str = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
checksum: Optional[str] = Field(None, title="MD5 hash of file", regex=r"([a-fA-F\d]{32})")
description: Optional[StrictStr] = Field(None, title="Description of asset")
# fmt: on
@ -508,9 +509,9 @@ class DocJSONSchema(BaseModel):
None, title="Indices of sentences' start and end indices"
)
text: StrictStr = Field(..., title="Document text")
spans: Dict[StrictStr, List[Dict[StrictStr, Union[StrictStr, StrictInt]]]] = Field(
None, title="Span information - end/start indices, label, KB ID"
)
spans: Optional[
Dict[StrictStr, List[Dict[StrictStr, Union[StrictStr, StrictInt]]]]
] = Field(None, title="Span information - end/start indices, label, KB ID")
tokens: List[Dict[StrictStr, Union[StrictStr, StrictInt]]] = Field(
..., title="Token information - ID, start, annotations"
)
@ -519,9 +520,9 @@ class DocJSONSchema(BaseModel):
title="Any custom data stored in the document's _ attribute",
alias="_",
)
underscore_token: Optional[Dict[StrictStr, Dict[StrictStr, Any]]] = Field(
underscore_token: Optional[Dict[StrictStr, List[Dict[StrictStr, Any]]]] = Field(
None, title="Any custom data stored in the token's _ attribute"
)
underscore_span: Optional[Dict[StrictStr, Dict[StrictStr, Any]]] = Field(
underscore_span: Optional[Dict[StrictStr, List[Dict[StrictStr, Any]]]] = Field(
None, title="Any custom data stored in the span's _ attribute"
)

8
spacy/scorer.py
View File

@ -446,7 +446,7 @@ class Scorer:
labels (Iterable[str]): The set of possible labels. Defaults to [].
multi_label (bool): Whether the attribute allows multiple labels.
Defaults to True. When set to False (exclusive labels), missing
gold labels are interpreted as 0.0.
gold labels are interpreted as 0.0 and the threshold is set to 0.0.
positive_label (str): The positive label for a binary task with
exclusive classes. Defaults to None.
threshold (float): Cutoff to consider a prediction "positive". Defaults
@ -471,6 +471,8 @@ class Scorer:
"""
if threshold is None:
threshold = 0.5 if multi_label else 0.0
if not multi_label:
threshold = 0.0
f_per_type = {label: PRFScore() for label in labels}
auc_per_type = {label: ROCAUCScore() for label in labels}
labels = set(labels)
@ -505,11 +507,10 @@ class Scorer:
# Get the highest-scoring for each.
pred_label, pred_score = max(pred_cats.items(), key=lambda it: it[1])
gold_label, gold_score = max(gold_cats.items(), key=lambda it: it[1])
if pred_label == gold_label and pred_score >= threshold:
if pred_label == gold_label:
f_per_type[pred_label].tp += 1
else:
f_per_type[gold_label].fn += 1
if pred_score >= threshold:
f_per_type[pred_label].fp += 1
elif gold_cats:
gold_label, gold_score = max(gold_cats, key=lambda it: it[1])
@ -517,7 +518,6 @@ class Scorer:
f_per_type[gold_label].fn += 1
elif pred_cats:
pred_label, pred_score = max(pred_cats.items(), key=lambda it: it[1])
if pred_score >= threshold:
f_per_type[pred_label].fp += 1
micro_prf = PRFScore()
for label_prf in f_per_type.values():

21
spacy/strings.pxd
View File

@ -1,4 +1,4 @@
from libc.stdint cimport int64_t
from libc.stdint cimport int64_t, uint32_t
from libcpp.vector cimport vector
from libcpp.set cimport set
from cymem.cymem cimport Pool
@ -7,13 +7,6 @@ from murmurhash.mrmr cimport hash64
from .typedefs cimport attr_t, hash_t
cpdef hash_t hash_string(str string) except 0
cdef hash_t hash_utf8(char* utf8_string, int length) nogil
cdef str decode_Utf8Str(const Utf8Str* string)
ctypedef union Utf8Str:
unsigned char[8] s
unsigned char* p
@ -21,9 +14,13 @@ ctypedef union Utf8Str:
cdef class StringStore:
cdef Pool mem
cdef vector[hash_t] _keys
cdef PreshMap _map
cdef vector[hash_t] keys
cdef public PreshMap _map
cdef hash_t _intern_str(self, str string)
cdef Utf8Str* _allocate_str_repr(self, const unsigned char* chars, uint32_t length) except *
cdef str _decode_str_repr(self, const Utf8Str* string)
cdef const Utf8Str* intern_unicode(self, str py_string)
cdef const Utf8Str* _intern_utf8(self, char* utf8_string, int length, hash_t* precalculated_hash)
cpdef hash_t hash_string(object string) except -1
cpdef hash_t get_string_id(object string_or_hash) except -1

23
spacy/strings.pyi
View File

@ -1,21 +1,20 @@
from typing import Optional, Iterable, Iterator, Union, Any, overload
from typing import List, Optional, Iterable, Iterator, Union, Any, Tuple, overload
from pathlib import Path
def get_string_id(key: Union[str, int]) -> int: ...
class StringStore:
def __init__(
self, strings: Optional[Iterable[str]] = ..., freeze: bool = ...
) -> None: ...
def __init__(self, strings: Optional[Iterable[str]]) -> None: ...
@overload
def __getitem__(self, string_or_id: Union[bytes, str]) -> int: ...
def __getitem__(self, string_or_hash: str) -> int: ...
@overload
def __getitem__(self, string_or_id: int) -> str: ...
def as_int(self, key: Union[bytes, str, int]) -> int: ...
def as_string(self, key: Union[bytes, str, int]) -> str: ...
def __getitem__(self, string_or_hash: int) -> str: ...
def as_int(self, string_or_hash: Union[str, int]) -> int: ...
def as_string(self, string_or_hash: Union[str, int]) -> str: ...
def add(self, string: str) -> int: ...
def items(self) -> List[Tuple[str, int]]: ...
def keys(self) -> List[str]: ...
def values(self) -> List[int]: ...
def __len__(self) -> int: ...
def __contains__(self, string: str) -> bool: ...
def __contains__(self, string_or_hash: Union[str, int]) -> bool: ...
def __iter__(self) -> Iterator[str]: ...
def __reduce__(self) -> Any: ...
def to_disk(self, path: Union[str, Path]) -> None: ...
@ -23,3 +22,5 @@ class StringStore:
def to_bytes(self, **kwargs: Any) -> bytes: ...
def from_bytes(self, bytes_data: bytes, **kwargs: Any) -> StringStore: ...
def _reset_and_load(self, strings: Iterable[str]) -> None: ...
def get_string_id(string_or_hash: Union[str, int]) -> int: ...

426
spacy/strings.pyx
View File

@ -1,9 +1,10 @@
# cython: infer_types=True
from typing import Optional, Union, Iterable, Tuple, Callable, Any, List, Iterator
cimport cython
from libc.string cimport memcpy
from libcpp.set cimport set
from libc.stdint cimport uint32_t
from murmurhash.mrmr cimport hash64, hash32
from murmurhash.mrmr cimport hash64
import srsly
@ -14,105 +15,13 @@ from .symbols import NAMES as SYMBOLS_BY_INT
from .errors import Errors
from . import util
# Not particularly elegant, but this is faster than `isinstance(key, numbers.Integral)`
cdef inline bint _try_coerce_to_hash(object key, hash_t* out_hash):
try:
out_hash[0] = key
return True
except:
return False
def get_string_id(key):
"""Get a string ID, handling the reserved symbols correctly. If the key is
already an ID, return it.
This function optimises for convenience over performance, so shouldn't be
used in tight loops.
"""
cdef hash_t str_hash
if isinstance(key, str):
if len(key) == 0:
return 0
symbol = SYMBOLS_BY_STR.get(key, None)
if symbol is not None:
return symbol
else:
chars = key.encode("utf8")
return hash_utf8(chars, len(chars))
elif _try_coerce_to_hash(key, &str_hash):
# Coerce the integral key to the expected primitive hash type.
# This ensures that custom/overloaded "primitive" data types
# such as those implemented by numpy are not inadvertently used
# downsteam (as these are internally implemented as custom PyObjects
# whose comparison operators can incur a significant overhead).
return str_hash
else:
# TODO: Raise an error instead
return key
cpdef hash_t hash_string(str string) except 0:
chars = string.encode("utf8")
return hash_utf8(chars, len(chars))
cdef hash_t hash_utf8(char* utf8_string, int length) nogil:
return hash64(utf8_string, length, 1)
cdef uint32_t hash32_utf8(char* utf8_string, int length) nogil:
return hash32(utf8_string, length, 1)
cdef str decode_Utf8Str(const Utf8Str* string):
cdef int i, length
if string.s[0] < sizeof(string.s) and string.s[0] != 0:
return string.s[1:string.s[0]+1].decode("utf8")
elif string.p[0] < 255:
return string.p[1:string.p[0]+1].decode("utf8")
else:
i = 0
length = 0
while string.p[i] == 255:
i += 1
length += 255
length += string.p[i]
i += 1
return string.p[i:length + i].decode("utf8")
cdef Utf8Str* _allocate(Pool mem, const unsigned char* chars, uint32_t length) except *:
cdef int n_length_bytes
cdef int i
cdef Utf8Str* string = <Utf8Str*>mem.alloc(1, sizeof(Utf8Str))
cdef uint32_t ulength = length
if length < sizeof(string.s):
string.s[0] = <unsigned char>length
memcpy(&string.s[1], chars, length)
return string
elif length < 255:
string.p = <unsigned char*>mem.alloc(length + 1, sizeof(unsigned char))
string.p[0] = length
memcpy(&string.p[1], chars, length)
return string
else:
i = 0
n_length_bytes = (length // 255) + 1
string.p = <unsigned char*>mem.alloc(length + n_length_bytes, sizeof(unsigned char))
for i in range(n_length_bytes-1):
string.p[i] = 255
string.p[n_length_bytes-1] = length % 255
memcpy(&string.p[n_length_bytes], chars, length)
return string
cdef class StringStore:
"""Look up strings by 64-bit hashes.
"""Look up strings by 64-bit hashes. Implicitly handles reserved symbols.
DOCS: https://spacy.io/api/stringstore
"""
def __init__(self, strings=None, freeze=False):
def __init__(self, strings: Optional[Iterable[str]] = None):
"""Create the StringStore.
strings (iterable): A sequence of unicode strings to add to the store.
@ -123,128 +32,127 @@ cdef class StringStore:
for string in strings:
self.add(string)
def __getitem__(self, object string_or_id):
"""Retrieve a string from a given hash, or vice versa.
def __getitem__(self, string_or_hash: Union[str, int]) -> Union[str, int]:
"""Retrieve a string from a given hash. If a string
is passed as the input, add it to the store and return
its hash.
string_or_id (bytes, str or uint64): The value to encode.
Returns (str / uint64): The value to be retrieved.
string_or_hash (int / str): The hash value to lookup or the string to store.
RETURNS (str / int): The stored string or the hash of the newly added string.
"""
cdef hash_t str_hash
cdef Utf8Str* utf8str = NULL
if isinstance(string_or_id, str):
if len(string_or_id) == 0:
return 0
# Return early if the string is found in the symbols LUT.
symbol = SYMBOLS_BY_STR.get(string_or_id, None)
if symbol is not None:
return symbol
if isinstance(string_or_hash, str):
return self.add(string_or_hash)
else:
return hash_string(string_or_id)
elif isinstance(string_or_id, bytes):
return hash_utf8(string_or_id, len(string_or_id))
elif _try_coerce_to_hash(string_or_id, &str_hash):
if str_hash == 0:
return ""
elif str_hash in SYMBOLS_BY_INT:
return SYMBOLS_BY_INT[str_hash]
else:
utf8str = <Utf8Str*>self._map.get(str_hash)
else:
# TODO: Raise an error instead
utf8str = <Utf8Str*>self._map.get(string_or_id)
return self._get_interned_str(string_or_hash)
if utf8str is NULL:
raise KeyError(Errors.E018.format(hash_value=string_or_id))
else:
return decode_Utf8Str(utf8str)
def __contains__(self, string_or_hash: Union[str, int]) -> bool:
"""Check whether a string or a hash is in the store.
def as_int(self, key):
"""If key is an int, return it; otherwise, get the int value."""
if not isinstance(key, str):
return key
else:
return self[key]
def as_string(self, key):
"""If key is a string, return it; otherwise, get the string value."""
if isinstance(key, str):
return key
else:
return self[key]
def add(self, string):
"""Add a string to the StringStore.
string (str): The string to add.
RETURNS (uint64): The string's hash value.
"""
cdef hash_t str_hash
if isinstance(string, str):
if string in SYMBOLS_BY_STR:
return SYMBOLS_BY_STR[string]
string = string.encode("utf8")
str_hash = hash_utf8(string, len(string))
self._intern_utf8(string, len(string), &str_hash)
elif isinstance(string, bytes):
if string in SYMBOLS_BY_STR:
return SYMBOLS_BY_STR[string]
str_hash = hash_utf8(string, len(string))
self._intern_utf8(string, len(string), &str_hash)
else:
raise TypeError(Errors.E017.format(value_type=type(string)))
return str_hash
def __len__(self):
"""The number of strings in the store.
RETURNS (int): The number of strings in the store.
"""
return self.keys.size()
def __contains__(self, string_or_id not None):
"""Check whether a string or ID is in the store.
string_or_id (str or int): The string to check.
string (str / int): The string/hash to check.
RETURNS (bool): Whether the store contains the string.
"""
cdef hash_t str_hash
if isinstance(string_or_id, str):
if len(string_or_id) == 0:
return True
elif string_or_id in SYMBOLS_BY_STR:
return True
str_hash = hash_string(string_or_id)
elif _try_coerce_to_hash(string_or_id, &str_hash):
pass
else:
# TODO: Raise an error instead
return self._map.get(string_or_id) is not NULL
cdef hash_t str_hash = get_string_id(string_or_hash)
if str_hash in SYMBOLS_BY_INT:
return True
else:
return self._map.get(str_hash) is not NULL
def __iter__(self):
"""Iterate over the strings in the store, in order.
def __iter__(self) -> Iterator[str]:
"""Iterate over the strings in the store in insertion order.
YIELDS (str): A string in the store.
RETURNS: An iterable collection of strings.
"""
cdef int i
cdef hash_t key
for i in range(self.keys.size()):
key = self.keys[i]
utf8str = <Utf8Str*>self._map.get(key)
yield decode_Utf8Str(utf8str)
# TODO: Iterate OOV here?
return iter(self.keys())
def __reduce__(self):
strings = list(self)
return (StringStore, (strings,), None, None, None)
def __len__(self) -> int:
"""The number of strings in the store.
RETURNS (int): The number of strings in the store.
"""
return self._keys.size()
def add(self, string: str) -> int:
"""Add a string to the StringStore.
string (str): The string to add.
RETURNS (uint64): The string's hash value.
"""
if not isinstance(string, str):
raise TypeError(Errors.E017.format(value_type=type(string)))
if string in SYMBOLS_BY_STR:
return SYMBOLS_BY_STR[string]
else:
return self._intern_str(string)
def as_int(self, string_or_hash: Union[str, int]) -> str:
"""If a hash value is passed as the input, return it as-is. If the input
is a string, return its corresponding hash.
string_or_hash (str / int): The string to hash or a hash value.
RETURNS (int): The hash of the string or the input hash value.
"""
if isinstance(string_or_hash, int):
return string_or_hash
else:
return get_string_id(string_or_hash)
def as_string(self, string_or_hash: Union[str, int]) -> str:
"""If a string is passed as the input, return it as-is. If the input
is a hash value, return its corresponding string.
string_or_hash (str / int): The hash value to lookup or a string.
RETURNS (str): The stored string or the input string.
"""
if isinstance(string_or_hash, str):
return string_or_hash
else:
return self._get_interned_str(string_or_hash)
def items(self) -> List[Tuple[str, int]]:
"""Iterate over the stored strings and their hashes in insertion order.
RETURNS: A list of string-hash pairs.
"""
# Even though we internally store the hashes as keys and the strings as
# values, we invert the order in the public API to keep it consistent with
# the implementation of the `__iter__` method (where we wish to iterate over
# the strings in the store).
cdef int i
pairs = [None] * self._keys.size()
for i in range(self._keys.size()):
str_hash = self._keys[i]
utf8str = <Utf8Str*>self._map.get(str_hash)
pairs[i] = (self._decode_str_repr(utf8str), str_hash)
return pairs
def keys(self) -> List[str]:
"""Iterate over the stored strings in insertion order.
RETURNS: A list of strings.
"""
cdef int i
strings = [None] * self._keys.size()
for i in range(self._keys.size()):
utf8str = <Utf8Str*>self._map.get(self._keys[i])
strings[i] = self._decode_str_repr(utf8str)
return strings
def values(self) -> List[int]:
"""Iterate over the stored strings hashes in insertion order.
RETURNS: A list of string hashs.
"""
cdef int i
hashes = [None] * self._keys.size()
for i in range(self._keys.size()):
hashes[i] = self._keys[i]
return hashes
def to_disk(self, path):
"""Save the current state to a directory.
@ -294,24 +202,122 @@ cdef class StringStore:
def _reset_and_load(self, strings):
self.mem = Pool()
self._map = PreshMap()
self.keys.clear()
self._keys.clear()
for string in strings:
self.add(string)
cdef const Utf8Str* intern_unicode(self, str py_string):
# 0 means missing, but we don't bother offsetting the index.
cdef bytes byte_string = py_string.encode("utf8")
return self._intern_utf8(byte_string, len(byte_string), NULL)
def _get_interned_str(self, hash_value: int) -> str:
cdef hash_t str_hash
if not _try_coerce_to_hash(hash_value, &str_hash):
raise TypeError(Errors.E4001.format(expected_types="'int'", received_type=type(hash_value)))
@cython.final
cdef const Utf8Str* _intern_utf8(self, char* utf8_string, int length, hash_t* precalculated_hash):
# Handle reserved symbols and empty strings correctly.
if str_hash == 0:
return ""
symbol = SYMBOLS_BY_INT.get(str_hash)
if symbol is not None:
return symbol
utf8str = <Utf8Str*>self._map.get(str_hash)
if utf8str is NULL:
raise KeyError(Errors.E018.format(hash_value=str_hash))
else:
return self._decode_str_repr(utf8str)
cdef hash_t _intern_str(self, str string):
# TODO: This function's API/behaviour is an unholy mess...
# 0 means missing, but we don't bother offsetting the index.
cdef hash_t key = precalculated_hash[0] if precalculated_hash is not NULL else hash_utf8(utf8_string, length)
chars = string.encode('utf-8')
cdef hash_t key = hash64(<unsigned char*>chars, len(chars), 1)
cdef Utf8Str* value = <Utf8Str*>self._map.get(key)
if value is not NULL:
return value
value = _allocate(self.mem, <unsigned char*>utf8_string, length)
return key
value = self._allocate_str_repr(<unsigned char*>chars, len(chars))
self._map.set(key, value)
self.keys.push_back(key)
return value
self._keys.push_back(key)
return key
cdef Utf8Str* _allocate_str_repr(self, const unsigned char* chars, uint32_t length) except *:
cdef int n_length_bytes
cdef int i
cdef Utf8Str* string = <Utf8Str*>self.mem.alloc(1, sizeof(Utf8Str))
cdef uint32_t ulength = length
if length < sizeof(string.s):
string.s[0] = <unsigned char>length
memcpy(&string.s[1], chars, length)
return string
elif length < 255:
string.p = <unsigned char*>self.mem.alloc(length + 1, sizeof(unsigned char))
string.p[0] = length
memcpy(&string.p[1], chars, length)
return string
else:
i = 0
n_length_bytes = (length // 255) + 1
string.p = <unsigned char*>self.mem.alloc(length + n_length_bytes, sizeof(unsigned char))
for i in range(n_length_bytes-1):
string.p[i] = 255
string.p[n_length_bytes-1] = length % 255
memcpy(&string.p[n_length_bytes], chars, length)
return string
cdef str _decode_str_repr(self, const Utf8Str* string):
cdef int i, length
if string.s[0] < sizeof(string.s) and string.s[0] != 0:
return string.s[1:string.s[0]+1].decode('utf-8')
elif string.p[0] < 255:
return string.p[1:string.p[0]+1].decode('utf-8')
else:
i = 0
length = 0
while string.p[i] == 255:
i += 1
length += 255
length += string.p[i]
i += 1
return string.p[i:length + i].decode('utf-8')
cpdef hash_t hash_string(object string) except -1:
if not isinstance(string, str):
raise TypeError(Errors.E4001.format(expected_types="'str'", received_type=type(string)))
# Handle reserved symbols and empty strings correctly.
if len(string) == 0:
return 0
symbol = SYMBOLS_BY_STR.get(string)
if symbol is not None:
return symbol
chars = string.encode('utf-8')
return hash64(<unsigned char*>chars, len(chars), 1)
cpdef hash_t get_string_id(object string_or_hash) except -1:
cdef hash_t str_hash
try:
return hash_string(string_or_hash)
except:
if _try_coerce_to_hash(string_or_hash, &str_hash):
# Coerce the integral key to the expected primitive hash type.
# This ensures that custom/overloaded "primitive" data types
# such as those implemented by numpy are not inadvertently used
# downsteam (as these are internally implemented as custom PyObjects
# whose comparison operators can incur a significant overhead).
return str_hash
else:
raise TypeError(Errors.E4001.format(expected_types="'str','int'", received_type=type(string_or_hash)))
# Not particularly elegant, but this is faster than `isinstance(key, numbers.Integral)`
cdef inline bint _try_coerce_to_hash(object key, hash_t* out_hash):
try:
out_hash[0] = key
return True
except:
return False

2
spacy/tests/README.md
View File

@ -40,7 +40,7 @@ py.test spacy/tests/tokenizer/test_exceptions.py::test_tokenizer_handles_emoji #
To keep the behavior of the tests consistent and predictable, we try to follow a few basic conventions:
- **Test names** should follow a pattern of `test_[module]_[tested behaviour]`. For example: `test_tokenizer_keeps_email` or `test_spans_override_sentiment`.
- **Test names** should follow a pattern of `test_[module]_[tested behaviour]`. For example: `test_tokenizer_keeps_email`.
- If you're testing for a bug reported in a specific issue, always create a **regression test**. Regression tests should be named `test_issue[ISSUE NUMBER]` and live in the [`regression`](regression) directory.
- Only use `@pytest.mark.xfail` for tests that **should pass, but currently fail**. To test for desired negative behavior, use `assert not` in your test.
- Very **extensive tests** that take a long time to run should be marked with `@pytest.mark.slow`. If your slow test is testing important behavior, consider adding an additional simpler version.

23
spacy/tests/conftest.py
View File

@ -1,10 +1,10 @@
import pytest
from spacy.util import get_lang_class
import functools
from hypothesis import settings
import inspect
import importlib
import sys
from hypothesis import settings
# Functionally disable deadline settings for tests
# to prevent spurious test failures in CI builds.
@ -382,12 +382,20 @@ def ru_tokenizer():
return get_lang_class("ru")().tokenizer
@pytest.fixture
@pytest.fixture(scope="session")
def ru_lemmatizer():
pytest.importorskip("pymorphy3")
return get_lang_class("ru")().add_pipe("lemmatizer")
@pytest.fixture(scope="session")
def ru_lookup_lemmatizer():
pytest.importorskip("pymorphy3")
return get_lang_class("ru")().add_pipe(
"lemmatizer", config={"mode": "pymorphy3_lookup"}
)
@pytest.fixture(scope="session")
def sa_tokenizer():
return get_lang_class("sa")().tokenizer
@ -460,13 +468,22 @@ def uk_tokenizer():
return get_lang_class("uk")().tokenizer
@pytest.fixture
@pytest.fixture(scope="session")
def uk_lemmatizer():
pytest.importorskip("pymorphy3")
pytest.importorskip("pymorphy3_dicts_uk")
return get_lang_class("uk")().add_pipe("lemmatizer")
@pytest.fixture(scope="session")
def uk_lookup_lemmatizer():
pytest.importorskip("pymorphy3")
pytest.importorskip("pymorphy3_dicts_uk")
return get_lang_class("uk")().add_pipe(
"lemmatizer", config={"mode": "pymorphy3_lookup"}
)
@pytest.fixture(scope="session")
def ur_tokenizer():
return get_lang_class("ur")().tokenizer

4
spacy/tests/doc/test_array.py
View File

@ -123,14 +123,14 @@ def test_doc_from_array_heads_in_bounds(en_vocab):
# head before start
arr = doc.to_array(["HEAD"])
arr[0] = -1
arr[0] = numpy.int32(-1).astype(numpy.uint64)
doc_from_array = Doc(en_vocab, words=words)
with pytest.raises(ValueError):
doc_from_array.from_array(["HEAD"], arr)
# head after end
arr = doc.to_array(["HEAD"])
arr[0] = 5
arr[0] = numpy.int32(5).astype(numpy.uint64)
doc_from_array = Doc(en_vocab, words=words)
with pytest.raises(ValueError):
doc_from_array.from_array(["HEAD"], arr)

28
spacy/tests/doc/test_doc_api.py
View File

@ -82,6 +82,21 @@ def test_issue2396(en_vocab):
assert (span.get_lca_matrix() == matrix).all()
@pytest.mark.issue(11499)
def test_init_args_unmodified(en_vocab):
words = ["A", "sentence"]
ents = ["B-TYPE1", ""]
sent_starts = [True, False]
Doc(
vocab=en_vocab,
words=words,
ents=ents,
sent_starts=sent_starts,
)
assert ents == ["B-TYPE1", ""]
assert sent_starts == [True, False]
@pytest.mark.parametrize("text", ["-0.23", "+123,456", "±1"])
@pytest.mark.parametrize("lang_cls", [English, MultiLanguage])
@pytest.mark.issue(2782)
@ -365,9 +380,7 @@ def test_doc_api_serialize(en_tokenizer, text):
assert [t.text for t in tokens] == [t.text for t in new_tokens]
assert [t.orth for t in tokens] == [t.orth for t in new_tokens]
new_tokens = Doc(tokens.vocab).from_bytes(
tokens.to_bytes(exclude=["sentiment"]), exclude=["sentiment"]
)
new_tokens = Doc(tokens.vocab).from_bytes(tokens.to_bytes())
assert tokens.text == new_tokens.text
assert [t.text for t in tokens] == [t.text for t in new_tokens]
assert [t.orth for t in tokens] == [t.orth for t in new_tokens]
@ -975,3 +988,12 @@ def test_doc_spans_setdefault(en_tokenizer):
assert len(doc.spans["key2"]) == 1
doc.spans.setdefault("key3", default=SpanGroup(doc, spans=[doc[0:1], doc[1:2]]))
assert len(doc.spans["key3"]) == 2
def test_doc_sentiment_from_bytes_v3_to_v4():
"""Test if a doc with sentiment attribute created in v3.x works with '.from_bytes' in v4.x without throwing errors. The sentiment attribute was removed in v4"""
doc_bytes = b"\x89\xa4text\xa5happy\xaaarray_head\x9fGQACKOLMN\xcd\x01\xc4\xcd\x01\xc6I\xcd\x01\xc5JP\xaaarray_body\x85\xc4\x02nd\xc3\xc4\x04type\xa3<u8\xc4\x04kind\xc4\x00\xc4\x05shape\x92\x01\x0f\xc4\x04data\xc4x\x05\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\xa4\x9a\xd3\x17\xca\xf0b\x03\xa4\x9a\xd3\x17\xca\xf0b\x03\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x00\x01\x00\x00\x00\x00\x00\x00\x00\xa9sentiment\xcb?\xf0\x00\x00\x00\x00\x00\x00\xa6tensor\x85\xc4\x02nd\xc3\xc4\x04type\xa3<f4\xc4\x04kind\xc4\x00\xc4\x05shape\x91\x00\xc4\x04data\xc4\x00\xa4cats\x80\xa5spans\xc4\x01\x90\xa7strings\x92\xa0\xa5happy\xb2has_unknown_spaces\xc2"
doc = Doc(Vocab()).from_bytes(doc_bytes)
assert doc.text == "happy"
with pytest.raises(AttributeError):
doc.sentiment == 1.0

34
spacy/tests/doc/test_json_doc_conversion.py
View File

@ -128,7 +128,9 @@ def test_doc_to_json_with_token_span_attributes(doc):
doc._.json_test1 = "hello world"
doc._.json_test2 = [1, 2, 3]
doc[0:1]._.span_test = "span_attribute"
doc[0:2]._.span_test = "span_attribute_2"
doc[0]._.token_test = 117
doc[1]._.token_test = 118
doc.spans["span_group"] = [doc[0:1]]
json_doc = doc.to_json(
underscore=["json_test1", "json_test2", "token_test", "span_test"]
@ -139,8 +141,10 @@ def test_doc_to_json_with_token_span_attributes(doc):
assert json_doc["_"]["json_test2"] == [1, 2, 3]
assert "underscore_token" in json_doc
assert "underscore_span" in json_doc
assert json_doc["underscore_token"]["token_test"]["value"] == 117
assert json_doc["underscore_span"]["span_test"]["value"] == "span_attribute"
assert json_doc["underscore_token"]["token_test"][0]["value"] == 117
assert json_doc["underscore_token"]["token_test"][1]["value"] == 118
assert json_doc["underscore_span"]["span_test"][0]["value"] == "span_attribute"
assert json_doc["underscore_span"]["span_test"][1]["value"] == "span_attribute_2"
assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc
@ -161,8 +165,8 @@ def test_doc_to_json_with_custom_user_data(doc):
assert json_doc["_"]["json_test"] == "hello world"
assert "underscore_token" in json_doc
assert "underscore_span" in json_doc
assert json_doc["underscore_token"]["token_test"]["value"] == 117
assert json_doc["underscore_span"]["span_test"]["value"] == "span_attribute"
assert json_doc["underscore_token"]["token_test"][0]["value"] == 117
assert json_doc["underscore_span"]["span_test"][0]["value"] == "span_attribute"
assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc
@ -181,8 +185,8 @@ def test_doc_to_json_with_token_span_same_identifier(doc):
assert json_doc["_"]["my_ext"] == "hello world"
assert "underscore_token" in json_doc
assert "underscore_span" in json_doc
assert json_doc["underscore_token"]["my_ext"]["value"] == 117
assert json_doc["underscore_span"]["my_ext"]["value"] == "span_attribute"
assert json_doc["underscore_token"]["my_ext"][0]["value"] == 117
assert json_doc["underscore_span"]["my_ext"][0]["value"] == "span_attribute"
assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
assert srsly.json_loads(srsly.json_dumps(json_doc)) == json_doc
@ -195,10 +199,9 @@ def test_doc_to_json_with_token_attributes_missing(doc):
doc[0]._.token_test = 117
json_doc = doc.to_json(underscore=["span_test"])
assert "underscore_token" in json_doc
assert "underscore_span" in json_doc
assert json_doc["underscore_span"]["span_test"]["value"] == "span_attribute"
assert "token_test" not in json_doc["underscore_token"]
assert json_doc["underscore_span"]["span_test"][0]["value"] == "span_attribute"
assert "underscore_token" not in json_doc
assert len(schemas.validate(schemas.DocJSONSchema, json_doc)) == 0
@ -283,7 +286,9 @@ def test_json_to_doc_with_token_span_attributes(doc):
doc._.json_test1 = "hello world"
doc._.json_test2 = [1, 2, 3]
doc[0:1]._.span_test = "span_attribute"
doc[0:2]._.span_test = "span_attribute_2"
doc[0]._.token_test = 117
doc[1]._.token_test = 118
json_doc = doc.to_json(
underscore=["json_test1", "json_test2", "token_test", "span_test"]
@ -295,7 +300,9 @@ def test_json_to_doc_with_token_span_attributes(doc):
assert new_doc._.json_test1 == "hello world"
assert new_doc._.json_test2 == [1, 2, 3]
assert new_doc[0]._.token_test == 117
assert new_doc[1]._.token_test == 118
assert new_doc[0:1]._.span_test == "span_attribute"
assert new_doc[0:2]._.span_test == "span_attribute_2"
assert new_doc.user_data == doc.user_data
assert new_doc.to_bytes(exclude=["user_data"]) == doc.to_bytes(
exclude=["user_data"]
@ -363,3 +370,12 @@ def test_json_to_doc_validation_error(doc):
doc_json.pop("tokens")
with pytest.raises(ValueError):
Doc(doc.vocab).from_json(doc_json, validate=True)
def test_to_json_underscore_doc_getters(doc):
def get_text_length(doc):
return len(doc.text)
Doc.set_extension("text_length", getter=get_text_length)
doc_json = doc.to_json(underscore=["text_length"])
assert doc_json["_"]["text_length"] == get_text_length(doc)

25
spacy/tests/doc/test_span.py
View File

@ -305,31 +305,6 @@ def test_span_similarity_match():
assert span1[:1].similarity(doc.vocab["a"]) == 1.0
def test_spans_default_sentiment(en_tokenizer):
"""Test span.sentiment property's default averaging behaviour"""
text = "good stuff bad stuff"
tokens = en_tokenizer(text)
tokens.vocab[tokens[0].text].sentiment = 3.0
tokens.vocab[tokens[2].text].sentiment = -2.0
doc = Doc(tokens.vocab, words=[t.text for t in tokens])
assert doc[:2].sentiment == 3.0 / 2
assert doc[-2:].sentiment == -2.0 / 2
assert doc[:-1].sentiment == (3.0 + -2) / 3.0
def test_spans_override_sentiment(en_tokenizer):
"""Test span.sentiment property's default averaging behaviour"""
text = "good stuff bad stuff"
tokens = en_tokenizer(text)
tokens.vocab[tokens[0].text].sentiment = 3.0
tokens.vocab[tokens[2].text].sentiment = -2.0
doc = Doc(tokens.vocab, words=[t.text for t in tokens])
doc.user_span_hooks["sentiment"] = lambda span: 10.0
assert doc[:2].sentiment == 10.0
assert doc[-2:].sentiment == 10.0
assert doc[:-1].sentiment == 10.0
def test_spans_are_hashable(en_tokenizer):
"""Test spans can be hashed."""
text = "good stuff bad stuff"

15
spacy/tests/doc/test_span_group.py
View File

@ -1,7 +1,10 @@
from typing import List
import pytest
from random import Random
from spacy.matcher import Matcher
from spacy.tokens import Span, SpanGroup
from spacy.tokens import Span, SpanGroup, Doc
from spacy.util import filter_spans
@pytest.fixture
@ -242,3 +245,13 @@ def test_span_group_extend(doc):
def test_span_group_dealloc(span_group):
with pytest.raises(AttributeError):
print(span_group.doc)
@pytest.mark.issue(11975)
def test_span_group_typing(doc: Doc):
"""Tests whether typing of `SpanGroup` as `Iterable[Span]`-like object is accepted by mypy."""
span_group: SpanGroup = doc.spans["SPANS"]
spans: List[Span] = list(span_group)
for i, span in enumerate(span_group):
assert span == span_group[i] == spans[i]
filter_spans(span_group)

119
spacy/tests/doc/test_underscore.py
View File

@ -3,6 +3,10 @@ from mock import Mock
from spacy.tokens import Doc, Span, Token
from spacy.tokens.underscore import Underscore
# Helper functions
def _get_tuple(s: Span):
return "._.", "span_extension", s.start_char, s.end_char, s.label, s.kb_id, s.id
@pytest.fixture(scope="function", autouse=True)
def clean_underscore():
@ -171,3 +175,118 @@ def test_underscore_docstring(en_vocab):
doc = Doc(en_vocab, words=["hello", "world"])
assert test_method.__doc__ == "I am a docstring"
assert doc._.test_docstrings.__doc__.rsplit(". ")[-1] == "I am a docstring"
def test_underscore_for_unique_span(en_tokenizer):
"""Test that spans with the same boundaries but with different labels are uniquely identified (see #9706)."""
Doc.set_extension(name="doc_extension", default=None)
Span.set_extension(name="span_extension", default=None)
Token.set_extension(name="token_extension", default=None)
# Initialize doc
text = "Hello, world!"
doc = en_tokenizer(text)
span_1 = Span(doc, 0, 2, "SPAN_1")
span_2 = Span(doc, 0, 2, "SPAN_2")
# Set custom extensions
doc._.doc_extension = "doc extension"
doc[0]._.token_extension = "token extension"
span_1._.span_extension = "span_1 extension"
span_2._.span_extension = "span_2 extension"
# Assert extensions
assert doc.user_data[_get_tuple(span_1)] == "span_1 extension"
assert doc.user_data[_get_tuple(span_2)] == "span_2 extension"
# Change label of span and assert extensions
span_1.label_ = "NEW_LABEL"
assert doc.user_data[_get_tuple(span_1)] == "span_1 extension"
assert doc.user_data[_get_tuple(span_2)] == "span_2 extension"
# Change KB_ID and assert extensions
span_1.kb_id_ = "KB_ID"
assert doc.user_data[_get_tuple(span_1)] == "span_1 extension"
assert doc.user_data[_get_tuple(span_2)] == "span_2 extension"
# Change extensions and assert
span_2._.span_extension = "updated span_2 extension"
assert doc.user_data[_get_tuple(span_1)] == "span_1 extension"
assert doc.user_data[_get_tuple(span_2)] == "updated span_2 extension"
# Change span ID and assert extensions
span_2.id = 2
assert doc.user_data[_get_tuple(span_1)] == "span_1 extension"
assert doc.user_data[_get_tuple(span_2)] == "updated span_2 extension"
# Assert extensions with original key
assert doc.user_data[("._.", "doc_extension", None, None)] == "doc extension"
assert doc.user_data[("._.", "token_extension", 0, None)] == "token extension"
def test_underscore_for_unique_span_from_docs(en_tokenizer):
"""Test that spans in the user_data keep the same data structure when using Doc.from_docs"""
Span.set_extension(name="span_extension", default=None)
Token.set_extension(name="token_extension", default=None)
# Initialize doc
text_1 = "Hello, world!"
doc_1 = en_tokenizer(text_1)
span_1a = Span(doc_1, 0, 2, "SPAN_1a")
span_1b = Span(doc_1, 0, 2, "SPAN_1b")
text_2 = "This is a test."
doc_2 = en_tokenizer(text_2)
span_2a = Span(doc_2, 0, 3, "SPAN_2a")
# Set custom extensions
doc_1[0]._.token_extension = "token_1"
doc_2[1]._.token_extension = "token_2"
span_1a._.span_extension = "span_1a extension"
span_1b._.span_extension = "span_1b extension"
span_2a._.span_extension = "span_2a extension"
doc = Doc.from_docs([doc_1, doc_2])
# Assert extensions
assert doc_1.user_data[_get_tuple(span_1a)] == "span_1a extension"
assert doc_1.user_data[_get_tuple(span_1b)] == "span_1b extension"
assert doc_2.user_data[_get_tuple(span_2a)] == "span_2a extension"
# Check extensions on merged doc
assert doc.user_data[_get_tuple(span_1a)] == "span_1a extension"
assert doc.user_data[_get_tuple(span_1b)] == "span_1b extension"
assert (
doc.user_data[
(
"._.",
"span_extension",
span_2a.start_char + len(doc_1.text) + 1,
span_2a.end_char + len(doc_1.text) + 1,
span_2a.label,
span_2a.kb_id,
span_2a.id,
)
]
== "span_2a extension"
)
def test_underscore_for_unique_span_as_span(en_tokenizer):
"""Test that spans in the user_data keep the same data structure when using Span.as_doc"""
Span.set_extension(name="span_extension", default=None)
# Initialize doc
text = "Hello, world!"
doc = en_tokenizer(text)
span_1 = Span(doc, 0, 2, "SPAN_1")
span_2 = Span(doc, 0, 2, "SPAN_2")
# Set custom extensions
span_1._.span_extension = "span_1 extension"
span_2._.span_extension = "span_2 extension"
span_doc = span_1.as_doc(copy_user_data=True)
# Assert extensions
assert span_doc.user_data[_get_tuple(span_1)] == "span_1 extension"
assert span_doc.user_data[_get_tuple(span_2)] == "span_2 extension"

18
spacy/tests/lang/grc/test_tokenizer.py Normal file
View File

@ -0,0 +1,18 @@
import pytest
# fmt: off
GRC_TOKEN_EXCEPTION_TESTS = [
("τὸ 〈τῆς〉 φιλοσοφίας ἔργον ἔνιοί φασιν ἀπὸ ⟦βαρβάρων⟧ ἄρξαι.", ["τὸ", "〈", "τῆς", "〉", "φιλοσοφίας", "ἔργον", "ἔνιοί", "φασιν", "ἀπὸ", "⟦", "βαρβάρων", "⟧", "ἄρξαι", "."]),
("τὴν δὲ τῶν Αἰγυπτίων φιλοσοφίαν εἶναι τοιαύτην περί τε †θεῶν† καὶ ὑπὲρ δικαιοσύνης.", ["τὴν", "δὲ", "τῶν", "Αἰγυπτίων", "φιλοσοφίαν", "εἶναι", "τοιαύτην", "περί", "τε", "†", "θεῶν", "†", "καὶ", "ὑπὲρ", "δικαιοσύνης", "."]),
("⸏πόσις δ' Ἐρεχθεύς ἐστί μοι σεσωσμένος⸏", ["⸏", "πόσις", "δ'", "Ἐρεχθεύς", "ἐστί", "μοι", "σεσωσμένος", "⸏"]),
("⸏ὔπνον ἴδωμεν⸎", ["⸏", "ὔπνον", "ἴδωμεν", "⸎"]),
]
# fmt: on
@pytest.mark.parametrize("text,expected_tokens", GRC_TOKEN_EXCEPTION_TESTS)
def test_grc_tokenizer(grc_tokenizer, text, expected_tokens):
tokens = grc_tokenizer(text)
token_list = [token.text for token in tokens if not token.is_space]
assert expected_tokens == token_list

29
spacy/tests/lang/ru/test_lemmatizer.py
View File

@ -78,3 +78,32 @@ def test_ru_lemmatizer_punct(ru_lemmatizer):
assert ru_lemmatizer.pymorphy2_lemmatize(doc[0]) == ['"']
doc = Doc(ru_lemmatizer.vocab, words=["»"], pos=["PUNCT"])
assert ru_lemmatizer.pymorphy2_lemmatize(doc[0]) == ['"']
def test_ru_doc_lookup_lemmatization(ru_lookup_lemmatizer):
assert ru_lookup_lemmatizer.mode == "pymorphy3_lookup"
words = ["мама", "мыла", "раму"]
pos = ["NOUN", "VERB", "NOUN"]
morphs = [
"Animacy=Anim|Case=Nom|Gender=Fem|Number=Sing",
"Aspect=Imp|Gender=Fem|Mood=Ind|Number=Sing|Tense=Past|VerbForm=Fin|Voice=Act",
"Animacy=Anim|Case=Acc|Gender=Fem|Number=Sing",
]
doc = Doc(ru_lookup_lemmatizer.vocab, words=words, pos=pos, morphs=morphs)
doc = ru_lookup_lemmatizer(doc)
lemmas = [token.lemma_ for token in doc]
assert lemmas == ["мама", "мыла", "раму"]
@pytest.mark.parametrize(
"word,lemma",
(
("бременем", "бремя"),
("будешь", "быть"),
("какая-то", "какой-то"),
),
)
def test_ru_lookup_lemmatizer(ru_lookup_lemmatizer, word, lemma):
assert ru_lookup_lemmatizer.mode == "pymorphy3_lookup"
doc = Doc(ru_lookup_lemmatizer.vocab, words=[word])
assert ru_lookup_lemmatizer(doc)[0].lemma_ == lemma

16
spacy/tests/lang/uk/test_lemmatizer.py
View File

@ -8,4 +8,20 @@ pytestmark = pytest.mark.filterwarnings("ignore::DeprecationWarning")
def test_uk_lemmatizer(uk_lemmatizer):
"""Check that the default uk lemmatizer runs."""
doc = Doc(uk_lemmatizer.vocab, words=["a", "b", "c"])
assert uk_lemmatizer.mode == "pymorphy3"
uk_lemmatizer(doc)
assert [token.lemma for token in doc]
@pytest.mark.parametrize(
"word,lemma",
(
("якийсь", "якийсь"),
("розповідають", "розповідати"),
("розповіси", "розповісти"),
),
)
def test_uk_lookup_lemmatizer(uk_lookup_lemmatizer, word, lemma):
assert uk_lookup_lemmatizer.mode == "pymorphy3_lookup"
doc = Doc(uk_lookup_lemmatizer.vocab, words=[word])
assert uk_lookup_lemmatizer(doc)[0].lemma_ == lemma

44
spacy/tests/matcher/test_levenshtein.py Normal file
View File

@ -0,0 +1,44 @@
import pytest
from spacy.matcher import levenshtein
# empty string plus 10 random ASCII, 10 random unicode, and 2 random long tests
# from polyleven
@pytest.mark.parametrize(
"dist,a,b",
[
(0, "", ""),
(4, "bbcb", "caba"),
(3, "abcb", "cacc"),
(3, "aa", "ccc"),
(1, "cca", "ccac"),
(1, "aba", "aa"),
(4, "bcbb", "abac"),
(3, "acbc", "bba"),
(3, "cbba", "a"),
(2, "bcc", "ba"),
(4, "aaa", "ccbb"),
(3, "うあい", "いいうい"),
(2, "あううい", "うあい"),
(3, "いういい", "うううあ"),
(2, "うい", "あいあ"),
(2, "いあい", "いう"),
(1, "いい", "あいい"),
(3, "あうあ", "いいああ"),
(4, "いあうう", "ううああ"),
(3, "いあいい", "ういああ"),
(3, "いいああ", "ううあう"),
(
166,
"TCTGGGCACGGATTCGTCAGATTCCATGTCCATATTTGAGGCTCTTGCAGGCAAAATTTGGGCATGTGAACTCCTTATAGTCCCCGTGC",
"ATATGGATTGGGGGCATTCAAAGATACGGTTTCCCTTTCTTCAGTTTCGCGCGGCGCACGTCCGGGTGCGAGCCAGTTCGTCTTACTCACATTGTCGACTTCACGAATCGCGCATGATGTGCTTAGCCTGTACTTACGAACGAACTTTCGGTCCAAATACATTCTATCAACACCGAGGTATCCGTGCCACACGCCGAAGCTCGACCGTGTTCGTTGAGAGGTGGAAATGGTAAAAGATGAACATAGTC",
),
(
111,
"GGTTCGGCCGAATTCATAGAGCGTGGTAGTCGACGGTATCCCGCCTGGTAGGGGCCCCTTCTACCTAGCGGAAGTTTGTCAGTACTCTATAACACGAGGGCCTCTCACACCCTAGATCGTCCAGCCACTCGAAGATCGCAGCACCCTTACAGAAAGGCATTAATGTTTCTCCTAGCACTTGTGCAATGGTGAAGGAGTGATG",
"CGTAACACTTCGCGCTACTGGGCTGCAACGTCTTGGGCATACATGCAAGATTATCTAATGCAAGCTTGAGCCCCGCTTGCGGAATTTCCCTAATCGGGGTCCCTTCCTGTTACGATAAGGACGCGTGCACT",
),
],
)
def test_levenshtein(dist, a, b):
assert levenshtein(a, b) == dist

3
spacy/tests/matcher/test_matcher_api.py
View File

@ -50,8 +50,6 @@ def test_matcher_from_usage_docs(en_vocab):
def label_sentiment(matcher, doc, i, matches):
match_id, start, end = matches[i]
if doc.vocab.strings[match_id] == "HAPPY":
doc.sentiment += 0.1
span = doc[start:end]
with doc.retokenize() as retokenizer:
retokenizer.merge(span)
@ -61,7 +59,6 @@ def test_matcher_from_usage_docs(en_vocab):
matcher = Matcher(en_vocab)
matcher.add("HAPPY", pos_patterns, on_match=label_sentiment)
matcher(doc)
assert doc.sentiment != 0
assert doc[1].norm_ == "happy emoji"

9
spacy/tests/matcher/test_phrase_matcher.py
View File

@ -87,14 +87,15 @@ def test_issue4373():
@pytest.mark.issue(4651)
def test_issue4651_with_phrase_matcher_attr():
"""Test that the EntityRuler PhraseMatcher is deserialized correctly using
the method from_disk when the EntityRuler argument phrase_matcher_attr is
"""Test that the entity_ruler PhraseMatcher is deserialized correctly using
the method from_disk when the entity_ruler argument phrase_matcher_attr is
specified.
"""
text = "Spacy is a python library for nlp"
nlp = English()
patterns = [{"label": "PYTHON_LIB", "pattern": "spacy", "id": "spaCy"}]
ruler = nlp.add_pipe("entity_ruler", config={"phrase_matcher_attr": "LOWER"})
config = {"phrase_matcher_attr": "LOWER"}
ruler = nlp.add_pipe("entity_ruler", config=config)
ruler.add_patterns(patterns)
doc = nlp(text)
res = [(ent.text, ent.label_, ent.ent_id_) for ent in doc.ents]
@ -102,7 +103,7 @@ def test_issue4651_with_phrase_matcher_attr():
with make_tempdir() as d:
file_path = d / "entityruler"
ruler.to_disk(file_path)
nlp_reloaded.add_pipe("entity_ruler").from_disk(file_path)
nlp_reloaded.add_pipe("entity_ruler", config=config).from_disk(file_path)
doc_reloaded = nlp_reloaded(text)
res_reloaded = [(ent.text, ent.label_, ent.ent_id_) for ent in doc_reloaded.ents]
assert res == res_reloaded

37
spacy/tests/pipeline/test_edit_tree_lemmatizer.py
View File

@ -62,10 +62,45 @@ def test_initialize_from_labels():
nlp2 = Language()
lemmatizer2 = nlp2.add_pipe("trainable_lemmatizer")
lemmatizer2.initialize(
get_examples=lambda: train_examples,
# We want to check that the strings in replacement nodes are
# added to the string store. Avoid that they get added through
# the examples.
get_examples=lambda: train_examples[:1],
labels=lemmatizer.label_data,
)
assert lemmatizer2.tree2label == {1: 0, 3: 1, 4: 2, 6: 3}
assert lemmatizer2.label_data == {
"trees": [
{"orig": "S", "subst": "s"},
{
"prefix_len": 1,
"suffix_len": 0,
"prefix_tree": 0,
"suffix_tree": 4294967295,
},
{"orig": "s", "subst": ""},
{
"prefix_len": 0,
"suffix_len": 1,
"prefix_tree": 4294967295,
"suffix_tree": 2,
},
{
"prefix_len": 0,
"suffix_len": 0,
"prefix_tree": 4294967295,
"suffix_tree": 4294967295,
},
{"orig": "E", "subst": "e"},
{
"prefix_len": 1,
"suffix_len": 0,
"prefix_tree": 5,
"suffix_tree": 4294967295,
},
],
"labels": (1, 3, 4, 6),
}
def test_no_data():

Some files were not shown because too many files have changed in this diff Show More